ID: 950664388

View in Genome Browser
Species Human (GRCh38)
Location 3:14486394-14486416
Sequence CTGTAAACCCAGCTATTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1927
Summary {0: 1, 1: 1, 2: 5, 3: 209, 4: 1711}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950664388_950664394 15 Left 950664388 3:14486394-14486416 CCCTGCAATAGCTGGGTTTACAG 0: 1
1: 1
2: 5
3: 209
4: 1711
Right 950664394 3:14486432-14486454 GGACCCAAAAGAGAAGGCCTAGG 0: 1
1: 0
2: 0
3: 11
4: 228
950664388_950664392 9 Left 950664388 3:14486394-14486416 CCCTGCAATAGCTGGGTTTACAG 0: 1
1: 1
2: 5
3: 209
4: 1711
Right 950664392 3:14486426-14486448 ACCTGCGGACCCAAAAGAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 97
950664388_950664390 -6 Left 950664388 3:14486394-14486416 CCCTGCAATAGCTGGGTTTACAG 0: 1
1: 1
2: 5
3: 209
4: 1711
Right 950664390 3:14486411-14486433 TTACAGACATTTACCACCTGCGG 0: 1
1: 0
2: 1
3: 16
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950664388 Original CRISPR CTGTAAACCCAGCTATTGCA GGG (reversed) Exonic
900701624 1:4052161-4052183 CTGTAATCCCAGCTATTCGGAGG + Intergenic
900853052 1:5158723-5158745 CCATAGACCCAGCAATTGCAAGG + Intergenic
901074872 1:6547730-6547752 CTGTAACCCCAGCTACTGAGAGG + Intronic
901332314 1:8420206-8420228 CTGTAATCCCAGCTATTCAGGGG + Intronic
901376413 1:8842804-8842826 CTGTAATCCCAGCCTTTGGAAGG - Intergenic
901384619 1:8899534-8899556 CTGTAATCCCAGCTACTTGAGGG - Intergenic
901519346 1:9770869-9770891 CTGTAATCCCAGCTAATGGGAGG + Intronic
901536817 1:9887944-9887966 CTGTAATCCCAGCTATTAGGAGG - Intronic
901537253 1:9890644-9890666 CTGGAATCCTAGCTCTTGCATGG + Intronic
901594236 1:10372275-10372297 CTGTAATCCCAGCACTTTCAGGG + Intronic
901609258 1:10484148-10484170 CTGTAATCCCAGCTACTGGAAGG - Intronic
901676127 1:10886455-10886477 CTGTAACCCCAGCTACTGGGAGG + Intergenic
901948677 1:12724223-12724245 CAGGACACCCACCTATTGCAGGG + Intronic
902028968 1:13407212-13407234 CTGTAATCCCAGCTACTGGGAGG - Intergenic
902066042 1:13688734-13688756 CTGTAGTCCCAGCTACTGGAAGG + Intergenic
902140878 1:14353344-14353366 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
902294820 1:15459857-15459879 CTTTAATCCCAGCTATTCAAGGG + Intronic
902337158 1:15760099-15760121 CTGTAATCCCAGCTATTCGGCGG + Intronic
902444102 1:16450822-16450844 CTGTAATCCCAGCTACTCCGGGG + Intronic
902648484 1:17820688-17820710 CTGTAATCCCAGCTACTGGGGGG - Intronic
903075756 1:20764751-20764773 CTGTAATCCCAGCTATTCGGAGG + Intronic
903206729 1:21787962-21787984 CTGTAATCCCAGCTATCGGGAGG + Intergenic
903412686 1:23158842-23158864 CTGTAATCCCAGCTATTCAGGGG + Intronic
903830535 1:26171546-26171568 GTGTCAACCCAGCTATGGTAGGG + Exonic
903944739 1:26954978-26955000 CTGTAATCCCAGCTACTCCGAGG - Intronic
903990511 1:27264923-27264945 CTGTAATCCCAGCTATTCAGGGG - Intronic
904019713 1:27453766-27453788 CTGTAATCCCAGCTACTGGGGGG + Intronic
904180845 1:28665644-28665666 CTGTAATCCCAGCTACTTCCGGG + Intergenic
904361771 1:29979582-29979604 CTGTAATCCCAGCTACTAGAGGG + Intergenic
904428899 1:30449225-30449247 AGGTAAGCCCAGCTATAGCAGGG + Intergenic
904596874 1:31652359-31652381 CTGTAATCCTAGCTATTCAAGGG - Exonic
904736520 1:32638445-32638467 CTGTAATCCCAGCTTTTGGGAGG - Intronic
904763142 1:32819440-32819462 CTGTAATCCCAGCTACTGGGAGG + Intronic
905055648 1:35091332-35091354 CTGTAGACCCAGCTACTGGGAGG - Intronic
905064317 1:35166846-35166868 CTGTAATCCCAGCTATTCAGAGG + Intergenic
905157732 1:36001111-36001133 CTGTAATTCCAGCTCTTGGAAGG + Intronic
905424792 1:37874672-37874694 CTGTAATCCCAGCTACTGGGAGG + Intronic
905573532 1:39025477-39025499 CTGTAATCCCAGCTAGTGGGGGG - Intergenic
905577031 1:39053035-39053057 CTGTAAACCCAGCACTTGGTAGG + Intergenic
905723542 1:40228456-40228478 CTGTAATCCCAGCTACTCGAGGG + Intronic
906269427 1:44463211-44463233 CTGTAATCCCAGCTCTTGGGAGG + Intronic
906301959 1:44689182-44689204 CTGTAATCCCAGCTCTTGGGAGG - Intronic
906348724 1:45038726-45038748 CTGTAATCCCAGCTACTTCGGGG - Intronic
906437899 1:45812547-45812569 CTGTAATCCCAGCTACTGGGAGG - Intronic
906492041 1:46276280-46276302 CTGTAGCCCCAGCTACTTCAGGG - Intronic
906838626 1:49111233-49111255 CTGTACTCCCAGCTATTGGGAGG - Intronic
907026709 1:51127408-51127430 CTGTAGTCCCAGCTATTCCGGGG - Intronic
907193858 1:52670448-52670470 CTGTAATCCCAGCTATTGGGAGG + Intergenic
907351257 1:53833280-53833302 CTGTAATCCCAGCTACTGGAAGG - Intronic
908122149 1:60996150-60996172 CTGTAATCCCAGCTATTCGGGGG + Intronic
908188352 1:61674470-61674492 CTGTAATCTCAGCTACTCCAGGG - Intergenic
908189421 1:61686538-61686560 CTGTAATCCCAGCTACTACTAGG + Intronic
908232843 1:62122700-62122722 CTGTAATCCCAGCTATTTGGAGG + Intronic
908412249 1:63878588-63878610 CTGTAAGCCAAGCCATGGCAAGG - Intronic
908561733 1:65312920-65312942 CTGTAATCCCAGCTACTTGAGGG - Intronic
908835698 1:68227293-68227315 CTGTAATCCCAGCTATCGGGAGG + Intronic
909010715 1:70331698-70331720 CTGTAATCCCAGCTACTACTAGG + Intronic
909192009 1:72565379-72565401 CTGTAATCCCAGCTACTGGAGGG - Intergenic
909255135 1:73410576-73410598 CTGTAGTCCCAGCTATTTGAGGG + Intergenic
909287351 1:73836778-73836800 CTGTAATCCCAGCTACTGGGAGG + Intergenic
909569968 1:77098456-77098478 CTGTAATCCCAGCTACTTGAGGG - Intronic
909841987 1:80338592-80338614 CTGTAATCCCAGCTACTCAAGGG + Intergenic
909949241 1:81699986-81700008 CTGTACCGACAGCTATTGCAGGG - Intronic
910129203 1:83883511-83883533 CTGTAGTCCCAGCTACTTCAAGG - Intronic
910185001 1:84529697-84529719 CTGTAATTCCAGCTATCGGAAGG - Intergenic
910349995 1:86285658-86285680 ATGTAATCCCGGCTATTCCAAGG + Intergenic
910388437 1:86710385-86710407 CTGTAATCCCAGCTACTAGAGGG - Intronic
910756586 1:90699451-90699473 CTGTAATCCCAGCACTTGGAAGG - Intergenic
911538806 1:99133426-99133448 CTGTAATCCCAGCTACTCGAAGG + Intergenic
911655375 1:100437061-100437083 CTGTAGTCCCAGCTAATTCAGGG + Intronic
911757122 1:101571467-101571489 CTGTAATCCCAGCAATTGGGAGG - Intergenic
911982566 1:104584866-104584888 CTGTAATCCCAGCTACTACAGGG - Intergenic
912022822 1:105127361-105127383 CTGTAATCCCAGCCATTGGGTGG + Intergenic
912082863 1:105958849-105958871 CTGTAATCCCAGCTACTTCAGGG - Intergenic
912114461 1:106388160-106388182 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
912139745 1:106709050-106709072 CTGTGAATCCATCTGTTGCAGGG + Intergenic
912183241 1:107243673-107243695 CTGTAGTCCCAGCTACTGGAAGG - Intronic
912206875 1:107518512-107518534 CTGTAATCCCAGCTATTCTGGGG - Intergenic
912340385 1:108908759-108908781 CTGTAATCCCAGCTCTTGGGAGG + Intronic
912362719 1:109108263-109108285 CTGTAATCCCAGCTACTTGAGGG - Intronic
912387106 1:109276687-109276709 CTGTAATCGCAGCTACTCCAGGG + Intergenic
912436069 1:109661782-109661804 CTATGAACCCAGCTACTGCCAGG - Intronic
912530653 1:110318765-110318787 CTGTAATCCCAGCTACTTGAAGG + Intergenic
912836764 1:113003475-113003497 CTGTAATCCCAGCTACTCCAGGG - Intergenic
913026839 1:114852089-114852111 CTGTAATCCCAGCTACTCCAGGG + Intergenic
913428323 1:118760157-118760179 CTGTAATCCCAGCACTTGAAAGG + Intergenic
913650115 1:120905664-120905686 CTGTAATCCCAGCTACTCAAGGG + Intergenic
913676454 1:121145621-121145643 CTGTAATCCCAGCTATTCAGAGG + Intergenic
913687890 1:121251040-121251062 CTCTAAGTCCAGCTATTCCATGG - Intronic
914028350 1:143933571-143933593 CTGTAATCCCAGCTATTCAGAGG + Intergenic
914039746 1:144038680-144038702 CTCTAAGTCCAGCTATTCCATGG - Intergenic
914076561 1:144357840-144357862 CTGTAATCCCAGCTACTCAAGGG - Intergenic
914102617 1:144608657-144608679 CTGTAATCCCAGCTACTCAAGGG + Intergenic
914149711 1:145029240-145029262 CTCTAAGTCCAGCTATTCCATGG + Intronic
914171009 1:145223421-145223443 CTGTAATCCCAGCTACTCAAGGG - Intergenic
914215800 1:145626825-145626847 CTGTAATCCCAGCTACTCCCCGG + Intronic
914467745 1:147947210-147947232 CTGTAATCCCAGCTACTCCCCGG + Intronic
914526122 1:148467389-148467411 CTGTAATCCCAGCTACTCAAGGG - Intergenic
914640281 1:149599735-149599757 CTGTAATCCCAGCTACTCAAGGG + Intergenic
914703361 1:150152422-150152444 CTGTAGTCCCAGCTACTCCAAGG - Intronic
914726344 1:150330837-150330859 CTGTAATCCCAGCTACTCAAGGG - Intronic
914733928 1:150398125-150398147 CTGTAATTCCAGCTACTGCGGGG - Intronic
914751774 1:150539599-150539621 CTGTAATCCCAGCTACTACGAGG + Intergenic
914925759 1:151885239-151885261 CTGTAATCCCAGCTATTTGGGGG - Intronic
915177802 1:154031210-154031232 CTGTAATCCCAGCTATTTGGGGG - Intronic
915193826 1:154174208-154174230 CTGTAATCCCAGCTACTTGAGGG + Intronic
915369068 1:155332714-155332736 CTGTAATCCTAGCTATTTGAGGG + Intergenic
915436223 1:155908683-155908705 CTGTAATCCCAGCTACTGCGGGG - Intronic
915438071 1:155924463-155924485 CTGTAATCCCAGCACTTTCAGGG - Intronic
915728226 1:158033855-158033877 CTGTAATCCCAGCTACTGGGGGG + Intronic
915959308 1:160251593-160251615 CTGTAGTCCCAGCTACTGGAGGG - Intronic
916102318 1:161403055-161403077 CTGTAATCCCAGCTACTCCGAGG + Intergenic
916127889 1:161587642-161587664 CTGTAATCCCAGCTCTTGGGAGG + Intronic
916129525 1:161600381-161600403 CTGTAATCCCAGCTACTGGGAGG - Intronic
916137805 1:161669446-161669468 CTGTAATCCCAGCTCTTGGGAGG + Intronic
916224861 1:162479472-162479494 CTGTAATCCCAGCTACTTGAGGG + Intergenic
916395688 1:164384725-164384747 CTGTAGTCCCAGCTACTCCAGGG - Intergenic
916405613 1:164495321-164495343 CTGTAATCCCAGCTACTCGAAGG + Intergenic
916686198 1:167149421-167149443 ATGTAAACACAGCTATACCAAGG + Intergenic
916749328 1:167709927-167709949 CTGTAATCCCAGCTACTCCGGGG + Intergenic
917078288 1:171228908-171228930 CTGTAATCCCAGCTACTGGGTGG - Intergenic
917174195 1:172213704-172213726 CTGTAATCCCAGCTATCGGGAGG + Intronic
917201794 1:172525043-172525065 CTGTAGACCCAGCTACTCCAGGG - Intergenic
917565034 1:176204800-176204822 CTGTAATCCCAGCTACTACTCGG + Intronic
917869274 1:179227926-179227948 CTGTAATCCCAGCTACTCCGAGG + Intronic
917883419 1:179361595-179361617 CTGTAATCCCAGCTATTCAGGGG + Intergenic
918491118 1:185082470-185082492 CTGTAATCCCAGCTACTGGGGGG - Intronic
918502653 1:185215659-185215681 CTGTAGACCCAGCTATTCGGGGG - Intronic
918525319 1:185458287-185458309 CTGTAATCCCAGCTTTTGGGAGG - Intergenic
918596326 1:186298258-186298280 CTGTAATCCCAGCTATTCGGAGG + Intronic
918882215 1:190139189-190139211 CTGTAATCCCAGCCTTTGGAAGG + Intronic
919138084 1:193535728-193535750 CTGTAATCCCAGCTACTCAAGGG - Intergenic
919162544 1:193850275-193850297 CTGTAAACCCAGCATTTTGAGGG + Intergenic
919661940 1:200255992-200256014 CTGTAATCCCAGCTACTGGGGGG + Intergenic
919908983 1:202098454-202098476 CTGTAATCCCAGCTACTCGAAGG - Intergenic
919916373 1:202142122-202142144 CTGTAATCCCAGCAATTGGGAGG - Intronic
920147651 1:203875912-203875934 CTGTAATCCCAGCACTTGGAAGG - Intergenic
920373646 1:205494805-205494827 CTGTAATCCCAGCTTTTGGGAGG - Intergenic
920419392 1:205821029-205821051 CTGTAATCCCAGCTACTCCCAGG - Intergenic
920463820 1:206164462-206164484 CTGTAATCCCAGCTATTCAGAGG + Intergenic
920475214 1:206269538-206269560 CTCTAAGTCCAGCTATTCCATGG - Intronic
920545636 1:206814569-206814591 CTGTAATCCCAGCTACTCGAGGG + Intronic
920754255 1:208713647-208713669 CTGTAATCCCAGCACTTGGAAGG - Intergenic
920928648 1:210366491-210366513 CTGTAATCCCAGCTACTCCAGGG + Intronic
921041977 1:211441376-211441398 CTGTAATCCCAGCTATTTGGGGG + Intergenic
921115438 1:212086510-212086532 CTGTAGTCCCAGCTATTGGGAGG - Intronic
921205041 1:212841418-212841440 CTGTAATCCCAGCCTTTGAAAGG - Intronic
922230383 1:223680568-223680590 CTGTAATCCCAGCTATTGGGAGG - Intergenic
922283292 1:224145809-224145831 CTGTAATCCCAGCACTTGGAAGG + Intronic
922358417 1:224798347-224798369 CTGTAAACCCAGAGCTGGCAGGG + Intergenic
922587149 1:226742640-226742662 CTGTAGATCAAGCTGTTGCAGGG + Intergenic
922624939 1:227030009-227030031 CTGTAATCCCAGCTACTGGGAGG + Intronic
922846186 1:228686860-228686882 CTGTAATCCCAGCTATTGGGAGG - Intergenic
922885513 1:229017626-229017648 CTGTAGTCCTAGCTACTGCAAGG + Intergenic
923023016 1:230180039-230180061 CTGTAATCCCAGCTACTGGGAGG - Intronic
923189265 1:231604689-231604711 CTGTAATCCCAGCTATTCGGGGG + Intronic
923343302 1:233025790-233025812 CTGTAAAACAGGCTATTGTAAGG + Intronic
923489189 1:234468329-234468351 CTGTAATCCCAGCTACTGGTGGG + Intronic
923618273 1:235555987-235556009 CTGTAACCCCAGCTACTAGAAGG - Intronic
923634553 1:235682186-235682208 CTGTAGCCCCAGCTATTGGTAGG + Intronic
923675303 1:236075677-236075699 CTGTAATCCCAGCTACTTGAAGG + Intergenic
923744861 1:236691057-236691079 CTGTAATTCCAGCTACTGTAAGG - Intronic
923891730 1:238223157-238223179 CTATAAGCCCAGCTATAGAAAGG - Intergenic
924001148 1:239554010-239554032 CTGTAATCCCAGCTCTTTAAGGG - Intronic
924148964 1:241108179-241108201 CTGTAATCCCAGCTATCGGGAGG + Intronic
924240814 1:242038540-242038562 CTGTAATCCCAGCACTTACACGG - Intergenic
924396334 1:243625252-243625274 CTGTAATCCCAGCTACTTGAGGG - Intronic
924440101 1:244078813-244078835 CTGTAATCCCAGCTACTGGAGGG - Intergenic
924520686 1:244803430-244803452 CTGTAATCCCAGCTACTAGAGGG + Intergenic
924527890 1:244868280-244868302 CTGTAATCCCAGCTACTAGAGGG + Intergenic
924578324 1:245300950-245300972 CTGTAATCCCAGCTACTGGGGGG - Intronic
924648054 1:245897775-245897797 CTGTAATCCCAGCTATTCAGGGG + Intronic
924778086 1:247124918-247124940 CTGTAGTCCCAGCTATTGGGAGG - Intronic
924789852 1:247236136-247236158 CTGTAATCCCAGCTATTCAAAGG + Intergenic
924898323 1:248367450-248367472 CTGTAATCCCAGCTAGTGAGGGG - Intergenic
1062845647 10:702567-702589 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1062859570 10:800450-800472 CTGTGAATCCATCTATTCCATGG - Intergenic
1062980614 10:1719084-1719106 CTGTAATCCCAGCTACTACTTGG - Intronic
1063177171 10:3561929-3561951 CTGTAATCCCAGCTACGTCAGGG - Intergenic
1063218066 10:3941963-3941985 CTGTAACCCCAGCTATTCAGGGG + Intergenic
1063249582 10:4259368-4259390 CTGTAATCCCAGCTTTTGGGAGG - Intergenic
1063293557 10:4777484-4777506 CTGTAGTCCCAGCTATAGCCTGG - Intergenic
1063346959 10:5320555-5320577 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1063475662 10:6326632-6326654 CTGTCAACCCACCTCTTGGATGG - Intergenic
1063735933 10:8754390-8754412 CTGTAATCCCAGCTACTCAAGGG - Intergenic
1063771287 10:9205003-9205025 CTGTAATCCCAGCTATAGGGAGG + Intergenic
1064023479 10:11827933-11827955 CTGTAATCCCAGCACTTTCAGGG - Intronic
1064045556 10:12011473-12011495 CTGTAGTCCCAGTTATTGCTTGG + Intronic
1064438480 10:15332073-15332095 CTGTAATCCCAGCTACTACCTGG - Intronic
1064561221 10:16596971-16596993 CTGTAATCCCAGCCTTTCCAAGG - Intronic
1064801086 10:19073035-19073057 CTGTAATCCCAGCTACTCAAGGG - Intronic
1064858257 10:19796197-19796219 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1064989666 10:21245038-21245060 CTGTAGACCCAGCTATTCAGAGG + Intergenic
1065015899 10:21462512-21462534 CTGTAATCCCAGCTACTCAAGGG + Intergenic
1065041238 10:21698995-21699017 CTGTAATCCCAGCTACTACGGGG - Intronic
1065058815 10:21875800-21875822 CTGTAATCCCAGCTATTCCAGGG + Intronic
1065209996 10:23393883-23393905 CTGTAAACCCAGCTACTTGGAGG - Intergenic
1065248961 10:23790855-23790877 CTGTAGTCCCAGCTATTGGGGGG - Intronic
1065252766 10:23833211-23833233 CTGTAAGCCAAGCTTTTGCTAGG - Intronic
1065350216 10:24788846-24788868 CTGTAATCCCAGCTAATCCCAGG - Intergenic
1065426176 10:25606311-25606333 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1065452221 10:25870740-25870762 CTGTAATCCCAGGTACTCCAAGG + Intergenic
1065573416 10:27095543-27095565 CTGTAATCCCAGCTACTCGAGGG + Intronic
1065602035 10:27378845-27378867 CTGTAATCCCAGCAATTGGGAGG - Intergenic
1065701801 10:28432800-28432822 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1066097215 10:32083880-32083902 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1066201240 10:33144160-33144182 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1066334389 10:34461481-34461503 CTGTAATCCCAGCTACTGGGGGG + Intronic
1066434172 10:35381436-35381458 CTGTAATCCCAGCTACTGGAGGG + Intronic
1066537536 10:36408079-36408101 CTGTAATCCCAGCTACTCCCTGG - Intergenic
1066578075 10:36848416-36848438 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1067510281 10:46889032-46889054 CTGTAGACCCAGCTATTGACCGG - Intergenic
1067651974 10:48162825-48162847 CTGTAGACCCAGCTATTGACCGG + Intronic
1068571937 10:58639518-58639540 CTGTAATCCCAGCTACTACTTGG - Intronic
1068707799 10:60096049-60096071 CTGTAATCCCAGCTATCGGGAGG + Intronic
1069025186 10:63532537-63532559 CTGTAATCCCAGCTACTCGAAGG + Intronic
1069032202 10:63609327-63609349 CTGTAGTCCCAGCTACTGGAGGG + Intronic
1069410034 10:68143875-68143897 CTGTAATCCCAGCTATTCGGGGG - Intronic
1069442531 10:68441651-68441673 CTGTAATCCCAGCTACTTGAAGG + Intronic
1069449138 10:68502071-68502093 CTGTAATCCCAGCTACTGGAGGG + Intronic
1069518608 10:69100094-69100116 CTGTAATCCCAGCTATTGAGAGG + Intronic
1069540249 10:69288906-69288928 CTGTAATCCCAGCTACTGGGAGG - Intronic
1069545574 10:69325657-69325679 CTGTAATCCCAGCTACTGGGGGG - Intronic
1069933042 10:71896279-71896301 CTGTAAACCCAGCTACTCGGAGG + Intergenic
1069971345 10:72172290-72172312 CTGTAATCCCAGCTACTTCGAGG + Intronic
1070003871 10:72403235-72403257 CTGTAATCCCAGCTTTTGGGAGG + Intronic
1070030181 10:72669268-72669290 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1070031282 10:72679709-72679731 CTGTAGTCCTAGCTATTCCAAGG + Intergenic
1070047418 10:72852587-72852609 CTGTAAACTCAACCAATGCAGGG - Intronic
1070069173 10:73069930-73069952 CTGTAATCCCAGCTACTGGGAGG - Intronic
1070114253 10:73513936-73513958 CTGTAATCCCAGCTATTTGGGGG - Intronic
1070320079 10:75348003-75348025 CTGTAATCCCAGCTATTCAGAGG - Intergenic
1070504313 10:77099589-77099611 CTGTAATCCCAGCTACTCGAGGG + Intronic
1070650984 10:78236261-78236283 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1070732449 10:78840609-78840631 CTGTAATCCCAGCTACTCTAAGG + Intergenic
1071770330 10:88722170-88722192 CTGTAATCCCAGCTATTCCGGGG + Intergenic
1072044396 10:91640092-91640114 CTGTGAACTTAGCTATTGGAGGG + Intergenic
1072074082 10:91950951-91950973 CTGTAGTCCCAGCTACTCCAGGG - Intronic
1072088694 10:92105836-92105858 CTGTAATCCCAGCTACTGGTGGG - Intronic
1072094254 10:92161392-92161414 CTGTAATCCCAGCTAGTCAAGGG - Intronic
1072104729 10:92263196-92263218 CTGTAATCCCAGCTACTCCTGGG - Intronic
1072140912 10:92588394-92588416 CTGTAAACCCAGCTATTCAGAGG + Intergenic
1072233523 10:93433278-93433300 CTGTAATCCCAGCTACTCGAGGG - Intronic
1072389901 10:94972566-94972588 CTGTAATCCCAGCTACTCGAGGG + Intronic
1072470635 10:95709896-95709918 CTGTAATCCCAGCTACTGGTGGG - Intergenic
1072523034 10:96246427-96246449 CTGTAATCCCAGCTATTCGCTGG + Intronic
1072534097 10:96347215-96347237 CTGTAATCCCAGCTACTTCGTGG - Intronic
1072776526 10:98202021-98202043 CTGTAATCCGAGCTCTTGGAAGG - Intronic
1072957359 10:99899068-99899090 CTGTAATCCCAGCTACTGGGGGG + Intronic
1072977919 10:100075166-100075188 CTGTAGACCCAGCTACTCGAGGG + Intronic
1073013139 10:100377324-100377346 CTGTAATCCCAGCTACTCCAGGG - Intergenic
1073059650 10:100725783-100725805 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1073084705 10:100880692-100880714 CTGTAATCCCAGCTATTCTGGGG - Intergenic
1073215953 10:101836361-101836383 CTGTAATCCCAGCTATTCGGTGG - Intronic
1073233703 10:101994911-101994933 CTGTAATCCCAGCTACTAGAGGG + Intronic
1073276029 10:102312166-102312188 CTGTAATCCCATCTATTCAATGG + Intronic
1073397294 10:103228668-103228690 CTGTAATCCCAGCTATTTGGGGG + Intergenic
1073437466 10:103528231-103528253 CTGTAATCCCAGCTACTCAAAGG + Intronic
1074072594 10:110087287-110087309 CTGTAATCCCAGCAATTTGAGGG - Intronic
1074202970 10:111256236-111256258 CTGTAATCCCAGCTACTACTCGG + Intergenic
1074526477 10:114267552-114267574 CTGTAATCCCAGCTATCGGGAGG - Intronic
1074824859 10:117207284-117207306 CTGTAATCCCAGCAATTTGAGGG - Intronic
1075000467 10:118793394-118793416 CTATAATCCCAGCTATTGGGAGG - Intergenic
1075113909 10:119610091-119610113 CTGTAATCTCAGCTACTGGAGGG - Intergenic
1075652265 10:124135624-124135646 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1075896683 10:126002187-126002209 CTGTAATCCCAGCTACTTGAGGG + Intronic
1076094296 10:127718513-127718535 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1076282969 10:129265438-129265460 CTGTAGTCCCAGCTACTCCAGGG + Intergenic
1076448716 10:130539674-130539696 CTGTAATCCCAGCACTTTCAAGG - Intergenic
1076755526 10:132569477-132569499 CTGTAAACCCAGCTACTCAGGGG - Intronic
1077033872 11:484485-484507 CTGTAAACACAGCCAGTGCAGGG + Intronic
1077699509 11:4428279-4428301 CTGTAATCCCAGCACTTGGAAGG + Intergenic
1078221203 11:9353061-9353083 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1078227893 11:9409500-9409522 CTGTAATCCCAGCTACTCCGGGG - Intronic
1078456050 11:11476315-11476337 CTGATAAGTCAGCTATTGCAAGG - Intronic
1078630563 11:13000023-13000045 CTGTAATCCCAGCTACTTGAGGG + Intergenic
1078673234 11:13383726-13383748 CTGTAATCCCAGCTACTCCGGGG + Intronic
1079064605 11:17278296-17278318 CTGTAATCCCAGCTACTCGATGG - Intronic
1079204445 11:18402076-18402098 CTGTAATCCCAGCTCTTGGGAGG - Intronic
1079221970 11:18571093-18571115 CTGTAATCCCAGCACTTTCAAGG + Intronic
1079248319 11:18769523-18769545 CTGTAATCCCAGCTACTGGGAGG - Intronic
1079546490 11:21639142-21639164 CTGTAATCCCAGCTACTCAAGGG + Intergenic
1079578413 11:22031429-22031451 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1079592387 11:22195687-22195709 CTGTAATCCCAGCAATTTGAGGG - Intronic
1079735179 11:23988456-23988478 CTCTAAACCCAGGTAGTGGAAGG + Intergenic
1079972243 11:27049505-27049527 CTGTAATCCCAGCTATTTGAGGG - Intronic
1080010556 11:27454636-27454658 CTGTAATCCCAGCTACATCAGGG + Intronic
1080092513 11:28365285-28365307 CTGTAAATCCATCTAGTCCAGGG + Intergenic
1080247645 11:30197691-30197713 CTCAAAACCCAGTTAGTGCAGGG + Intergenic
1080320864 11:31007783-31007805 CTGTAATCCCAGCTATTCAGAGG - Intronic
1080361318 11:31517305-31517327 CTGTAATCCCAGCTATTCGGGGG - Intronic
1080474550 11:32577314-32577336 CTGTAATCCCAGCTACTGTAAGG + Intergenic
1080630622 11:34071440-34071462 CTGTAATCCCAGCTACTTTAGGG + Intronic
1080729025 11:34929351-34929373 CTGTAATCCCAGCTATTTGGGGG - Intronic
1080845349 11:36021905-36021927 CTGTAATCTCAGCACTTGCAGGG - Intronic
1080980576 11:37399532-37399554 CTGTAATCCCAGCTACTCAATGG + Intergenic
1080988868 11:37506098-37506120 CTTTAAACCCACCTATGACATGG + Intergenic
1081261988 11:40972257-40972279 TTGTAATCCCAGCTACTGAAGGG - Intronic
1081321602 11:41698491-41698513 CTGTAATCCCAGCTCTTGGGAGG - Intergenic
1081508714 11:43745772-43745794 CTGTAATCCCAGCTTTTGGAAGG + Intronic
1081517409 11:43846539-43846561 CTATAAACCCAGCTACTGTAGGG + Intronic
1081543989 11:44056707-44056729 CTGTAATCCCAGCTACTTCGGGG + Intronic
1081944139 11:46974107-46974129 CTGTAGTCCCAGCTACTCCAGGG + Intronic
1082071973 11:47946584-47946606 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1082663504 11:55945260-55945282 CTGTAGTCCCAGCTACTCCAGGG - Intergenic
1082665028 11:55964834-55964856 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1082851550 11:57769405-57769427 CTGTAGTCCCAGCTACTCCAGGG - Intronic
1082865918 11:57900088-57900110 CTGTAGTCCCAGCTACTGAAAGG + Intergenic
1082902055 11:58265981-58266003 CTGTAATCCCAGCTACTTGAGGG - Intergenic
1083125534 11:60561915-60561937 CTGTAATCCCAGCTCTTGGGAGG - Intergenic
1083203857 11:61135675-61135697 CTGTAGTCCCAGCTATTGGAAGG - Intronic
1083408232 11:62473272-62473294 CTGTAATCCCAGCTACTTGAGGG + Intronic
1083434855 11:62635304-62635326 CTGTAATCCCAGCTATTTGGAGG - Intronic
1083797624 11:65026674-65026696 CTGTAATTCCAGCTACTCCAGGG - Intronic
1083974481 11:66106617-66106639 CTGTAATCCCAGCTACTGGGTGG + Intronic
1084016715 11:66387784-66387806 CTGTAATCCCAGCTACTCAATGG - Intergenic
1084048358 11:66584108-66584130 CTGTAATCCCAGCTACTGAGGGG + Intergenic
1084648811 11:70476104-70476126 CTGTAATCCCAGCTACTGGGAGG + Intronic
1084725915 11:70941934-70941956 CTGTAATCCCAGCTATTTGAGGG + Intronic
1084818549 11:71666768-71666790 CTGTAGTCCCAGCTATTCCGGGG - Intergenic
1084851656 11:71946484-71946506 CTGTAAACCCAGCTACTCTGTGG - Intronic
1084886400 11:72210684-72210706 CTGTAATCCCAGCTATTTGGAGG + Intergenic
1084894647 11:72257059-72257081 CTGTAATCCCAGCTACTACCTGG - Intergenic
1084920564 11:72466117-72466139 CTGTAATCCCAGCTACTGACAGG + Intergenic
1085065836 11:73494875-73494897 CTGTAATCCCAGCTACTACTTGG + Intronic
1085106583 11:73848942-73848964 CTGTAGTCCCAGCTATTCCAGGG - Intronic
1085124511 11:73990243-73990265 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1085354075 11:75819844-75819866 CTGTAATCCCAGCTATTTGGAGG + Intronic
1085585822 11:77704872-77704894 CTGTAATCCCAGCTACTGGGAGG - Intronic
1085639772 11:78186117-78186139 CTGTAATCCCAGCACTTGGAAGG + Intronic
1085676919 11:78530593-78530615 CTGTAATCCCAGCTACTGGCAGG - Intronic
1086036715 11:82424692-82424714 CTGTAATCCCAGCTACTGTGGGG + Intergenic
1086579293 11:88378838-88378860 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1086879984 11:92141691-92141713 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1086996153 11:93358703-93358725 CTGTAATCCCAGCTATTTGGAGG - Intronic
1087020044 11:93592901-93592923 CTGTAATCCCAGCTACTACTTGG + Intergenic
1087411065 11:97790532-97790554 CTGTAATCCCAGCTCTTTGAGGG - Intergenic
1087744197 11:101924586-101924608 CTGTAATCCCAGCTATTCGGGGG - Intronic
1087783817 11:102331761-102331783 CTGTAATCCCAGCTAAGGGAAGG - Intronic
1088101029 11:106155852-106155874 CTGTAATCCCAGTTACTGGAGGG - Intergenic
1088201468 11:107339788-107339810 CTGTAATCCCAGCTGTTGTGGGG - Intronic
1088249814 11:107852747-107852769 CTGTAATCCCAGCTACTACTAGG + Intronic
1088298609 11:108329534-108329556 CTGTAGCCCCAGCTATTTCGGGG - Intronic
1088486767 11:110348288-110348310 CTGTAATCCCAGCCATTGGGAGG - Intergenic
1088775065 11:113074752-113074774 CTGTAATCCCAGCTATTTGGGGG - Intronic
1088932036 11:114361908-114361930 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1089213044 11:116819378-116819400 CTGCAGCACCAGCTATTGCACGG + Intergenic
1089240549 11:117074802-117074824 CTGTAATCCCAGCTACTGAGGGG + Intronic
1089278697 11:117357227-117357249 CTGTAATCCCAGCTATTTGAGGG - Intronic
1089392293 11:118110462-118110484 CTGTAATCCCAGCTATTTAGGGG - Intronic
1089484713 11:118836429-118836451 CTGTAATCCCAGCTACTCCGGGG + Intergenic
1089562896 11:119354141-119354163 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1089590751 11:119539142-119539164 CTGTAATCCCAGCATTTTCAGGG + Intergenic
1089829629 11:121315388-121315410 CTGTAATCCCAGCACTTTCAAGG - Intergenic
1089875056 11:121713120-121713142 CTGTAATCCCAGCTAGTCCGGGG + Intergenic
1089909245 11:122079320-122079342 CTGTAATCCCAGCTATTCGGGGG + Intergenic
1091401487 12:183433-183455 CTGTAATCCCAGCTATTCGAAGG + Intergenic
1091506684 12:1076515-1076537 CTGTAAACCCAGCTACTCAGGGG - Intronic
1091747473 12:3001652-3001674 CTGTAGTCCCAGCTACTTCAGGG + Intronic
1091924827 12:4337286-4337308 CTGTAATCCCAGCTATTGGGAGG - Intronic
1092219700 12:6704458-6704480 CTGTATCCCCAGCCATGGCACGG - Intergenic
1092221775 12:6718640-6718662 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1092365929 12:7877123-7877145 CTGTAATCCCAGCTCTTGGGAGG - Intronic
1092389417 12:8062764-8062786 CTGTAATCCCAGCTACTGGGAGG - Intronic
1092565353 12:9659518-9659540 CTGTAACCCCAGCTAATTGAGGG - Intergenic
1092797773 12:12130306-12130328 CTGTAATCCCAGCTACTGGGAGG - Intronic
1092871870 12:12812711-12812733 CTGTAATCCCAGCTATTCAGGGG - Intronic
1093058634 12:14579968-14579990 CTGTAATCCCAGCTATTCAGAGG - Intergenic
1093730127 12:22557628-22557650 CTGTAATCCCAGCTATTCGGTGG - Intergenic
1093730235 12:22558331-22558353 CTGTAATCCCAGCTATTCGGGGG - Intergenic
1093913055 12:24769028-24769050 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1093949916 12:25153297-25153319 CTGTAATTCCAGCTATTGGGAGG + Intronic
1094140464 12:27175623-27175645 CTTTAAACACAGCTCTTGCTGGG + Intergenic
1094364764 12:29668581-29668603 CTGTAATCCCAGCTACTAGAGGG - Intronic
1094537843 12:31337643-31337665 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1094577714 12:31702857-31702879 CTGTAATCCCAGCTACTGGGAGG - Intronic
1095460010 12:42433577-42433599 CTGTAATCCCAGCAATTGGGAGG - Intronic
1096043100 12:48537809-48537831 CTGTAATCCCAGCTATTCAGGGG + Intergenic
1096161949 12:49386284-49386306 CTGTAATCCCAGCTACTGGGAGG - Intronic
1096296202 12:50386304-50386326 CTGTAATCCCAGCTATAGGGAGG + Intronic
1096300560 12:50423875-50423897 CTGTAATCCCAGCTACTACTCGG - Intronic
1096364646 12:51018270-51018292 CTGTAATCCCAGCTATTGGGAGG + Intronic
1096419549 12:51445289-51445311 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1096741732 12:53698414-53698436 CTGTAATCCCAGCTACTCCAGGG - Intergenic
1096831585 12:54318665-54318687 CTGTATTCCCAGCTACTCCAGGG - Intronic
1096850745 12:54434348-54434370 CTGTAATCCCAGCTATTCAGGGG - Intergenic
1097024672 12:56046054-56046076 CTGTAATCCCAGCTACTGGTAGG - Intergenic
1097106223 12:56627342-56627364 CTGTAATTCCAGCTACTGGAGGG + Intronic
1097113242 12:56678298-56678320 CTGTAATCCCAGCTACTCAAGGG - Intronic
1097230248 12:57506796-57506818 CTGTAATCCCAGCTACTCGAAGG - Intronic
1097394418 12:59056286-59056308 CTGTAATCCCAGCACTTGGAGGG + Intergenic
1097511039 12:60540436-60540458 CTGTAGTCCCAGCTACTCCAGGG - Intergenic
1097725719 12:63073687-63073709 CTGTAATCCCAGCTATTCGGAGG + Intergenic
1097776975 12:63658370-63658392 CTGTAATCCCAGCTATTCGGAGG + Intronic
1097782701 12:63726483-63726505 CTGTAATCCCAGCTACTACTCGG + Intergenic
1097988986 12:65814712-65814734 CTGTAGTCCCAGCTACTCCAGGG + Intergenic
1098089875 12:66890049-66890071 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1098114014 12:67155474-67155496 CTGTAATCCCAGCACTTTCAAGG - Intergenic
1098160430 12:67644158-67644180 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1098195017 12:67990713-67990735 CTGTAATCCCAGCCATTGGGAGG - Intergenic
1098261932 12:68680663-68680685 CTGTAGTCCCAGCTACTTCAGGG + Intergenic
1098331858 12:69361073-69361095 CTGTAATCCCAGCTACTAGAGGG + Intronic
1098344900 12:69491753-69491775 CTGTAAACCCAGCAGTTGAGAGG - Intronic
1098548582 12:71738293-71738315 CTGTAATCCCAGCTACTTGAGGG + Intergenic
1098620941 12:72597543-72597565 CTGTAATCCCAGCTATTCTGGGG + Intronic
1098898534 12:76089201-76089223 CTGTAATCCCAGCTACTACTTGG - Intergenic
1098969826 12:76840461-76840483 CTGTAATCCCAGCTACTGAGGGG - Intronic
1099064569 12:77957787-77957809 CTGTAATCCCAGCTACTCCAGGG - Intronic
1099433514 12:82617492-82617514 CTGTAATCCCAGCTACTGGGGGG - Intergenic
1099567052 12:84264693-84264715 CTGTAATCCCAGCTACTCAAGGG + Intergenic
1099586047 12:84515178-84515200 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1099690264 12:85943124-85943146 CTTTAATCCCAGCTACTGGAGGG + Intergenic
1099705959 12:86153187-86153209 CTGTAAACCCAACAAGTACATGG + Intronic
1099714862 12:86278299-86278321 CTGTAATCCCAGCTATTTGAGGG - Intronic
1099898347 12:88677066-88677088 CTGTAATCCCAGCTATTCAGGGG - Intergenic
1100334973 12:93620535-93620557 CTGTAATCCCAGCTACTGGGGGG - Intergenic
1100544325 12:95586827-95586849 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1100545254 12:95596278-95596300 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1100647566 12:96547307-96547329 CTGTAATCCCAGCTACTGGGAGG - Intronic
1100905940 12:99299181-99299203 CTGTAATCCCAGCTACTTGAAGG - Intronic
1100923783 12:99520916-99520938 CTGTAATCCCAGCTACTTAAAGG - Intronic
1101139316 12:101778782-101778804 CTGTAATCCCAGCTATTTGGAGG + Intronic
1101145641 12:101838207-101838229 CTGTAATCCCAGCTACTCCAGGG - Intergenic
1101359730 12:104014923-104014945 CCCTGAACCCAGCTATTGAAAGG + Intronic
1101775049 12:107786073-107786095 CTATAATCCCAGCTATTGGGAGG - Intergenic
1101808404 12:108085618-108085640 CTGTAAACCCAGCACTTGGGAGG + Intergenic
1101884954 12:108654822-108654844 CTATAATCCCAGCTCTTGCCAGG - Intronic
1101907105 12:108835316-108835338 CTGTAATCCCAGCTATTGGGAGG + Intronic
1102239394 12:111314516-111314538 CTGTAATCCCAGCTATTTGGAGG + Intronic
1102271766 12:111542587-111542609 CTGTAAACCCAGCTACTTGGTGG - Intronic
1102285009 12:111648802-111648824 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1102311299 12:111846619-111846641 CTGTAATCCCAGCTACTACTCGG - Intronic
1102417174 12:112773957-112773979 CTGTAATCCCAGCTACTACTTGG + Intronic
1102457709 12:113081218-113081240 CTGTAATCCCAGCTACTGGGAGG + Intronic
1102631509 12:114284893-114284915 CTGTAGTCCCAGCTATTTGAGGG - Intergenic
1102667296 12:114586071-114586093 CTGTAATCCCAGCTACTCAAGGG + Intergenic
1102684765 12:114716095-114716117 CTGTAATCCCAGCTACTCAAGGG + Intergenic
1102959392 12:117082379-117082401 CTGTAATCCCAGCTATTCAGAGG + Intronic
1102990644 12:117313415-117313437 CTGTAGTCCCAGCTACTGGAGGG - Intronic
1103077169 12:117993360-117993382 CTGTAATCCCAGCTACTCCGGGG + Intergenic
1103282903 12:119775148-119775170 CTGTAATCCCAGCTATTCAGGGG + Intronic
1103383696 12:120514913-120514935 CTGTAATCCCAGCTATTTGAAGG - Intronic
1103387005 12:120540976-120540998 CTGTAATCCCAGCTACTCCGGGG - Intronic
1103421656 12:120789700-120789722 CTGTAATCCCAGCTACCCCAGGG + Intronic
1103426287 12:120837909-120837931 CTGTAATCCCAGCTACTGGGAGG + Intronic
1103473703 12:121202457-121202479 CTGTAATCCCAGCTACTACTTGG + Intergenic
1103500211 12:121395878-121395900 CTGTAACCCCAGCTACTACTCGG + Intronic
1103542848 12:121678307-121678329 CTGTAATCCCTGCTATTGGGAGG - Intergenic
1103610767 12:122122947-122122969 CTGTAATCCCAGCACTTGGAGGG - Intronic
1103681789 12:122699973-122699995 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1103838668 12:123845116-123845138 CTGTAGTCCCAGCTACTCCAGGG - Intronic
1104011378 12:124932790-124932812 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1104261174 12:127183490-127183512 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1104449415 12:128857088-128857110 CTGTAAACCCACATCTTCCAAGG + Intronic
1104678679 12:130733349-130733371 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1105346178 13:19574587-19574609 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1105386059 13:19930660-19930682 CTGTAATCCCAGCTATTCTCAGG - Intergenic
1105441546 13:20419413-20419435 CTGTAATCCCAGCTATTTGGAGG - Intronic
1105499625 13:20960322-20960344 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1105758177 13:23489097-23489119 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1105963491 13:25364346-25364368 CTGTAATCCCAGCTACTTGAGGG + Intergenic
1106188392 13:27428283-27428305 CTGGCAACCCACCTGTTGCAAGG - Intronic
1106238690 13:27888937-27888959 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1106247078 13:27959856-27959878 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1106727624 13:32502184-32502206 CTGTAATCCCAGCTACTTGAAGG - Intronic
1106767003 13:32923212-32923234 CTGTAATCCCAGCACTTGGAGGG + Intergenic
1106961455 13:35003256-35003278 CTGTAGGCCCAGCTACTTCAGGG + Intronic
1107103867 13:36623165-36623187 CTGTTAACCCTGCAATTACAAGG - Intergenic
1107462591 13:40618331-40618353 CTATAATCCCAGCTCTTGGAGGG - Intronic
1107629457 13:42328360-42328382 CTGTAATCCCAACTACTCCAGGG - Intergenic
1107848890 13:44550457-44550479 CTGTAATCCCAGCTACTTGAGGG + Intronic
1107861462 13:44665066-44665088 CTGTAATCCCAGCTACTGAGGGG - Intergenic
1108022042 13:46137412-46137434 CTGTAATCCCAGCTATTTGGTGG + Intronic
1108554022 13:51575301-51575323 CTGTAATCCCATCTATTGGGAGG + Intergenic
1108699903 13:52934758-52934780 CTGTAATCCCAGCTACTGGAAGG + Intergenic
1108773609 13:53735482-53735504 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1108842823 13:54641606-54641628 CTGTAATCCCAGCTATTCGGAGG + Intergenic
1109092363 13:58064459-58064481 CTGTAATCCCAGCTACTAGAGGG + Intergenic
1109181953 13:59224423-59224445 CTGTAATACCAGCTATTGGGAGG - Intergenic
1109287966 13:60434343-60434365 CTGTAATCCCAGCTATTTGGGGG + Intronic
1109785780 13:67172753-67172775 CTGTAATCCCAGCTACTCGAGGG + Intronic
1109801909 13:67390910-67390932 CTGTAATCCCAGCTATTTGAGGG - Intergenic
1110094225 13:71496108-71496130 CTGTAATCCCAGCTATTTGGAGG + Intronic
1110601635 13:77381255-77381277 CTGTATTCCCAGCTACTCCAGGG + Intergenic
1110957664 13:81576236-81576258 CTGTAATCCCAGCATTTGGAGGG + Intergenic
1110962694 13:81649568-81649590 CGGTAAACCCAGCTACTGCGGGG - Intergenic
1111024279 13:82499005-82499027 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1111124614 13:83898218-83898240 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1111294266 13:86258784-86258806 CAGTAATCCCAGCTATTGGGAGG - Intergenic
1112009948 13:95285425-95285447 CTGTAATCCCAGCTATTTTGGGG + Intronic
1112065144 13:95784849-95784871 CTGTAGTCCCAGCTACTTCATGG + Intronic
1112417243 13:99213939-99213961 CTGTAATCCCAGCTACTAGAAGG - Intronic
1112471965 13:99697488-99697510 CTGTAATCCCAGCTACTGAGTGG - Intronic
1112522555 13:100110009-100110031 CTGTAATCCCAGCTATTAGGAGG + Intronic
1113151597 13:107269867-107269889 CTGTAGTCCCAGCTACTCCAAGG - Intronic
1113478252 13:110600740-110600762 TTGCAAAGCCAGCTATTGCTGGG - Intergenic
1113642002 13:111964402-111964424 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1113827167 13:113265291-113265313 CTGTAGTCCCAGCTATGGGAGGG + Intronic
1114215052 14:20651239-20651261 CTGTAATCCCAGCTACTCGAGGG - Intergenic
1114295787 14:21328045-21328067 CTGTAATCCCAGCTACTGGGAGG + Intronic
1114350967 14:21850813-21850835 CTGTAATCCCAGCTAGTATAGGG - Intergenic
1114541560 14:23464074-23464096 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1114959759 14:27871033-27871055 CTGTAATCCCAGCTATTTTGAGG - Intergenic
1115119461 14:29923106-29923128 CTGTAGACCCAGCTACTCAAGGG + Intronic
1115192318 14:30758861-30758883 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1115216410 14:31017953-31017975 CTGTAATCCCAGCTACTCAAGGG + Intronic
1115372245 14:32630010-32630032 ATTTAAACCCAGCTATTGGGAGG - Intronic
1115603787 14:34980482-34980504 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1115617161 14:35106462-35106484 CTGTAATCCCAGCTATTCAAGGG - Intronic
1115727731 14:36235411-36235433 CTGTAGATCCAGCTATTGGGAGG - Intergenic
1115992343 14:39163113-39163135 CTGTAATCCCAGCATTTGGAAGG + Intronic
1116205531 14:41860938-41860960 CTCTAAAGCCAACTATTCCAAGG + Intronic
1116210679 14:41939095-41939117 CTGTAATCCCAGCTACTCCATGG - Intergenic
1116818329 14:49603813-49603835 CTGTAATCCCAGCTACTGGGAGG - Intronic
1116978533 14:51142618-51142640 CTGTAAAGCCATCTTTTGTAGGG - Intergenic
1117057507 14:51928150-51928172 CTGTAATCCCAGCTATTGAGAGG - Intronic
1117071170 14:52057578-52057600 CTGTAATCCCAGCTACTGGGAGG + Intronic
1117423827 14:55575099-55575121 CTGTAGTCCCAGCTATTTGAGGG + Intronic
1117675918 14:58154610-58154632 CTGTAATCCCAGCTATTAGGGGG + Intronic
1117695527 14:58358343-58358365 CTGTAATCCCAGATATTGGGAGG + Intronic
1117979589 14:61329356-61329378 CTGTAATCCCAGCTACTGAGAGG - Intronic
1118190860 14:63578908-63578930 CTGTAATCCCAGCTACTTGAGGG - Intergenic
1118235840 14:64004450-64004472 CTGTAATCCCAGCTACTGGGGGG - Intronic
1118392349 14:65305990-65306012 CTGTAATCCCAGCACTTGGAAGG - Intergenic
1118413906 14:65512286-65512308 CTGTAATCCCAGCTACTACCTGG - Intronic
1118575366 14:67236966-67236988 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1118658467 14:67980320-67980342 CTGTAATCCCAGTTATGGGAAGG + Intronic
1118734922 14:68694463-68694485 CTGGGAACACATCTATTGCACGG - Intronic
1118806179 14:69238883-69238905 CTGTAATCCCAGTTCTTCCAAGG - Intronic
1118943452 14:70360161-70360183 CTGTAATCCCAGCTACTGGGGGG + Intronic
1119089487 14:71767461-71767483 CTGTAATCCCAGCTATTCAGGGG + Intergenic
1119112455 14:71987640-71987662 CTGTAGTCCCAGCTATGGGAAGG - Intronic
1119253226 14:73175381-73175403 CTGTAATCCCAGCCCTTGCGAGG - Intronic
1119282716 14:73423517-73423539 CTGTAATCCCAGCTCTTGGGAGG + Intronic
1119335685 14:73831642-73831664 CTGTAGTCCCAGCTACTGCGGGG - Intergenic
1119355139 14:73999963-73999985 CTGTAATCCCAGCTATTCAGGGG + Intronic
1119373942 14:74173308-74173330 CTGTAATCCCAGCTATTCAGGGG - Intronic
1119457543 14:74769407-74769429 CTGTAATCCCAGCTACTCCTGGG - Intronic
1119680628 14:76589945-76589967 CCATAATCCCAGCTATTGCAAGG - Intergenic
1120133643 14:80837592-80837614 CTGTAATCCCAGCTACTGGGAGG + Intronic
1120396919 14:83979630-83979652 CTGAACCACCAGCTATTGCAAGG + Intergenic
1120460323 14:84786936-84786958 CTGTAATCCCAGCTATTCAGGGG - Intergenic
1120583052 14:86278036-86278058 CTGTAATCCCAGCTATTGCAGGG + Intergenic
1120628326 14:86857038-86857060 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1121184468 14:91954397-91954419 CTGTAGTCCCAGCTACTCCAGGG - Intergenic
1121282350 14:92708339-92708361 CTGTAATCCCAGCACTTTCAGGG + Intronic
1121341100 14:93105645-93105667 CTGTAATCCCAGCTACTACTCGG - Intronic
1121356899 14:93223271-93223293 CTGTAATCCCAGCTACTCCGAGG + Intronic
1121380538 14:93462181-93462203 CTGTAATCCCAGCTACTGGCAGG + Intronic
1121397330 14:93637578-93637600 CTGTAATCCCAGCTACTCCTCGG - Intronic
1121467540 14:94125803-94125825 CTGGAGACCCAGATATGGCAGGG - Intergenic
1121477180 14:94219837-94219859 CTGTAATCCCAGCTATTAGGAGG + Intronic
1121544554 14:94753908-94753930 CTGTAATCCCAGCACTTGGATGG + Intergenic
1121751268 14:96359247-96359269 CTGTAGTCCCAGCTACTGCAGGG + Intronic
1121769669 14:96522242-96522264 CTGTAATCCCAGCTACTTGAGGG - Intronic
1122179654 14:99945974-99945996 CTGTAGTCCCAGCTACTTCAGGG + Intergenic
1122201530 14:100125676-100125698 CTGTAATCCCAGCTACTCAAGGG - Intronic
1122434717 14:101687466-101687488 CTGTAATCCCAGCTACTAGAGGG + Intergenic
1122557178 14:102587372-102587394 CTGTAATCCCAGCTATGGGGTGG - Intergenic
1122683302 14:103484297-103484319 CTGTAATCCCAGCTACTGGGAGG - Intronic
1122705838 14:103620760-103620782 CTGTAACCCCAGCTACTCAAGGG - Intronic
1122777033 14:104122836-104122858 CTGTAGTCCCAGCTACTTCAGGG - Intergenic
1123485822 15:20737502-20737524 CTGTAGTCCCAGCTACTTCAGGG + Intergenic
1123542309 15:21306545-21306567 CTGTAGTCCCAGCTACTTCAGGG + Intergenic
1123760419 15:23427724-23427746 CTGTAATCCCAGCTACTCAAGGG - Intergenic
1123798740 15:23799513-23799535 CTGTAATCCCAGCTATTCGGAGG + Intergenic
1123808048 15:23895590-23895612 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1123813763 15:23955534-23955556 CTGTAATCCCAGCACTTGGAAGG + Intergenic
1124013135 15:25854935-25854957 CTGTAATCCCAGCTATTCGGAGG + Intronic
1124027235 15:25977803-25977825 CTGTAATCCCAGCTACTTCGGGG - Intergenic
1124945441 15:34261416-34261438 CTGTACTCCCAGCTACTTCAAGG - Intronic
1125008395 15:34843385-34843407 CTGTAATCCCAGCTATTTGGTGG + Intergenic
1125064098 15:35461204-35461226 CTGTAGTCCCAGCTATTCGAAGG - Intronic
1125191336 15:36997600-36997622 CTGTAGTCCCAGCTACTCCAAGG - Intronic
1126059550 15:44766934-44766956 CTGTAATCCCAGCTATTTGGGGG + Intronic
1126120223 15:45244947-45244969 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1126587309 15:50301668-50301690 CTGTAATCCCAGCTATTCAGGGG + Intronic
1126739314 15:51761609-51761631 CTGTAGACCCAGCTACTCGAGGG + Intronic
1126766461 15:52015932-52015954 CTGTAATCCCAGCTACTGGAAGG + Intronic
1126852419 15:52805476-52805498 CTGTAATCCCAGTAATTGTAGGG + Intergenic
1126895235 15:53250269-53250291 CTGTAATCCCAGCTACTCAAGGG + Intergenic
1127243673 15:57147999-57148021 CTGTACTCCCAGCTATTCGAAGG - Intronic
1127316913 15:57805322-57805344 CTGTAATCCCAGCTACTCGAAGG - Intergenic
1127424241 15:58839452-58839474 CTGTAATCCCAGCTACTCCGGGG - Intronic
1127471922 15:59297701-59297723 CTGTAGTCCCAGCTACTCCAGGG - Intronic
1127475945 15:59333362-59333384 CTGTAATCCCAGCTACTCCGGGG - Intronic
1127486859 15:59426488-59426510 CTGTAATCCCAGCTACTGGGAGG + Intronic
1127560807 15:60134251-60134273 CTGTAATCCCAGCTACTCGAAGG + Intergenic
1127563913 15:60167918-60167940 CTGTAATCCCAGCTATTTCGGGG + Intergenic
1127581363 15:60341894-60341916 CTGGAAACCCAGCTCTCCCAGGG + Intergenic
1127786622 15:62361165-62361187 CTGTAATCTCAGCTATTGGGAGG - Intergenic
1127802823 15:62492434-62492456 CTGTAATCTCAGCTACTCCAAGG + Intronic
1127986438 15:64075770-64075792 CTGTAATTCCAGCTATTGGGAGG - Intronic
1128023092 15:64410146-64410168 CTGTAATCCCAGCTACTCAAGGG - Intronic
1128044216 15:64603392-64603414 CTGTAATCCCAGCTACTTCTGGG - Intronic
1128141942 15:65308341-65308363 CTGTAAACCCAGCTACTTAGGGG + Intergenic
1128154041 15:65380920-65380942 CTGTAATCCCAGCTATTCGGGGG + Intergenic
1128164525 15:65451801-65451823 CTGTAAACCCAGCTACTCGGGGG + Intronic
1128198024 15:65777910-65777932 CTGTAGTCCCAGCTACTGGAAGG + Intronic
1128222250 15:65977599-65977621 CTGTAATCCCAGCTATTCGGAGG - Intronic
1128274951 15:66345590-66345612 CTGTAATCCCAGCTACTGGGAGG + Intronic
1128373352 15:67057443-67057465 CTGTAATCCCAGCTACTACTCGG - Intergenic
1128431993 15:67605175-67605197 CTGTAATCCCAGCTACTCTAGGG - Intronic
1128463724 15:67891059-67891081 CTGTAATCCCAGCTGAAGCAGGG - Intergenic
1128823031 15:70679278-70679300 CTGTAATCCCAGCTACTAGAAGG + Intronic
1128932918 15:71721545-71721567 CTGTAATCCCAGCTACTTAAGGG + Intronic
1128979082 15:72173804-72173826 CTGTAATCCCAGCTACTCAAGGG + Intronic
1129247378 15:74287697-74287719 CTGTAATCCCAGCTACTGGGAGG + Intronic
1129286947 15:74533150-74533172 CTGTAATCCCAGCTACTCAAGGG + Intergenic
1129409817 15:75343810-75343832 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1129420701 15:75423871-75423893 CTGTAATCCCAGCTACTGAGAGG + Intronic
1129493451 15:75952677-75952699 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1129580044 15:76799383-76799405 CTGTAATCCCAGCTATTTGGGGG - Intronic
1129647749 15:77453103-77453125 CTGTAATCCCAGCTACTACTTGG + Intronic
1130005867 15:80097120-80097142 CTGTAATCCCAGCTACTAGAGGG - Intronic
1130031569 15:80318894-80318916 CTGTAATCCCAGCTACTCAAGGG + Intergenic
1130264443 15:82387191-82387213 CTGTAATCCCAGCACTTTCAAGG + Intergenic
1130507548 15:84559758-84559780 CTGTAATCCCAGCACTTTCAAGG - Intergenic
1130659257 15:85817371-85817393 CTGTAATCCCAGCTATTGAGAGG - Intergenic
1130846171 15:87748242-87748264 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1130849309 15:87778171-87778193 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1131436619 15:92427859-92427881 CTGTAATCCCAGCTATTTGGAGG + Intronic
1131488346 15:92840697-92840719 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1132138750 15:99370985-99371007 CTGTAATCCCAGCTACTGGGAGG + Intronic
1132191430 15:99865582-99865604 CTGTAATCCCAGCTATTAAGGGG + Intergenic
1202950626 15_KI270727v1_random:33686-33708 CTGTAGTCCCAGCTACTTCAGGG + Intergenic
1132494709 16:256694-256716 CTGTAATCCCAGCTACTACTTGG - Intronic
1132827594 16:1912912-1912934 CTGTAATCCCAGCTACTCCGGGG - Intronic
1133097219 16:3455827-3455849 CTGTAATCCCAGCTACTAAAAGG - Intronic
1133132230 16:3684041-3684063 CTGTAAACCCAGCTACTTGGGGG + Intronic
1133389680 16:5399608-5399630 CTGTAGTCCCAGCTACTGAAAGG + Intergenic
1133490210 16:6260756-6260778 CTGTAATCTCAGCTACTCCAGGG + Intronic
1133609413 16:7419025-7419047 CTGTAGTCCCAGCTACTCCAGGG - Intronic
1133672767 16:8039932-8039954 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1133735607 16:8612944-8612966 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1133829220 16:9306250-9306272 CTGTAATCCCAGCTATTCGGGGG - Intergenic
1133963574 16:10515539-10515561 CTGTAATCCCAGCCTTTGAAAGG + Intergenic
1134182463 16:12058913-12058935 CTGTAGACCCAGCTACTGGAGGG - Intronic
1134281265 16:12819118-12819140 CTGTAATCCCAGCTGCTGCTAGG + Intergenic
1134386173 16:13774752-13774774 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1134464685 16:14464632-14464654 CTGTAATCCCAGCTACTGAGAGG + Intronic
1134476400 16:14577788-14577810 CTGTAATCCCAGCTACTGGGGGG - Intronic
1134630276 16:15751280-15751302 CTGTAATCCCAGCTACTGGGAGG - Intronic
1134641362 16:15831814-15831836 CTGTAATCCCAGCTACTGGGAGG + Intronic
1134867816 16:17624282-17624304 CTGTAATCCCAGCTATTCCGGGG + Intergenic
1135003646 16:18799947-18799969 CTGTAAACCCAGCACTTGGCGGG + Intronic
1135124479 16:19796954-19796976 CAGTAATCCCAGCTATTGGGAGG + Intronic
1135140622 16:19918337-19918359 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1135201055 16:20437946-20437968 CTGTAATCCCAGCTACTGGGGGG - Intronic
1135218060 16:20589909-20589931 CTGTAATCCCAGCTACTGGTGGG + Intergenic
1135252570 16:20913432-20913454 CTGTAATCCCAGCTATTTGGAGG - Intronic
1135270865 16:21068434-21068456 CTGTAATCCCGGCTATTCCAAGG - Intronic
1135275465 16:21108618-21108640 CTGTAGACCCAGCTACTTCGGGG + Intronic
1135336200 16:21603259-21603281 CTGTAATCCCAGCTATGGAGAGG - Intronic
1135378226 16:21969409-21969431 CTGTAATCCCAGCTATCGGGGGG + Intronic
1135496657 16:22957273-22957295 CTGTAATCCCAGCTACTCCGGGG + Intergenic
1135541777 16:23335567-23335589 CTGTAATCCCAGCTATTGGGAGG - Intronic
1135678199 16:24435195-24435217 CTGTATTCCCAGCTATCGGAGGG + Intergenic
1135758502 16:25117728-25117750 CTGTAATCTCAGCTATTGGGAGG + Intronic
1135933954 16:26763021-26763043 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1135971039 16:27072173-27072195 CTGTAATCCCAGCTACTCGAGGG - Intergenic
1136107007 16:28037146-28037168 CTGTAATCCCAGCTATTCAGAGG - Intronic
1136136855 16:28261505-28261527 CTGTAGTCCCAGCTATTCCAGGG + Intergenic
1136222885 16:28839769-28839791 CTGTAATCCCAGCTACTTGAAGG + Intergenic
1136371436 16:29839060-29839082 CTGTAATCCCAGCTACTGCTCGG + Intronic
1136400173 16:30012595-30012617 CTGTAATCCTAGCTACTCCAGGG + Intronic
1136445998 16:30319403-30319425 CTGTAATCCCAGCTATTTGGGGG - Intergenic
1136462325 16:30419111-30419133 CTGTAATCCCAGCTACTGAGGGG + Exonic
1136592532 16:31226058-31226080 CTGTAATCCCAGCACTTGGAAGG - Intronic
1137430296 16:48413068-48413090 CTGTAATCCCAGCTACTGGGGGG - Intronic
1137522828 16:49209567-49209589 ATGTAAAACCAGCTAGGGCAGGG - Intergenic
1137544198 16:49388632-49388654 CTGTAATCCCAGCTACTTGAGGG - Intronic
1137824153 16:51475216-51475238 CTGTAGTCTCAGCTATTCCAGGG - Intergenic
1137969037 16:52965465-52965487 CTGTAATCCCAGCTACTCGAAGG - Intergenic
1137978921 16:53053772-53053794 CTGTAATCCCAACTACTCCAAGG - Intergenic
1137993311 16:53181955-53181977 CTGTAATCCCAGCTATCGGGAGG + Intronic
1138012337 16:53394222-53394244 CTGTAGTCCCAGCTACTGCGGGG + Intergenic
1138211576 16:55167437-55167459 CTGTAATCCCAGCTACTCCCAGG + Intergenic
1138241519 16:55431186-55431208 CTGTAATCCCAGCTATTGGAAGG - Intronic
1138407439 16:56807897-56807919 CTGTAATCCCAGCTACTCCAGGG + Intronic
1138437032 16:57007605-57007627 CTGTAATCCCAGCTATTGGGAGG + Intronic
1138602146 16:58062302-58062324 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1138625929 16:58251512-58251534 CTGTAATCCCAGCTATTCAGGGG - Intronic
1138856191 16:60696311-60696333 CTGTAATCCCAGCTACTGAGGGG + Intergenic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1138876033 16:60951062-60951084 CTGTAGTCCCAGCTATTCAAGGG - Intergenic
1138938513 16:61760431-61760453 CTGTAATCCCAGCTACTGGGAGG - Intronic
1139092034 16:63659951-63659973 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1139258585 16:65568364-65568386 CTGTAATCCCAGCTACTTGAGGG + Intergenic
1139451625 16:67031946-67031968 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1139482869 16:67240401-67240423 CTGTAATCCCAGCTACTGCTGGG + Intronic
1139628172 16:68208605-68208627 CTGTAATCCCAGCTATTTGTGGG + Intronic
1139769690 16:69264051-69264073 CTGTAATCCCAGCTTTTGGGAGG - Intronic
1139802359 16:69533505-69533527 CTGTAATCCCAGCTACTCGAGGG - Intergenic
1139821152 16:69722283-69722305 CTGTAATCCCAGCTATTCGGAGG - Intronic
1139933528 16:70549800-70549822 CTGTAATCCCAGCTACTTAAGGG + Intronic
1140214014 16:72993012-72993034 CTGTAATCCCAGCTACTCCCAGG + Intronic
1140465956 16:75182894-75182916 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1140494110 16:75367980-75368002 CTGTAATCCCAGCTACTCAAGGG + Intronic
1140494771 16:75375667-75375689 CTGTAGTCCCAGCTACTCCAAGG + Intronic
1140675005 16:77319563-77319585 CTGTAATCCCAGCTATTAGTGGG - Intronic
1140764499 16:78144641-78144663 CTGTAATCCCAGCTATTGGGAGG - Intronic
1140782981 16:78313486-78313508 CTGTAATCTCAGCTACTCCAGGG - Intronic
1141014655 16:80437711-80437733 CTGGAAATCCAGCTCATGCAAGG + Intergenic
1141070484 16:80949781-80949803 CTGTAATCCCAGCTACTGAGGGG + Intergenic
1141129037 16:81422187-81422209 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1141198579 16:81879980-81880002 CTGTAATCCCAGCTACTGAGGGG + Intronic
1141458196 16:84158851-84158873 CTGTAATCCCAGCTATTCATGGG - Intronic
1141542311 16:84735151-84735173 CTGTAATCCCAGCTATTCAGGGG - Intronic
1141566427 16:84905519-84905541 CTGTAATCCCAGCTAGTTGAAGG - Intronic
1142470191 17:158920-158942 CTGTAATCCCAGCTATTGGGAGG + Intronic
1142594727 17:1023900-1023922 CTGTAAACCCAGCTACTCAGGGG + Intronic
1142616029 17:1135751-1135773 CTGTAATCCCAGCTATTCGGGGG + Intronic
1142735443 17:1895803-1895825 CTGTAATCCCAGCTACTCGAGGG - Intronic
1142837698 17:2600853-2600875 CTGTAATTCCAGCTATTACTAGG - Intronic
1142842351 17:2643374-2643396 CTGTAATCCCAGCTATTAGGGGG - Intronic
1142860733 17:2759571-2759593 CTGTAATCCCAGCTACTCCGGGG - Intergenic
1142934102 17:3312744-3312766 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1143034091 17:3984545-3984567 CTGTAATCCCAGCTACTGGGGGG - Intergenic
1143082598 17:4392943-4392965 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1143086770 17:4421885-4421907 CTGTAATCCCAGCTACTTCTGGG + Intergenic
1143132155 17:4685668-4685690 CTGTAGTCCCAGCTATTGGTGGG + Intronic
1143224478 17:5288824-5288846 CTGTAATCCCAGCTACTTGAGGG - Intronic
1143233468 17:5377781-5377803 CTGTAATCCCAGCATTTGCAAGG - Intronic
1143286028 17:5789954-5789976 CTGTCAACCCAGTTACTCCAAGG + Intronic
1143550682 17:7628566-7628588 CTGTAATCCCAGCTACTCCGAGG - Intronic
1143697806 17:8632952-8632974 CTGTAATCCCAGCATTTTCAGGG - Intergenic
1144220783 17:13097967-13097989 CTGTAATCCCAGCTATCGAGAGG - Intergenic
1144351438 17:14400994-14401016 CTGTAATCCCAGCTACTGAGAGG - Intergenic
1144472419 17:15556609-15556631 CTGTAATCCCAGCAATTGGGAGG - Intronic
1144526158 17:15992047-15992069 CTGTAATCCCAGCTATTCGGGGG - Intronic
1144537439 17:16104647-16104669 CAGTAATCCCAGCTATTGGGAGG + Intronic
1144549584 17:16228172-16228194 CTGTAATCCCAGCTATTCAGGGG - Intronic
1144657571 17:17047053-17047075 CTGTAATCCCAGCTACTCCTTGG + Intronic
1144695033 17:17297921-17297943 CTGTAATCCCAGCTACTCCAGGG - Intergenic
1144701853 17:17345536-17345558 CTGTAGTCCCAGCTACTTCAGGG + Intronic
1144823115 17:18089258-18089280 CTGTAATCCCAGCTATTTGGAGG - Intronic
1145025510 17:19465185-19465207 CTCTAATCCCAGCTATTGGGAGG + Intergenic
1145199750 17:20932814-20932836 CTGTAAACCCAGCTACTTGGGGG - Intergenic
1145737342 17:27242132-27242154 CTGTAATCCCAGCACTTTCAGGG + Intergenic
1145947824 17:28791164-28791186 CTGTAATCCCAGCTTTTGGGAGG - Intronic
1146034959 17:29398326-29398348 CTGTAATCCCAGCTGTTGGGAGG - Intronic
1146070117 17:29672827-29672849 CTGTAATCCCAGCTACTACTCGG - Intronic
1146155087 17:30516834-30516856 CTGTAATCCCAGCTACTGGGAGG - Intronic
1146174694 17:30658293-30658315 CTGTAATCCCAGCTACTTGAGGG + Intergenic
1146197513 17:30825646-30825668 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1146218217 17:30995877-30995899 CTGTAATCCCAGCTACTACTAGG - Intronic
1146219107 17:31002988-31003010 CTGTAATCCCAGCTATTTGGAGG + Intergenic
1146348154 17:32074304-32074326 CTGTAATCCCAGCTACTTGAGGG + Intergenic
1146408166 17:32557627-32557649 CTGTAGTCCCAGCTACTGGATGG - Intronic
1146716552 17:35090915-35090937 CTGTAGACCCAGCTATAGGGTGG - Intronic
1146993085 17:37293662-37293684 CTGTAATCCCAGCTACTGGGGGG - Intronic
1147000063 17:37355733-37355755 CTGTAATCCCAGCTACTCGAGGG + Intronic
1147253940 17:39170645-39170667 CTGTAATCCCAGCTACTCAAAGG - Intergenic
1147334882 17:39721394-39721416 CTGTAATCCCAGCTACTGGGGGG - Intronic
1147346754 17:39802667-39802689 CTGTATTCCCAGCTATTCCCAGG - Intronic
1147728901 17:42584683-42584705 CTGTAGTCCCAGCTACTGAAGGG + Intronic
1147736834 17:42644494-42644516 CTGTAATCCCAGCTACTTGAAGG - Intergenic
1147752156 17:42742990-42743012 CTGTAATCCCAGCTATTCAGGGG - Intronic
1147754151 17:42757061-42757083 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1147803010 17:43108085-43108107 CTGTAATCCCAGCACTTGCGGGG + Intronic
1147889843 17:43709636-43709658 CTGTAATCCCAGCTACTACTCGG - Intergenic
1148030920 17:44620291-44620313 CTGTAATCCCAGCTACTTCGGGG + Intergenic
1148057678 17:44810894-44810916 CTGTAGTCCCAGCTACTGCAGGG - Intronic
1148118969 17:45196515-45196537 CTGTAATCCCAGCTCTTGGGAGG - Intergenic
1148168053 17:45497574-45497596 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1148182016 17:45612984-45613006 CTGTAATCCCAGCTACTGGGGGG - Intergenic
1148272231 17:46270782-46270804 CTGTAATCCCAGCTATTGGGGGG + Intergenic
1148280764 17:46345383-46345405 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148302992 17:46563318-46563340 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148885464 17:50768960-50768982 CTGTAATCCCAGCTATTTATAGG - Intergenic
1148938978 17:51190597-51190619 CTGTAGTCCCAGCTACTCCAGGG + Intronic
1149152077 17:53578681-53578703 CTGTAATCCCAGCTACTTGAAGG + Intergenic
1149679812 17:58498103-58498125 CTGTAAACCCAGCTCCTACTTGG + Intronic
1149762803 17:59247751-59247773 CTGTAATCCCAGCTATTTGGGGG - Intronic
1149841648 17:59970241-59970263 CTGTAATCCCAGCTACTGGGGGG - Intronic
1149864730 17:60144985-60145007 CTGTAATCCCAGCAATTTGAGGG - Intergenic
1149893554 17:60411200-60411222 CTGTAATCCCAGCTATTTGGGGG + Intronic
1149971543 17:61223277-61223299 CTGTAATCCCAGCTATTGGGGGG - Intronic
1150057951 17:62036999-62037021 CTGTAATCCCAGCACTTGGAAGG + Intronic
1150348344 17:64422003-64422025 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1150783619 17:68144070-68144092 CTGTGATCCCAGCTATTGAAAGG - Intergenic
1150825374 17:68470202-68470224 CTGTAATCCCAGCTATTAGGAGG - Intergenic
1151065500 17:71144848-71144870 CTGTAATCCCAGCTACTTGAGGG + Intergenic
1151606281 17:75138528-75138550 CTATAACCCCAGCTATTGGGAGG - Intronic
1151626912 17:75282425-75282447 CTGTAATCCCAGCTACTGGGAGG + Intronic
1151651197 17:75470794-75470816 CTGTAATCCCAGCTACTTGAGGG + Intronic
1151670570 17:75569679-75569701 CTGTAATCCCAGCTACTGGAAGG + Intronic
1151708116 17:75782738-75782760 CTGTAATCCCAGCTCTTGGGAGG + Intronic
1152051941 17:77986157-77986179 CTGTAATCCCAGCACTTGGAAGG + Intergenic
1152152063 17:78607930-78607952 AAGTAAACCCATCTATTGAAAGG - Intergenic
1152343899 17:79740070-79740092 CTGTAATCCCAGCTACTGGCAGG + Intronic
1152348010 17:79766243-79766265 CTGTAATCCCAGCTACTTGAGGG - Intergenic
1152517308 17:80833217-80833239 CTGAAAACCCAGCTCTTGCCTGG + Intronic
1152681226 17:81669266-81669288 CTGTAATCCCAGCTACTGGGGGG - Intronic
1152813829 17:82395286-82395308 CTGTAATCCCAGCACTTGCAAGG - Intronic
1152815811 17:82407089-82407111 CTGTAATCCCAGCTGTAGCTGGG + Intronic
1152831322 17:82498528-82498550 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1153327662 18:3837727-3837749 CTGTAAAGCCAGCTATTTGGGGG + Intronic
1153495366 18:5692846-5692868 CTGTAATCCCAGCTATTGGGGGG + Intergenic
1153653041 18:7258031-7258053 CTGTAATCCCAGCAATTGGGAGG - Intergenic
1153803443 18:8691510-8691532 CTGTAATCCCAGCTTTTGGGAGG + Intergenic
1154247665 18:12714005-12714027 CTGTAATCCCAGCATTTGAAAGG - Intronic
1154271475 18:12924135-12924157 CTGTAATCCCAGCTACTTGAGGG - Intronic
1154351360 18:13586283-13586305 CTGTAATCCCAGCTACTGGGAGG + Intronic
1154513230 18:15133428-15133450 CAGTAAAGCCATCTATTGTAGGG - Intergenic
1154960438 18:21302976-21302998 CTGTAATCCCAGCACTTTCAGGG - Intronic
1155098203 18:22580560-22580582 CTGTAATCCCAGGGATTACAGGG + Intergenic
1155158022 18:23173839-23173861 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1155274281 18:24171154-24171176 CTGTAATCCCAGCCATTGGGAGG - Intronic
1155454194 18:25993643-25993665 CTGTAATCCCAGCTACTCAAGGG + Intergenic
1155480776 18:26285088-26285110 CTGTAGTCCCAGCTACCGCAGGG - Intronic
1155714287 18:28920953-28920975 CTGTAATCCCAGCTACTCCAGGG - Intergenic
1155758745 18:29537175-29537197 CTGTAATCCCAGCAATTGGGAGG - Intergenic
1155944945 18:31837574-31837596 CTGTAATCCCAGCTACTCAAAGG + Intronic
1156078701 18:33310561-33310583 CTGTAATCCCAGCTATTCAAGGG + Intronic
1156336940 18:36180979-36181001 CTGTAATCCCAGCTATTCAGGGG - Intergenic
1156385752 18:36603624-36603646 CTGTAATCCCAGCTACTAGAGGG - Intronic
1156429083 18:37051579-37051601 CTGTGAACCCATCTAGTACAGGG - Intronic
1156600341 18:38598354-38598376 CTGTAATCCCAGCACTTGGAAGG + Intergenic
1156842764 18:41628905-41628927 CTGTAGTCCCAGCTATTCCAGGG - Intergenic
1156897630 18:42264556-42264578 CTGTAATGCCAGCTATTAAAAGG - Intergenic
1157142199 18:45120861-45120883 CTGTAAACCCAGCTACTAGGGGG - Intergenic
1157253285 18:46115334-46115356 CTGTAATCCCAGCTACTAGAGGG + Intronic
1157308681 18:46535691-46535713 CTGTAATCCCAGCTACTCCAGGG - Intronic
1158465133 18:57683083-57683105 CTGTAATCCCAGCATTTGGAAGG - Intronic
1158948297 18:62467264-62467286 CTGTAATTCCAGCTATTTGAGGG - Intergenic
1159050775 18:63419289-63419311 CTGTAATCCCAGCTGCTACATGG + Intronic
1159064206 18:63551446-63551468 CTGTAATCCCAGCTACTTGAGGG - Intergenic
1159244429 18:65786943-65786965 CTATAATCCCAGCTATTGGGGGG - Intronic
1159362023 18:67417635-67417657 CTGTAATCCCAGCTTTTGGGAGG - Intergenic
1159963317 18:74572663-74572685 CTGTAGTCCCAGCTATTTAAGGG + Intronic
1160489063 18:79321503-79321525 CTGTAATCCCAGCTATTTGGGGG - Intronic
1160596318 18:79977080-79977102 CTGTAATCCCAGCTACTGGGAGG - Intronic
1160612946 18:80103053-80103075 CTGTAATCCCAGCTACTGAGGGG - Intergenic
1161050772 19:2163194-2163216 CTGTAATCCCAGCTACTGCGGGG - Intronic
1161325716 19:3662981-3663003 CTGTAATCCCAGCTCTTGGGAGG - Intronic
1161689896 19:5725776-5725798 CTGTAATCCCAGCTATCGGGAGG + Intronic
1161691938 19:5740642-5740664 CTGTAATCCCAGCTATCGGGAGG + Intronic
1161764915 19:6201909-6201931 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1161787816 19:6338997-6339019 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1161830927 19:6603673-6603695 CTGTAATCCCAGCTACTGGGGGG - Intronic
1161837171 19:6655507-6655529 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1161927403 19:7311565-7311587 CTGTAATCCCAGCACTTGGAAGG - Intergenic
1162076482 19:8191279-8191301 CTGTAATCCCAGCTACTCGAGGG - Intronic
1162112553 19:8407829-8407851 CTGTAATCCCAGCTACTCCAGGG + Intronic
1162195852 19:8984119-8984141 CTGTAATTCCAGCTACTCCAGGG - Intergenic
1162313944 19:9925689-9925711 CTGTAATCCCAGCAATTGGGAGG - Intronic
1162338896 19:10079533-10079555 CTGTAATCCCAGCTACTACTTGG + Intergenic
1162404166 19:10463521-10463543 CTGTAATCCCAGCTATAGTGGGG - Intronic
1162417719 19:10548150-10548172 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1162463059 19:10824678-10824700 CTGTAATCCCATCTACTCCAGGG + Intronic
1162469276 19:10862705-10862727 CTGTAATCCCAGCTATTAGGAGG + Intronic
1162509544 19:11109815-11109837 CTGTAATCCCAGCTACTGAGGGG - Intronic
1162659109 19:12155970-12155992 CTGTAATCCCAGCTACTGGGGGG - Intronic
1162749468 19:12819755-12819777 CTGTAATCCCAGCTACTCCAGGG + Intronic
1162761724 19:12892412-12892434 CTGTAATCCCAGCTACTAGAGGG - Intronic
1162809800 19:13156848-13156870 CTGTAATCCCAGCTATCCGAAGG + Intergenic
1162842380 19:13365788-13365810 CTGTAGTCCTAGCTATTGCAGGG - Intronic
1162943735 19:14030077-14030099 CTGTAATCCCAGCACTTCCAGGG - Intronic
1162960901 19:14125978-14126000 CTATAGACCCAGCTACTCCAGGG - Intronic
1163014946 19:14449060-14449082 CTGTAGTCCCAGCTATTAGAAGG - Intronic
1163206877 19:15809937-15809959 CTGTAGTCCCAGCTATTTAAGGG - Intergenic
1163259759 19:16181617-16181639 GTGTAATCCCACCTACTGCAGGG + Intergenic
1163352424 19:16786263-16786285 CTGTAATCCCAGCACTTTCAGGG - Intronic
1163410542 19:17151154-17151176 CTGTAATCTCAGCTACTGGAAGG + Intronic
1163460449 19:17434244-17434266 CTGTAATCCCAGCTACTGGGTGG + Intergenic
1163855086 19:19695359-19695381 CTGTAATCCCAGCTACTCCGGGG - Intergenic
1163868581 19:19797321-19797343 CTGTAATCCCAGCTATTCAGGGG + Intronic
1163877784 19:19889466-19889488 CTGTAATCCCAGCTACTGGGAGG - Intronic
1163889672 19:19999789-19999811 CTGTAACCCCAGCAATTGGGAGG - Intronic
1163909716 19:20178044-20178066 CTGTAATCCCAGCTACTCAAAGG - Intronic
1163957769 19:20660135-20660157 CTGTAATCCCAGCTACTGGTGGG + Intronic
1164021977 19:21315945-21315967 CTGTAATCCCAGCTACTGAGAGG + Intronic
1164075246 19:21810825-21810847 CTGTACACCCAGCTACTTAAGGG + Intronic
1164107520 19:22121907-22121929 CTGTAATCCCAGCTATTCTGGGG - Intergenic
1164133499 19:22388136-22388158 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1164165308 19:22668619-22668641 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1164167070 19:22689693-22689715 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1164311068 19:24046984-24047006 CTGTAATCCCAGCTATTCAGAGG - Intronic
1164550685 19:29209713-29209735 CTGTAATCCCAGGTAGTGCTAGG - Intronic
1164572743 19:29385996-29386018 CTGTAATCCCAGCTACTCAAGGG - Intergenic
1164627457 19:29738905-29738927 CTATAGTCCCAGCTATTGCGAGG + Intergenic
1164641763 19:29831492-29831514 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1164666735 19:30044120-30044142 CTGTAATCCCAGCTACTACTCGG - Intergenic
1165015131 19:32875163-32875185 CTGTAATCCCAGCTATTCGGGGG + Intergenic
1165082533 19:33317277-33317299 CTGTAATCCCAGCTATGGGGTGG - Intergenic
1165233651 19:34403601-34403623 CTGTAACCCCAGCTACTGGGTGG + Intronic
1165616081 19:37202135-37202157 CTGTAATCCCAGCTACTGGTAGG - Intronic
1165644172 19:37419599-37419621 CTGTAATCCCAGCTACTGGGAGG + Intronic
1165685315 19:37814826-37814848 CTGTAATCCCAGCTACTAGAGGG + Intronic
1165747755 19:38240429-38240451 CTGTAATCCCAGCTACTACTTGG + Intergenic
1165894832 19:39135456-39135478 CTGTAATCCCAGCTACTTGAGGG - Intronic
1165932020 19:39365429-39365451 CTGTAATCCCAGCTACTGGTGGG + Intronic
1165961381 19:39537441-39537463 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1165990306 19:39807779-39807801 CTGTAATCCCAGCTACTCCGGGG + Intergenic
1166056138 19:40290122-40290144 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1166082514 19:40452936-40452958 CTGTAATCCCAGCTATTCTCAGG + Intronic
1166143097 19:40815920-40815942 CTGTAATCCCAGCTACTCTAGGG + Intronic
1166154745 19:40902501-40902523 CTGTAATCCCAGCTACTTCAGGG - Intergenic
1166189507 19:41166630-41166652 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1166249042 19:41553225-41553247 CTGTAATCCCAGCTACTCAAGGG - Intronic
1166462789 19:43004152-43004174 CTGTAATCCCAGCCTTTGGAAGG + Intronic
1166513087 19:43424110-43424132 CTGTAGTCCCAGCTACTGGAGGG - Intergenic
1166529073 19:43531902-43531924 CTGTAGTCCCAGCTATTTCACGG - Intronic
1166773610 19:45299299-45299321 CTGTAGTCCCAGCTACTTCAGGG + Intronic
1166815072 19:45539654-45539676 CTGTAATCCCAGCTACTGGGCGG + Intronic
1167075808 19:47248321-47248343 CTGTAATCCCAGCTACTCCGGGG - Intergenic
1167119402 19:47507674-47507696 CTGTAAGCCCACCTCCTGCACGG + Intronic
1167143278 19:47666831-47666853 CTGTAATCCCAGCCAAGGCAGGG - Intronic
1167168319 19:47814176-47814198 CTGTATTCCCAGCTATTGGGAGG - Intronic
1167207292 19:48111233-48111255 CTGTAATCCCAGCTACTACTCGG + Intergenic
1167233538 19:48299678-48299700 CTGTAATCCCAGCTACTGGGAGG + Intronic
1167291335 19:48626691-48626713 CTGTAATCCCAGCTACAGGAGGG + Intronic
1167382630 19:49147562-49147584 CTGTAATCCCAGCTACTCGAAGG + Intronic
1167496438 19:49821692-49821714 CTGTAATCCCAGCTCTTGGGAGG + Intronic
1167841929 19:52129153-52129175 CTGTAATCCCAGCTATTGGGAGG + Intronic
1167897210 19:52591676-52591698 CTGTAATCCCAGCTACTTGAAGG - Intergenic
1167950988 19:53027640-53027662 CTGTAATCACAGCTATTGGGAGG - Intergenic
1168050288 19:53824717-53824739 CTGTAATCCCAGCTACTCAAGGG - Intergenic
1168211163 19:54891522-54891544 CTGTAGTCCCAGCTACTCCAGGG + Intergenic
1168299197 19:55393769-55393791 CTGTAATCCCAGCTACTTGAGGG - Intronic
1168325247 19:55535609-55535631 CTGTAATCCCAGCAATTGGGAGG + Intronic
1168391830 19:56015315-56015337 CTGTAATCCCATCTACTGGAAGG - Intronic
1168496550 19:56856285-56856307 CTGTAATCCCAGCTACTACTCGG + Intergenic
1168568682 19:57445804-57445826 CTGTAATCCCAGCTATTCAGGGG + Intronic
1168622014 19:57887064-57887086 CTGTAATCCCAGCTACTGGGAGG + Intronic
1168704064 19:58458288-58458310 CTGTAATCCCAGCTACTGGAGGG - Intergenic
925902326 2:8517486-8517508 CTGTAATCCCAGCTATTTGGGGG + Intergenic
926093383 2:10064838-10064860 CTGTAATCCCAGCTACTCCGGGG - Intronic
926497218 2:13605178-13605200 CTGTAATCCCAGCTCTTGAAAGG - Intergenic
926770775 2:16373025-16373047 CTGTAGTCCCAGCTACTGCAGGG - Intergenic
927150688 2:20194004-20194026 CTGTAATCCCAGCTACTACTCGG + Intergenic
927329566 2:21846239-21846261 CTGTAAACCCAGCTACTAGGGGG - Intergenic
927368524 2:22327486-22327508 CTGTAGTCCCAGCTATTGGGAGG + Intergenic
927549349 2:23983796-23983818 CTGTAATCCCAGCTACTAGAGGG - Intronic
927581312 2:24251200-24251222 CTGTAATCCCAGCTATTCAAGGG + Intronic
927675324 2:25101469-25101491 CTGTAATCCCAGCTACTCAAAGG - Intronic
927704785 2:25290442-25290464 CTGTAATCCCAGCTACTGGTTGG - Intronic
927753199 2:25688113-25688135 CTGTAATCCCAGCTACTTGACGG - Intergenic
927755402 2:25704581-25704603 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
927902218 2:26828730-26828752 CTGTAATCCCAGCTAGTACTCGG + Intergenic
928137547 2:28699488-28699510 CTGTAATCCCAGCTACTCAAGGG + Intergenic
928183629 2:29089907-29089929 CTGTAGACCCAGCTACTTAAAGG + Intergenic
928512683 2:32016154-32016176 TTGTAATCCCAGCACTTGCAAGG - Intronic
928513305 2:32021553-32021575 CTGTAATCCCAGCTACTGGGGGG + Intronic
928553098 2:32393640-32393662 CTGTAATCCCAGCTACTTGAGGG - Intronic
928560596 2:32480762-32480784 CTGTAATCCCAGCTATTCCAGGG - Intronic
928804705 2:35136710-35136732 CTGTAATCCCAGCTACTTGAGGG - Intergenic
929519310 2:42633324-42633346 CTGTAATCCCAGCAATTGGGGGG + Intronic
929602622 2:43213958-43213980 CTGTAATCCCAGCTACTAGAGGG - Intergenic
929683844 2:44017579-44017601 CTGTAGACCCAGCTAGTTGAGGG + Intergenic
929704193 2:44193699-44193721 CTGTAATCCCAGCTACTGGGGGG - Intronic
929724703 2:44412951-44412973 CTGTAAACCCAGCTATTAGGGGG + Intronic
930009450 2:46924747-46924769 CTGTAGTCCCAGCTATTCCAGGG - Intronic
930041129 2:47125297-47125319 CTGTAATCCCAGCTACTTGAGGG + Intronic
930178223 2:48322066-48322088 CTGTAGTCCCAGCTACTCCAGGG - Intronic
931148952 2:59551219-59551241 CTGTAATCCCAGCTACTGGGAGG + Intergenic
931195438 2:60048229-60048251 GTGTATCCCCAGCTGTTGCAGGG - Intergenic
931309310 2:61063819-61063841 CTGTAATACCAGCTACTCCAAGG - Intergenic
931315832 2:61130232-61130254 CTGTAATCCCAGTTGTTGCCTGG - Intronic
931333723 2:61317402-61317424 CTGTAATCCCAGCTACTTCGGGG + Intronic
931399282 2:61915751-61915773 CTGTAATCCCAGCAATTGGGAGG - Intronic
931421544 2:62132586-62132608 CTGTAATCCCAGCTCTTTGAAGG + Intronic
931479275 2:62623231-62623253 CTGTAATCCCAGCTATTCAGGGG - Intergenic
931768530 2:65477931-65477953 CTGTAATCCCAGCACTTGGAAGG + Intergenic
931832534 2:66067651-66067673 CTGTAGTCCCAGCTATTTAAGGG - Intergenic
931866533 2:66418380-66418402 CTGTAATCCCAGCATTTGGAAGG + Intergenic
931963961 2:67512981-67513003 CTGTAGTCCCAGCTATTGAGAGG + Intergenic
932109839 2:68987947-68987969 CTGTAATCCCAGCTACTGGGAGG + Intergenic
932234157 2:70107865-70107887 CTGTAGTCCCAGCTACTCCAGGG + Intergenic
932399759 2:71471841-71471863 CTGTAATCCCAGCTACTTGAGGG + Intronic
932815883 2:74861296-74861318 CTGTAATCCCAGCTACTGGGGGG + Intronic
932826322 2:74944282-74944304 CTGTAAACACATGTATGGCATGG + Intergenic
933327799 2:80861085-80861107 CTGTAAACCCAGCTACTAGGAGG + Intergenic
933411017 2:81925146-81925168 CTGTAATTCCAGCTACTGCAGGG + Intergenic
933425088 2:82100563-82100585 CTGTAGTCACAGCTATTACATGG + Intergenic
933737188 2:85504601-85504623 CTGTAATCCCAGCTTTTGGTAGG - Intergenic
933830188 2:86200787-86200809 CTGTAATCCCAGCTACTCCAAGG - Intronic
933881160 2:86671236-86671258 CTGTAATCCCAGCTATTGGGAGG + Intronic
934583861 2:95471438-95471460 CTGTAATACCAGCCATTGGAAGG + Intergenic
934595591 2:95605276-95605298 CTGTAATACCAGCCATTGGAAGG - Intergenic
934743224 2:96740881-96740903 CTGTAATCCCAGCTACTGGGAGG + Intergenic
935115573 2:100133048-100133070 CTGTAATCCCAGCTGTTGGGAGG - Intronic
935162019 2:100537533-100537555 CTGTAATCCCAGCTATTCAGGGG + Intergenic
935609291 2:105004425-105004447 TTGTAAACCCAGCTACTCAAGGG - Intergenic
935895519 2:107733543-107733565 CTGTAGTCCCAGCTACTCCAGGG - Intergenic
936585507 2:113754165-113754187 CTGTAATCCCAGCTATTCAGGGG + Intronic
936862772 2:117037474-117037496 CTGTAATCCCAGCTATTCAAGGG + Intergenic
937109652 2:119354400-119354422 CTGTAAGCCCAGCTACTGGGAGG + Intronic
937625746 2:124041981-124042003 CTGTAATCCCAGCTATTCGGAGG - Intronic
937992083 2:127669593-127669615 CTGTAGTCCCAGCTACTGGAGGG + Intronic
938010710 2:127826685-127826707 CTGTAATCCCAGCTACTGGGAGG + Intergenic
938212144 2:129477350-129477372 CTGTAATCCCAGCTATAGGGAGG + Intergenic
938227475 2:129628232-129628254 CTGTAATCCCAGCAATTTTAGGG - Intergenic
938416560 2:131107783-131107805 CTGTAATCCCAGCTATTTGGGGG - Intronic
938463700 2:131513452-131513474 CTGTAATCCCAGCTACTCAAGGG - Intergenic
938548755 2:132360534-132360556 CTGTAATCCCAGCTACTCCGGGG + Intergenic
938614517 2:132983613-132983635 ATGTTAATCTAGCTATTGCATGG + Intronic
938793237 2:134695332-134695354 CTGTAATCCCAGCTACTGGGAGG - Intronic
938828485 2:135030798-135030820 CTGTAATCCCAGCTACTGGGAGG + Intronic
939059192 2:137399313-137399335 CTGTAATCCCAGCTATTCAAGGG - Intronic
939118374 2:138087869-138087891 CTGAAATCAGAGCTATTGCAAGG + Intergenic
939129579 2:138218401-138218423 CTGTGAACCCAGGTTTAGCAAGG + Intergenic
939715380 2:145577779-145577801 CTGTAATCCCATCTACTCCATGG + Intergenic
940160280 2:150704506-150704528 CTGTAGACCCAGCTATCGGGAGG - Intergenic
940210930 2:151256082-151256104 CTGTAATCCCAGCTACTTGAGGG - Intronic
940305469 2:152221214-152221236 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
940306966 2:152237255-152237277 CTGTAGTCCCAGCTACTCCAGGG - Intergenic
941081736 2:161069509-161069531 CTGTAGTCCCAGCTACTCCAGGG + Intergenic
941448341 2:165628807-165628829 CTGTAATCCCAGCTTTTGGGAGG + Intronic
941575202 2:167221339-167221361 CTGTAATCCCAGCTACTGGGAGG + Intronic
941682919 2:168418237-168418259 CTGTAATCCCAGCTACTTGAGGG + Intergenic
941918155 2:170825447-170825469 CTGTTCACCAAGCTATGGCATGG - Intronic
941956567 2:171211670-171211692 CTGTAATCCCAGCTATTCAGGGG - Intronic
941962678 2:171269273-171269295 CTGTAATCCCAGCACTTGGAAGG + Intergenic
941993805 2:171582411-171582433 CTGTAATCCCAGCTACTGGGGGG + Intergenic
942105800 2:172632143-172632165 CTGTAATCCCAGCTATAGGGAGG + Intergenic
942566634 2:177270905-177270927 CTGTAATCCCAGCTACTGGGGGG - Intronic
942580849 2:177414326-177414348 CTGTAATCCCAGCTACTACAAGG - Intronic
943027422 2:182646560-182646582 CTGTAATCCCAGCTATTCGGAGG + Intergenic
943057347 2:182998705-182998727 CTGTAATCCCAGCTACTGAGGGG + Intronic
943205752 2:184892604-184892626 CTGTAATCCCAGCTACTGGGGGG - Intronic
943417316 2:187624598-187624620 CTGTAATCCCAGCTACTCAAGGG + Intergenic
943608417 2:190003739-190003761 CTGTAATCCCAGCTACTGCTCGG + Intronic
943663753 2:190587321-190587343 CTGTAACCCAAGCTGCTGCAAGG + Intergenic
944097915 2:195990532-195990554 CTGTAGTCCCAGCTACTCCAAGG + Intronic
944567021 2:201001792-201001814 CTGTAATCCCAGCTACTGGGTGG - Intronic
944580026 2:201124455-201124477 CTGTAATCCCAGCTACTCGAGGG - Intronic
944657406 2:201889925-201889947 CTGTAGTCCCAGCTACTGCGAGG + Intronic
944704594 2:202276213-202276235 CTGTAATCCCAGCTACTGGGAGG + Intronic
944764202 2:202848327-202848349 CTATAAAAACAGCAATTGCATGG + Intronic
944787332 2:203086655-203086677 CTGTAATCCCAGCTATTTGGGGG - Intronic
945005816 2:205404769-205404791 CTGTAAACCCAGCACTTGGGAGG - Intronic
945139864 2:206673378-206673400 CTGTAATCCCAGCTACTGGAGGG - Intronic
945234110 2:207618578-207618600 CTGTAATCCCAGCTACTCAATGG + Intronic
945254168 2:207790216-207790238 CTGTAATCCCAGCTGTTGGGAGG - Intergenic
945271935 2:207949416-207949438 CTGTAATCCCAGCTACTGGAAGG + Intronic
945422852 2:209660513-209660535 CTGTAGTCCCAGCTATTGGGAGG - Intronic
945526306 2:210891796-210891818 CTGCAAATCCATCTATTCCAGGG - Intergenic
945637159 2:212369812-212369834 CTGTAATCCTAGCTATTGTGAGG - Intronic
945660581 2:212680899-212680921 CTGTAATCCCAGCTACTCAAGGG - Intergenic
945893570 2:215457212-215457234 CTGTAATCCCAGCTACTGGGAGG - Intergenic
946018121 2:216620487-216620509 CTGTAATCCCAGCTATTAGGGGG + Intergenic
946137795 2:217662378-217662400 CTGTAATCCCAGCTACTACTTGG + Intronic
946169041 2:217883385-217883407 CTGTTAGCACAGCTATTCCAGGG - Intronic
946323600 2:218969759-218969781 CTGTAATCCCAGCTTTTGGGAGG - Intergenic
946417173 2:219545826-219545848 CTGTCTACCCACCCATTGCAGGG - Intronic
946426409 2:219600183-219600205 CTGTAATCCCAGCTACTCGAGGG - Intronic
946754104 2:222925468-222925490 CTGTAATCCCAGCTACTTCAGGG + Intronic
946836948 2:223782133-223782155 CTGTAATCCCAGCTACTCCAGGG - Intronic
946925544 2:224623275-224623297 CTGTAATCCCAGCTATCGGGAGG - Intergenic
946926926 2:224635502-224635524 CTGTAATCCCAGCTATTCTGGGG + Intergenic
947120365 2:226807889-226807911 CTGTAGTCCCAGCTACTCCAGGG + Intergenic
947236581 2:227947825-227947847 CTGTAATCCCAGCTACTGGGAGG + Intergenic
947262714 2:228242006-228242028 CTGTAACCCCAGCTATCGGATGG + Intergenic
947414267 2:229877405-229877427 CTGTAATCCCAGCTACTACTTGG + Intronic
947416329 2:229900603-229900625 CTGTAATCCCAGCAATTGGGAGG + Intronic
947484663 2:230537134-230537156 CTGTAGTCCCAGCTACTCCAGGG + Intronic
947565025 2:231188273-231188295 CTGTAATCCCAGCTACTCGAGGG + Intergenic
947649608 2:231774712-231774734 CTGTAATCCCAGCTATTATTAGG - Intronic
947783941 2:232797722-232797744 CTGTAATCCCAGCATTTGGAAGG + Intronic
948414933 2:237796259-237796281 CTGTAATCCCAGCTACTGGAAGG + Intronic
948842438 2:240660321-240660343 CTGTAATCCCAGCAATTGGGAGG - Intergenic
948937353 2:241175898-241175920 CTGTAATCCCAGCTACTGAGAGG - Intronic
948948030 2:241231259-241231281 CTGTAATCCCAGCTACTCCCGGG + Intronic
1169210222 20:3762028-3762050 CTGTAATCCCAGCACTTTCACGG + Intronic
1169232556 20:3901177-3901199 CTGTAGTCCCAGCTACTCCAGGG - Intronic
1169370215 20:5023172-5023194 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1169427232 20:5505951-5505973 CTGTAATCCCAGCAATTGGGAGG - Intergenic
1169439248 20:5620342-5620364 CTGTAATCCCAGCTACTTCAGGG - Intergenic
1169448159 20:5689340-5689362 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1169459095 20:5779078-5779100 CTGTAATCCCAGCTACTGGGAGG + Intronic
1169984986 20:11434107-11434129 CTGTAATCCCAGCTATTTGGGGG + Intergenic
1170005339 20:11662586-11662608 CTGTAATCCCAGCTACTGGGGGG - Intergenic
1170107948 20:12772233-12772255 CTGTAGTCCCAGCTATTCCGCGG - Intergenic
1170186871 20:13601154-13601176 CTGTAGTCCCAGCTATTGAGCGG + Intronic
1170640455 20:18147705-18147727 CTGTAATCCCAGCTACTAGAGGG - Intronic
1170818782 20:19738641-19738663 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1170924354 20:20709363-20709385 CTGTAGCCCCAGCTACTCCAGGG + Intronic
1171073324 20:22097197-22097219 CTGTAGACCCAGCTATAGGGAGG + Intergenic
1171305084 20:24098354-24098376 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1172083684 20:32361513-32361535 CTGTAATCCCAGCTACTGAGGGG + Intronic
1172111186 20:32546068-32546090 CTGTAATCCCAGCTACTGGGAGG - Intronic
1172354122 20:34267654-34267676 CTGTAATCCCAGCTACTCCCGGG - Intronic
1172415809 20:34766503-34766525 CTGTAGTCCCAGCTACTGCAGGG + Intronic
1172418145 20:34788820-34788842 CTGTAATCCCAGCTACTGGGAGG + Intronic
1172545363 20:35756789-35756811 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1172564258 20:35916587-35916609 CTGTAATCCCAGCTATGGGGAGG - Intronic
1172665995 20:36600672-36600694 CTGTAGTCCCAGCTATTTGAAGG - Intronic
1172878168 20:38178921-38178943 CTGTAAACCTAGCTACTTAAGGG + Intergenic
1172949215 20:38711781-38711803 GTGGCAACCCAGCAATTGCATGG + Intergenic
1173213741 20:41059481-41059503 TTGTAATCCCAGCCATTCCAAGG + Intronic
1173510630 20:43625384-43625406 CTGTAATCCCAGCTACTCAAAGG + Intronic
1173593206 20:44241346-44241368 CTGTAATCCCAGCTATTCGTAGG + Intergenic
1173638833 20:44584844-44584866 CTGTAATCCCAGCTATTCGAGGG - Intronic
1173797412 20:45871737-45871759 CTGTAATCCCAGCTCTTGGGAGG + Intronic
1173807710 20:45936804-45936826 CTGTAATCCCAGCTACTGAGAGG + Intronic
1173814928 20:45981124-45981146 CTGTAATCCCAGCTACTCGAAGG - Intergenic
1174235020 20:49082639-49082661 CTGTAGTCCCAGCTATCGCGAGG - Intronic
1174463429 20:50699169-50699191 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1174570166 20:51495773-51495795 ATGTAGACCCAGCCAGTGCATGG - Intronic
1174614316 20:51824236-51824258 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1174641357 20:52047248-52047270 CTGGAATCCCAGCTATTGGGAGG - Intergenic
1175095851 20:56541030-56541052 CTGTAATCCCAGCTATTCCGGGG - Intergenic
1175109435 20:56636402-56636424 CTGTAATCCCAGCTATTCAGGGG + Intronic
1176202546 20:63868817-63868839 CTGTAATCCCAGCTACTCGAAGG + Intronic
1176262644 20:64190549-64190571 CTGTAATCCCAGCTATTTGGGGG + Intronic
1176419533 21:6503155-6503177 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1176943993 21:14956538-14956560 CTGTAATCCCAGCTACTGGAGGG + Intergenic
1177049116 21:16209552-16209574 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1177474585 21:21603092-21603114 CTGTAATCCCAGCTACTACTCGG + Intergenic
1178224029 21:30694311-30694333 CTGTAATCCCAGCACTTGGAGGG + Intergenic
1178802841 21:35812013-35812035 CTGTAATCCCAGCTACTCGAGGG + Intronic
1178855166 21:36244680-36244702 CTGTAATCCCAGCAATTGGGAGG - Intronic
1178878175 21:36428508-36428530 CTGTAATCCCAGCTATTTGGGGG - Intergenic
1179321302 21:40293697-40293719 CTGTAATCCCAGCTACTACTTGG + Intronic
1179369361 21:40790302-40790324 CTGTAATCCCAGCTACTCGAGGG - Intronic
1179526025 21:41976358-41976380 CTGTAATCCCAGCTACTCCGAGG - Intergenic
1179695026 21:43111478-43111500 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1179767717 21:43585521-43585543 CTGTAATCCCAGCTACTGGGAGG + Intronic
1179897799 21:44372371-44372393 CTGTAATCCCAGCTACTGGGAGG + Intronic
1180557345 22:16588507-16588529 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1180558089 22:16593423-16593445 CTGTAATCCCAGCTACTGAGAGG - Intergenic
1180846014 22:18982862-18982884 CTGTAATCCCAGCTACTCCGGGG - Intergenic
1180933651 22:19610211-19610233 CTGTAATCCCAGCTACTCAAGGG + Intergenic
1181122737 22:20682928-20682950 CTGTAATCCCAGCACTTGGAAGG + Intergenic
1181151128 22:20884208-20884230 CTGTAATCCCAGCTATCGGGTGG + Intronic
1181152831 22:20897402-20897424 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1181179689 22:21058155-21058177 CTGTAATCCCAGCACTTGGAAGG - Intronic
1181229513 22:21413752-21413774 CTGTAATCCCAGCTATTCGGGGG - Intergenic
1181249138 22:21521115-21521137 CTGTAATCCCAGCTATTCGGGGG + Intergenic
1181281284 22:21722491-21722513 CTGTAATCCCAGCTACTTCAGGG + Intronic
1181320979 22:22005734-22005756 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG + Intergenic
1181562193 22:23712010-23712032 CTGTAATCCCAGCTACTTTAGGG + Intergenic
1182498154 22:30725383-30725405 CTGTAATCCCAGCTACTACTCGG + Intronic
1182513331 22:30835973-30835995 CTGTAATCCCAGCATTTGGAAGG - Intronic
1182591100 22:31380652-31380674 CTGTAATCCCAGCACTTGGAGGG - Intergenic
1182674664 22:32029447-32029469 CTGTAATCCCAGCTACTTGAGGG + Intergenic
1182832053 22:33312316-33312338 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1183065661 22:35361004-35361026 CTGAAATCCCAGCTATTTCTTGG - Intergenic
1183071072 22:35396686-35396708 CTGTAATCCCAGCTACTCCGGGG + Intergenic
1183184365 22:36283412-36283434 CTGTAATCCCAGCTACTCCAGGG + Intronic
1183220630 22:36510283-36510305 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1183494744 22:38136464-38136486 CTGTAATCCCAGCTACTACTCGG + Intronic
1183541200 22:38430379-38430401 CTGTAATCCCAGCTACTGGGGGG + Intronic
1183548256 22:38466960-38466982 CTGTAATCCCAGCATTTGGAAGG + Intergenic
1183819997 22:40338433-40338455 CTGTAATCCTAGCTACTCCAGGG - Intergenic
1183960785 22:41410764-41410786 CTGTAATCCCAGCTACTCGAAGG - Intergenic
1184002304 22:41684024-41684046 CTGTAATCCCAGCTACTGGTGGG - Intronic
1184044122 22:41961773-41961795 CTGTAATCCCAGCTACTGGCAGG - Intergenic
1184210831 22:43034751-43034773 CTGTAATCCCAGCTACTTCTTGG + Intergenic
1184393699 22:44220218-44220240 CTGTAATCCCAGCTAGTTGAAGG - Intergenic
1184459583 22:44629446-44629468 CTGTAATCCCAGCACTTGGAAGG + Intergenic
1184494680 22:44831574-44831596 CTGTAATCCCAGCTACTCCGGGG + Intronic
1184677126 22:46049854-46049876 CGATAAACCCAGCCAGTGCAGGG - Exonic
1184796658 22:46737168-46737190 CTGTAATCCCAGCTACTCCGAGG + Intronic
1185098945 22:48827347-48827369 CCGGAAACCCAGGGATTGCAAGG - Intronic
1185159695 22:49215860-49215882 CTGTAATCCCAGCACTTGGAGGG - Intergenic
1185242306 22:49753220-49753242 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1185322280 22:50207244-50207266 CTGTAACCCCAGCTATTTGGGGG - Intronic
949112707 3:281680-281702 CTGTAATCCCAGCTATTTGGGGG - Intronic
949203515 3:1410081-1410103 CTGTAATCCCAGCACTTGGAAGG - Intergenic
949349892 3:3114624-3114646 CTGTAATCCCAGCTACTCAAAGG + Intronic
949450945 3:4184331-4184353 CTGTAATCCTAGCTACTCCAGGG + Intronic
949590199 3:5486363-5486385 CTGTTATCCCAGCTATTCCGGGG - Intergenic
950411123 3:12838282-12838304 CTGTAATCCCAGCTCTTGGGAGG + Intronic
950618400 3:14180972-14180994 CTGTAGTCCCAGCTACTCCAAGG - Intronic
950664388 3:14486394-14486416 CTGTAAACCCAGCTATTGCAGGG - Exonic
950795884 3:15510583-15510605 CTGTAATCCCAGCTACTGGAAGG + Intronic
951147788 3:19249982-19250004 CTGTAAACCCAGCAAGGCCAAGG + Intronic
951216465 3:20029925-20029947 CTGTAATCCCAGCTACTCAAGGG + Intergenic
951216751 3:20032354-20032376 CTATAATCCCAGCTATTGGGAGG + Intergenic
951391293 3:22107144-22107166 CTGTAATCCCAGCTACTCCGGGG - Intronic
951606539 3:24441005-24441027 CTGCAAACTCAGCTATGGCTTGG + Intronic
951741146 3:25925121-25925143 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
951892576 3:27580863-27580885 CTGTAATCCCAGCTATTTGGGGG + Intergenic
951909826 3:27738201-27738223 CTGTAATCCCAGCTACTCAAGGG - Intergenic
952134093 3:30397775-30397797 CTGTCAACCCAACTGTTGGAAGG + Intergenic
952263850 3:31766594-31766616 CTGTAATCCCAGCAATTTGAGGG - Intronic
952373675 3:32747293-32747315 CTGTAATCCCAGCTATTAGGAGG + Intronic
952381211 3:32806893-32806915 CTGTAGTCCCAGCTACTCCAGGG + Intergenic
952457577 3:33487978-33488000 CTGTAATCCCAGCACTTGGAAGG - Intergenic
952799379 3:37274569-37274591 CTGTAATCCCAGCTATTCAGGGG + Intronic
952927458 3:38331174-38331196 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
953089135 3:39706269-39706291 CTGTAATCCCAGCTACTCGAAGG - Intergenic
953445972 3:42967045-42967067 CTGTAATACCAGCTATTCCAGGG - Intronic
953615483 3:44486903-44486925 CTGTAATCCCAGCTACTCCGGGG - Intergenic
953617864 3:44508154-44508176 CTGTAATCCCAGCTATTTGGGGG + Intronic
953762480 3:45700792-45700814 CTGTAGTCCCAGCTATTGGGAGG - Intronic
953870427 3:46621635-46621657 CTGTAGTCCCAGCTACTGCGGGG + Intronic
954012944 3:47658993-47659015 CTGTAGTCCCAGCTACTCCAGGG + Intronic
954251028 3:49367642-49367664 TTGTAATCCCAGCTATTCCAGGG - Intronic
954254174 3:49392305-49392327 CTGTAATCCCAGCTACTGGGTGG + Intronic
954256283 3:49409270-49409292 CTGTAGTCCCAGCTACTCCAGGG + Intronic
954261651 3:49443408-49443430 CTATAATCCCAGCTATTCCAGGG - Intergenic
954560071 3:51549249-51549271 CTGTAATCCCAGCACTTTCAGGG - Intronic
954562933 3:51573556-51573578 CTGTAATCCCAGCTATTTGGAGG - Intronic
954670010 3:52285708-52285730 CTGTAATCCCAGCTACTGGTGGG - Intronic
954741800 3:52758054-52758076 CTGTAATCCCAGCTATTCAGGGG + Intronic
954814394 3:53269389-53269411 CTGTAATCCCAGCTACTGGGAGG - Intergenic
954955342 3:54513801-54513823 CTGTAAACCCAGCTACTTGGGGG - Intronic
955170759 3:56562759-56562781 CTGTAATCCCAGCTACTCGAGGG - Intronic
955341157 3:58126252-58126274 CTGTAATCCCAGCTACTACTTGG + Intronic
955365734 3:58308404-58308426 CTGTAGTCCCAGCTACTCCAGGG - Intronic
956457779 3:69440683-69440705 CTGTAATCCCAGCTACTTGAGGG + Intronic
956498386 3:69853970-69853992 CTGTAATCCCAGCTACTGGCAGG - Intronic
956641109 3:71416420-71416442 CTGTAATCCCAGCTATTTGGGGG + Intronic
956664973 3:71633424-71633446 CTGTAATCCCAGCTACTTGAGGG - Intergenic
956682716 3:71796203-71796225 CTGTAATCCCAGCTACTTCGGGG + Intergenic
956821483 3:72958149-72958171 CTGTAATCCCAGCTACTGGGAGG + Intronic
957924273 3:86788607-86788629 CTGTAATCCCAGCTACTGGAGGG - Intergenic
958085930 3:88806847-88806869 CTGAAATCACAGCTAATGCAAGG + Intergenic
958650474 3:96930867-96930889 CTGTAATCCCAGCTATTCAGTGG + Intronic
959207260 3:103325626-103325648 CTGTAATCCCAGCTACTTGAGGG - Intergenic
959852082 3:111099329-111099351 TTGTAAACCTAGATATTCCAAGG - Intronic
959859360 3:111199349-111199371 CTGTAAACACAGCTACAGAATGG - Intronic
960533048 3:118786921-118786943 CTGTAATCCCAGCTATCGGGAGG - Intergenic
960918365 3:122720848-122720870 CTGTAGTCCCAGCTATTGGGAGG + Intronic
960932250 3:122864888-122864910 CTGTAATCCCAGCTATTCAGGGG + Intronic
961196759 3:125008673-125008695 CTGTAATCCCAGCTATTTGGAGG + Intronic
961265123 3:125635321-125635343 CTGTGATCCCAGCTATTGGGAGG - Intergenic
961534134 3:127559123-127559145 CTGTAATCCCAGCTACTACTTGG + Intergenic
961556705 3:127701090-127701112 CTGTAGTCCCAGCTACTGCGGGG + Intronic
961561830 3:127735704-127735726 CTGGAAACCCACCTTTTGCCAGG - Intronic
961769583 3:129239260-129239282 CTGTAATCCCAGCATTTTCAGGG + Intergenic
961813547 3:129535603-129535625 CTGTAATCCCAGCTATTCAGTGG + Intergenic
961832503 3:129631147-129631169 CTGTAATCCCAGCTACTGGGAGG + Intergenic
961972523 3:130985508-130985530 CTGTAATCCCAGCTACTCTAAGG + Intronic
961997561 3:131262262-131262284 CTGTAGTCCCAGCTATTGGGAGG + Intronic
962103374 3:132365866-132365888 CTGTAATCCCAGCTACTGGGAGG + Intronic
962576301 3:136758217-136758239 CTGTAATCCCAGCTACTCGAGGG + Intergenic
962718049 3:138145041-138145063 CTGTAATCCCAGCTATTAGGCGG + Intergenic
962765886 3:138561899-138561921 CTGTAGTCCCAGCTATTGGGAGG + Intronic
963069362 3:141290273-141290295 CTGTAATGCCAGATACTGCAGGG + Intronic
963146010 3:141995625-141995647 CTGTAAACCCAGCATTTGGGAGG + Intronic
963219009 3:142785621-142785643 CTGTAATCCCAGCTACTGGGAGG - Intronic
963752786 3:149200622-149200644 CTGTAATCCCAGCTACTGGGAGG - Intronic
963917660 3:150874136-150874158 CTGTAGTCCCAGCTAATCCAGGG - Intronic
964065796 3:152577294-152577316 CTGTAATCCCAGCTACTGGAGGG + Intergenic
964280503 3:155059130-155059152 CTGTAATCCCAGCTATTCAAGGG + Intronic
964431610 3:156612459-156612481 CTGTAATCCCAGCATTTGGAAGG - Intergenic
964749760 3:160043442-160043464 GTGTAAACAAACCTATTGCATGG + Intergenic
964935617 3:162082543-162082565 CTGTAATCCCAGCTACTACCCGG - Intergenic
965008660 3:163057704-163057726 CTGTAATCCCAGCTATTCAGGGG + Intergenic
965191717 3:165538892-165538914 CTGTAATCCCAGAAATTGGAAGG - Intergenic
965488336 3:169306557-169306579 CTGTAATCCCAGCTACTCAAAGG + Intronic
965591543 3:170364576-170364598 CTGTAATCCCAGCAATTGAGAGG - Intronic
965798829 3:172469714-172469736 CTGTAATCCCAGCTGAGGCAGGG + Intergenic
966082942 3:176027804-176027826 CTGTAATCCCAGCTATTCATGGG - Intergenic
966358402 3:179107149-179107171 CTGTAATCCCAGCTACTGCGTGG + Intergenic
966363924 3:179161573-179161595 CTGTAATCCCAGCTATCGGGAGG + Intronic
966382139 3:179354917-179354939 CTGTAATCCCAGCTACTATAGGG - Intronic
966617808 3:181930868-181930890 CTGTAATCCCAGCACTTGGAAGG - Intergenic
966846236 3:184132426-184132448 CTGTAATCCCAGCTATTCAGGGG + Intergenic
967061009 3:185872691-185872713 CTGTAATCCCAGCTACTCCTCGG - Intergenic
967322357 3:188207352-188207374 CTGTAATCCCAGCTATTCAGGGG - Intronic
967583205 3:191184841-191184863 CTGTAATCCCAGCTACTCCGGGG + Intergenic
967919085 3:194601258-194601280 CTGTAATCCCAGCTACTACTGGG - Intronic
967929528 3:194680750-194680772 CTGTAATCCCAGCTACTCAAGGG + Intergenic
968029123 3:195467684-195467706 CTGTAATCCCAGCTATTCAGGGG + Intergenic
968033476 3:195524397-195524419 CTGTAATCCCAGCTACTACTGGG + Intronic
968133336 3:196205780-196205802 CTGTAATCCCAGCTATTTGGAGG - Intronic
968190973 3:196666871-196666893 CTGTAATCCCAGCTACTGCGGGG + Intronic
968685320 4:1954105-1954127 CTGTAATCCCAGCTACTGAAGGG - Intronic
968792875 4:2680440-2680462 CTGTAATCCCAGCTATTGGGGGG - Intronic
968825126 4:2890072-2890094 CTGTAATCCCAGCTACTGGGAGG + Intronic
968875806 4:3267382-3267404 CTGTAATCCCAGCTACTCCTCGG + Intronic
969055481 4:4399263-4399285 CTGTAGTCCCAGCTACTCCAGGG - Intronic
969418949 4:7079010-7079032 CTGTAATCCCAGCTACCCCAGGG - Intergenic
969735125 4:8983428-8983450 CTGTAATCCCAGCTACTTGAAGG - Intergenic
969927092 4:10594969-10594991 CTGTAATCCCAGCTACTGGCTGG + Intronic
969967425 4:11011638-11011660 CTGTAATCCCAGCTATTTGGAGG + Intergenic
970074491 4:12202063-12202085 CTGTAATCCCAGCTATTCAAGGG - Intergenic
970119056 4:12732276-12732298 CTGTAATCCCAGCATTTGGAAGG + Intergenic
970768929 4:19586246-19586268 CTGTAATCCCAGCTACTCCTGGG - Intergenic
971288989 4:25318475-25318497 CTGTAATCCCAGCTACTGAGAGG - Intronic
971299766 4:25432082-25432104 CTGTAATCCCAGCTACTGAGAGG + Intergenic
971322589 4:25617259-25617281 CTGTAATCCCAGCTATTGGGAGG + Intergenic
971456693 4:26851836-26851858 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
972252458 4:37318145-37318167 CTGTAATCCCAGCTATTTGGAGG - Intronic
972305336 4:37825190-37825212 CTGTAGTCCCAGCTATTTCGTGG - Intergenic
972500102 4:39669977-39669999 CTGTAATCCCAGCTACTAGAGGG - Intergenic
972537705 4:40013101-40013123 CTGTAATCCCAGCTATGGAGAGG - Intergenic
972875540 4:43354236-43354258 CTGTAATCCCAGCTACTATAGGG + Intergenic
972967247 4:44525644-44525666 CTGTAATCCCAGCTACTTGAGGG + Intergenic
973023404 4:45233782-45233804 CTGTAATCCCAGCTATTCCGGGG - Intergenic
973322684 4:48825957-48825979 CTGTAATCCCAGCTACTGACAGG - Intronic
973328174 4:48885109-48885131 CTGTAATCCCAGCTACTGAGAGG - Exonic
973964221 4:56144774-56144796 CTGTAATCCCAGCTACTGGGGGG - Intergenic
974037676 4:56831218-56831240 CTGTAATCCCAGCACTTTCAGGG + Intergenic
974046061 4:56899489-56899511 CTGTAATCCCAGCTACTTGAGGG + Intergenic
974051265 4:56944422-56944444 CTGTAATCCCACCTACTCCAGGG - Intergenic
974053542 4:56963193-56963215 CTGTAATCCCAGCTACTGGGGGG + Intergenic
974164559 4:58184971-58184993 CTGTCATCCCAGCTACTCCAAGG + Intergenic
974610630 4:64210771-64210793 CTGTAATCCCAGCTAGTGGGAGG - Intergenic
974654146 4:64797996-64798018 CTGTAATCCCAGCTATTGGGTGG - Intergenic
974726423 4:65804968-65804990 CTGTAATCCCAGCTACTGAGAGG - Intergenic
974759881 4:66261300-66261322 CTGTAATCCCAGCTACTCCTGGG - Intergenic
975286066 4:72621785-72621807 CTATTATCCCAGCTACTGCAAGG + Intergenic
975344452 4:73277900-73277922 CTGTAATCCCAGCTACTACTCGG - Intergenic
975385955 4:73760624-73760646 CTGTAATCCCAGCTACTACCTGG + Intergenic
975540143 4:75501130-75501152 CTGTAATCCCAGCTATTCGGGGG - Intronic
975576241 4:75865506-75865528 CTGTAGACCCAGCTATTGGGAGG - Intronic
975914646 4:79309836-79309858 CTGTAGTCCCAGCTACTGGAGGG - Intronic
976069474 4:81224735-81224757 CTGTAATCCCAGCTATTCGGAGG + Intergenic
976073584 4:81271362-81271384 CTGTAATCCCAGCTAGTTGAGGG + Intergenic
976338767 4:83921470-83921492 CTGTAAGCCCAGCTACTACTTGG - Intergenic
977183438 4:93905887-93905909 CTGTAATCCCAGATATTGGTAGG - Intergenic
977294205 4:95193163-95193185 CAGTAAATCCAGCCAATGCATGG - Intronic
977384358 4:96319835-96319857 CTGTAATCCCAGCACTTGGAAGG - Intergenic
977746282 4:100551334-100551356 CTGTAATCCCAGCTACTGGGAGG + Intronic
977878891 4:102181655-102181677 CTGTAATCCCAGCTACTCCAGGG + Intergenic
978360769 4:107929314-107929336 CTGTAATCCCAGCTACTGGGAGG + Intergenic
978415976 4:108476470-108476492 CTGTAAACCCAGCTACTCGGGGG - Intergenic
978440320 4:108727473-108727495 CTGTAATCCCAGCTCTTTGAGGG - Intergenic
978575994 4:110190625-110190647 CTGTAATCCCAGCTACTCCAGGG - Intronic
978770572 4:112452290-112452312 CTGTAATCCCAGCTACTTCAGGG + Intergenic
979679958 4:123448511-123448533 CTGTAATCCCAGCTACTCCAGGG - Intergenic
979803922 4:124946999-124947021 CTGTAGTCCCAGCTATTGGGGGG - Intergenic
979943504 4:126794066-126794088 CTGTAGTCCCAGCTACTCCAGGG - Intergenic
980079219 4:128326304-128326326 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
980092625 4:128458232-128458254 CTGTAATCCCAGCCAGGGCAGGG + Intergenic
980325457 4:131339017-131339039 CTGTAATCCCAGCTACTGGGAGG + Intergenic
980340029 4:131532647-131532669 CTGTAATCCCAGCTACTGGGGGG + Intergenic
980396794 4:132225375-132225397 CTGTAATCCCAGGGATTACAAGG + Intergenic
980570395 4:134608614-134608636 CTGTAGTCCCAGCTACTCCAGGG + Intergenic
980573252 4:134651165-134651187 CTGTAATCCCAGCTATAGGGAGG - Intergenic
980636770 4:135515864-135515886 CTGTAATCCCAGCTACTGGGAGG + Intergenic
980902013 4:138914092-138914114 CTGTAATCCCAGCACTTTCAGGG + Intergenic
980912194 4:139004002-139004024 CTGTAATCCCAGCTACTGGGAGG - Intergenic
980928560 4:139162973-139162995 CTGTAATCCCAGCTACTCCAGGG + Intronic
981418598 4:144522468-144522490 CTGTAAACCCAGTAAATGGAAGG - Intergenic
981755754 4:148140245-148140267 CTGTAAACCCAGCTACTTGGGGG + Intronic
981876611 4:149554437-149554459 CTGTAGTCCCAGCTACTCCAGGG - Intergenic
982174656 4:152694353-152694375 CTGTAATCCCAGCTACTACTTGG + Intronic
982266986 4:153546802-153546824 CTGTAAACCCAGCTACTCGTGGG + Intronic
982359549 4:154504918-154504940 CTGTAGACCCAGCTATTGGGAGG - Intergenic
982447376 4:155508655-155508677 CTGTAATCCCAGCCTTTGGAAGG - Intergenic
982814015 4:159862881-159862903 CTGTAATCCCAGCTATTTGAGGG + Intergenic
982823701 4:159976472-159976494 CTGGAAGCCCAGATATTGAAGGG + Intergenic
982942304 4:161573608-161573630 CTGTAATCCCAGCTACTCCAGGG + Intronic
983213729 4:164983075-164983097 CTGTAATCCCAGCACTTGCAGGG - Intergenic
983225820 4:165085149-165085171 CTGTAATCCCAGCTACTGGGAGG + Intronic
983235963 4:165179413-165179435 CTGTAATCCCAGCTACTGGGAGG + Intronic
983308613 4:166026264-166026286 CTGTAATCCCAGCTATTCCGGGG + Intronic
983579294 4:169291953-169291975 CTATAATCCCAGCTACTCCAGGG - Intergenic
983804584 4:171978583-171978605 CTGTGAACCCATCTGTGGCAGGG - Intronic
984058656 4:174963802-174963824 CTGTAATCCCAGCTACTCGAAGG - Intronic
984246128 4:177276928-177276950 CTGTAATCCCAGCTACTCAAGGG - Intergenic
984247889 4:177297259-177297281 CTGTAATCCCAGCTATTCCAAGG + Intergenic
984261682 4:177450565-177450587 CTGTAGTCCCAGCTATTAAATGG + Intergenic
984284265 4:177709197-177709219 CTGTAATCCCAGCTATTGGGAGG + Intergenic
984417791 4:179483201-179483223 CTGTAATCCCAGCTACTGGGGGG - Intergenic
984443178 4:179799367-179799389 CTGTAAACCCAGCACTTTGAGGG + Intergenic
984632583 4:182076324-182076346 CTGTAATCCCAGCTACTGGGAGG - Intergenic
984713777 4:182907258-182907280 CTGTAGCCCCAGCTACTCCAGGG - Intronic
984757803 4:183340062-183340084 CCGTAATCCCAGCTACTGGAAGG + Intergenic
984758773 4:183346532-183346554 CTGTAATCCCAGCTACTCCGAGG + Intergenic
984967542 4:185153305-185153327 CTGTGAATCCATCTTTTGCAGGG - Intergenic
985642081 5:1068310-1068332 CTGTAATCCCAGCTACTGGGAGG + Intronic
985694495 5:1332279-1332301 CTGTGATCCCAGCTACTGCAAGG + Intronic
986210045 5:5663484-5663506 ATGTAATCCCAGCTACTGCTTGG - Intergenic
986560189 5:9053169-9053191 CAGTAAACCAAGCTATTTCTGGG + Intronic
986683356 5:10253205-10253227 CTGTAATCCCAGCTACTGGGGGG + Intronic
986813300 5:11382474-11382496 CTGTAATCCCAGCTATCGGGAGG + Intronic
987532288 5:19137057-19137079 CTGTAAACCCAGCACTTTCGAGG + Intergenic
987627402 5:20419598-20419620 CTGTAGTCCCAGCTACTGAAGGG - Intronic
987777172 5:22383086-22383108 CTGTAATCCCAGCCTTTGCGAGG - Intronic
987832139 5:23108270-23108292 CTGTAGTCCCAGCTACTACAGGG + Intergenic
987951324 5:24680345-24680367 CTGTAATCCCAGCTACTGGGGGG + Intergenic
987961995 5:24823073-24823095 CTGTAATCCCAGCTACTAGAGGG - Intergenic
988160071 5:27508098-27508120 CTGTAATCCCAGCTACTCGAGGG - Intergenic
988780341 5:34515557-34515579 CTGTAATCCCAGCTATTCGGGGG + Intergenic
989054166 5:37350679-37350701 CTGTAATCCCAGCTATTGGGAGG + Intronic
989082408 5:37637217-37637239 CTGTAATCCCAGCTACTGGGAGG + Intronic
989208670 5:38837173-38837195 CTGTAGTCCCAGCTACTCCAGGG - Intergenic
989316661 5:40088380-40088402 CTGTAATCCCCGCTACTTCATGG - Intergenic
989572669 5:42959480-42959502 CTGTAATCCCAGCTACTGGGAGG - Intergenic
990099451 5:52163289-52163311 CTGTAATCCCAGCTACTGGTGGG + Intergenic
990466935 5:56079411-56079433 CTGTAATCCCAGCACTTGGAAGG - Intergenic
991061612 5:62382317-62382339 CTGTAGTCCCAGCTATTGGGAGG + Intronic
991068992 5:62456132-62456154 CTGTAAACCCAGCTACTAGGAGG - Intronic
991084253 5:62634194-62634216 CTGTAATCCCAGCTACTTCGGGG - Intergenic
991333312 5:65517062-65517084 CTGTAATCCCAGCTACTTGAAGG - Intergenic
991702976 5:69333102-69333124 CTGTAATCCCAGCTTTTGGGAGG + Intergenic
991732838 5:69605583-69605605 CTGTAGTCCCAGCTATTGTGGGG + Intergenic
991809272 5:70460727-70460749 CTGTAGTCCCAGCTATTGTGGGG + Intergenic
991862117 5:71022269-71022291 CTGTAGTCCCAGCTATTGTGGGG - Intronic
992027323 5:72682985-72683007 CTGTAATCCCAGCTACTCCAGGG + Intergenic
992166104 5:74053490-74053512 CTGTAATCCCAGCTACTTGAAGG + Intergenic
992326051 5:75661272-75661294 CTGTAATCCCAGCTACAGCGGGG + Intronic
992437247 5:76766505-76766527 CTGTAATCCCAGCTACTACTCGG + Intergenic
992777519 5:80101590-80101612 CTGTAATCCCAGCTACTGGGAGG + Intergenic
992868442 5:80981686-80981708 CTGTAATCCCAGCTACTGAGGGG - Intronic
992965316 5:81993548-81993570 CTGTAAACCCAGCTACTCAGAGG - Intronic
993117078 5:83732352-83732374 CTGTAATCCCAGCTACTTGAGGG + Intergenic
993137952 5:83993855-83993877 CTGTATACCCAGGTCTTCCAAGG + Intronic
993766229 5:91862268-91862290 CTGTAATCTCAGCTATTCAAGGG - Intergenic
993832166 5:92773768-92773790 CTGTAGTCCCAGCTACTGCGGGG + Intergenic
994001936 5:94791174-94791196 CTGTAATCCCAGCTACTAGAAGG + Intronic
994004880 5:94826273-94826295 TTGTAAAGCCATATATTGCATGG - Intronic
994355045 5:98785331-98785353 GTGTAAACCCAGCATTTTCAGGG + Intronic
994376189 5:99017420-99017442 CTGTAATCCCAGCTATTACAGGG - Intergenic
994939908 5:106309807-106309829 CTGTAATCCCAGCTATTCAGAGG + Intergenic
994943992 5:106361582-106361604 CTGTAATCCCAGCTATCGGGAGG - Intergenic
995109423 5:108412417-108412439 CTGTAGTCCCAGCTACTGGAGGG - Intergenic
995581347 5:113606310-113606332 ATGGAAACCTAGCCATTGCATGG + Intergenic
995660430 5:114476539-114476561 CTGTAATCCCAGCTATTTGGGGG - Intronic
995769730 5:115655007-115655029 CTGTAATCCCAGCATTTGGAAGG + Intergenic
995939539 5:117564887-117564909 CTGTAATCCCAGCTACTCGAGGG - Intergenic
996032498 5:118721569-118721591 CTGTAATCCCAGCTACTCCTTGG + Intergenic
996059438 5:119016475-119016497 CTGTAATCCCAGCTACTCCACGG + Intergenic
996066336 5:119083661-119083683 CTGTAATCCCAGCTACTCCGAGG - Intronic
996379346 5:122847614-122847636 CTGTAGTCCCAGCTACTCCAGGG - Intronic
996512655 5:124334528-124334550 CTGTAATCCCAGCTACTGGGAGG + Intergenic
996885393 5:128347899-128347921 CTGTAATCCCAGCTACTCGAGGG - Intronic
997066839 5:130570125-130570147 CTGTAAACCCAGCACTTGGGAGG - Intergenic
997122616 5:131190611-131190633 CTGTAATCCCAGCTACTTGAGGG - Intronic
997124597 5:131213065-131213087 CTGTAATCCCAGCTACTACACGG + Intergenic
997268334 5:132513018-132513040 CTGTAATCCCAGCTACTCGAGGG + Intergenic
997290332 5:132728327-132728349 CTGTAATCCCAGCTATTTACAGG - Intronic
997307816 5:132852419-132852441 CTGTAATCCCAGCTATTTTGGGG + Intergenic
997402927 5:133616522-133616544 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
997455644 5:134015576-134015598 CTGTAATCCCAGCTATTCGGGGG + Intergenic
997540125 5:134654837-134654859 CTGTAATCCCAGCTACTTCAGGG - Intronic
997966187 5:138358237-138358259 CTGTAATCCCAGCACTTGGAAGG - Intronic
997971318 5:138404845-138404867 CTGTAATCCCAGCTACTTGAAGG - Intronic
997982039 5:138474018-138474040 TTGTAGACCCATATATTGCATGG + Intergenic
998072130 5:139206130-139206152 CTATAAACCAAGCCACTGCAGGG + Intronic
998118214 5:139555166-139555188 CTGTAGTCCCAGCTACTTCAGGG - Intronic
998360807 5:141585077-141585099 CTGTAATCCCAGCTACTGCCAGG - Intronic
998368029 5:141643723-141643745 CTGTAATCCCAGCTACTCGAGGG + Intronic
998687201 5:144542010-144542032 CTGTAATCCCAGCTACTTGAAGG - Intergenic
998826119 5:146103280-146103302 CTGTAATCCCAGCTATTAGGGGG - Intronic
998842927 5:146275391-146275413 CTGTAATCCCAACTACTGGAGGG - Intronic
999318161 5:150597452-150597474 CTGTAATCCCAGCTACTCCAGGG - Intergenic
999328068 5:150655773-150655795 CTGTAGTCCCAGCTACTGCGGGG - Intronic
999531452 5:152467490-152467512 CTATAAAGCAAGCTGTTGCAGGG + Intergenic
1000032374 5:157414533-157414555 CTGTAATCCCAGCTATCCCAGGG + Intronic
1000064336 5:157682202-157682224 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1000087564 5:157901316-157901338 CTGTAATCCCAGCACTTTCAAGG - Intergenic
1000090076 5:157922570-157922592 CTGTAATCCCAGCTATTCCGGGG + Intergenic
1000507368 5:162137872-162137894 CTGTAGTCCCAGCTACTCCAGGG - Intronic
1000508127 5:162147485-162147507 CTGTAATCCCAGCTACTCGAGGG - Intronic
1000547422 5:162620430-162620452 CTGTAATTCCAGCTATTGGGAGG - Intergenic
1000592385 5:163173953-163173975 CTGTTCACTCAGCTATTGCAGGG - Intergenic
1000953812 5:167518062-167518084 CTGTAATCCCAGCTATCACGAGG + Intronic
1001083661 5:168685070-168685092 CTGTAATCCCAGCTATTGGGAGG - Intronic
1001107140 5:168864085-168864107 CTGTAGTCCCAGCTACTGCAGGG + Intronic
1001169295 5:169403537-169403559 GTGTCAACCCAGCTATTGGAAGG + Intergenic
1001344337 5:170877385-170877407 CTGTAGTCCCAGCTATTAGAGGG - Intronic
1001408260 5:171492158-171492180 CTGTAATCCCAGCTACTACTAGG - Intergenic
1001553606 5:172621624-172621646 CTGTAATCCCAGCTACTCCGGGG - Intergenic
1002139113 5:177127938-177127960 CTGTAATCCCAGCTATTCGGGGG - Intergenic
1002153813 5:177258955-177258977 CTGTAATCCAAGCTACTCCAGGG - Intronic
1002343905 5:178535093-178535115 CTGTAATCCCAGCTACTGGGGGG - Intronic
1002483837 5:179521234-179521256 CTGTAATCCCAGCTACTTGAAGG + Intergenic
1002486456 5:179541095-179541117 CTGTAATCCCAGCTACTAGAGGG - Intergenic
1002645675 5:180652455-180652477 CTGTAATCCCAGCTTCTCCAGGG - Intergenic
1002823433 6:750733-750755 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1003078300 6:3000963-3000985 CTGTAATCCCAGCTACTCAAGGG - Intronic
1003095314 6:3138273-3138295 CTGTAATCCCAGCAATTGGGAGG - Intronic
1003185580 6:3827514-3827536 CTGTAATCCCAGCTACTGAGAGG + Intergenic
1003569196 6:7245271-7245293 CTGTAATCCCAGCTCTTGGGAGG + Intronic
1003580261 6:7333788-7333810 CTGTAATCCCAGCTACTGGGGGG - Intronic
1003618310 6:7674792-7674814 CTGTAATCCCAGCTATTTGGGGG - Intergenic
1003682206 6:8267374-8267396 CTGTAATCCCAGCTACTTAAAGG - Intergenic
1004381637 6:15137737-15137759 CTGTAGTCCCAGCTATTCCAGGG + Intergenic
1004451034 6:15746732-15746754 CTGTAATCCCAGCTACTACTTGG + Intergenic
1004642896 6:17532623-17532645 CTGTAATCCCAGCTACTGGGAGG + Intronic
1004700370 6:18073779-18073801 CTGTAATCCCAGCACTTTCAGGG + Intergenic
1004715153 6:18209728-18209750 CTGTAATCCCAGCTACTCGAGGG - Intronic
1005293179 6:24398891-24398913 CTGTAATCCCAGCTACTGAGGGG - Intergenic
1005450334 6:25965793-25965815 CTGTAGACCCAGCTACTACTCGG + Intronic
1005561868 6:27048692-27048714 CTGTAATCCCAGCTTTTGAGAGG - Intergenic
1005587676 6:27292767-27292789 CTGTAATCCCAGCTACTCAAGGG - Intronic
1005607564 6:27489845-27489867 CTGTAATCCCAGCTATTCAGGGG + Intergenic
1005853367 6:29839864-29839886 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1005955150 6:30658419-30658441 CTGTAATCCCAGCTACTGGGGGG + Intronic
1006084832 6:31588272-31588294 CTGTCATTCCAGCTATCGCAAGG + Intronic
1006100950 6:31686049-31686071 CTGTAATCCCAGCTACTAGAGGG + Intergenic
1006323848 6:33338158-33338180 CTGTAATCCCAGCTACTCCCGGG + Intergenic
1006350884 6:33520317-33520339 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1006399105 6:33805742-33805764 CTGTAATCCCAGCTTTTGGGAGG + Intergenic
1006647798 6:35527016-35527038 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1006818311 6:36869105-36869127 CTGTAATCCCAGCTACTGGGAGG - Intronic
1006966266 6:37989027-37989049 CTGTAATCCCAGCTACTACTGGG - Intronic
1006999474 6:38295924-38295946 CTGTAATCCCAGCTATTGGGAGG + Intronic
1007035469 6:38668869-38668891 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1007080407 6:39097996-39098018 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1007441361 6:41863878-41863900 CTATAATCCCAGCTGTTCCAAGG - Intronic
1007533740 6:42565681-42565703 CTGTAATCCCAGCTACTCGAGGG - Intronic
1007648519 6:43401246-43401268 CTGTAATCCCAGCTACTTCCGGG + Intergenic
1007681681 6:43638018-43638040 CTGTAATCCCAGCTACTTCGAGG - Intronic
1007710355 6:43819127-43819149 CTATAATCCCAGCTACTCCAGGG + Intergenic
1007931312 6:45693918-45693940 CTGTAACCCCAGCTACTCAAAGG - Intergenic
1008074576 6:47132402-47132424 CTGTAATCCCAGCGACTGGAAGG - Intergenic
1008166310 6:48142866-48142888 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1008187304 6:48409964-48409986 CTGTAGTCCCAGCTATTTGAGGG + Intergenic
1008568972 6:52796663-52796685 CTGTAATCCCAGCTATTGGGAGG - Intronic
1008604725 6:53129394-53129416 CTGTAATCCCAGCTATTGAGAGG - Intronic
1008680644 6:53868345-53868367 CTGTAATCCCAGCTACTTCTCGG - Intronic
1008705511 6:54153727-54153749 CTGTAATCCCAGCGACTCCAGGG + Intronic
1008824484 6:55676768-55676790 CTTAAAACCAAGCTATTACATGG - Intergenic
1008837749 6:55857858-55857880 CTGTAATCCCAGCTCTTGGGAGG - Intronic
1008934682 6:56977698-56977720 CTGTAATCCCAGCATTTGGAAGG + Intronic
1008936101 6:56994334-56994356 CTGTAGTCCCAGCTACTGGAAGG + Intronic
1009004457 6:57765451-57765473 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1009347548 6:62634537-62634559 CTGTAAACCCAGCTACTCGGGGG + Intergenic
1009360038 6:62800245-62800267 CTGTAACCCCAGCTCTTGGGAGG - Intergenic
1009947540 6:70356935-70356957 CCGTAATCCCAGCTATTGGGAGG + Intergenic
1009955108 6:70444278-70444300 CTGTAATCCCAGCTACTCCAGGG + Intronic
1009965548 6:70574196-70574218 CTGTAATCCCAGCTATTGGGAGG + Intronic
1009974617 6:70659598-70659620 CTGTAATCCCAGCTACTCAAAGG + Intergenic
1010032683 6:71287780-71287802 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1010194792 6:73228405-73228427 CTGTAATCCCAGCTACTTGAGGG + Intronic
1010207046 6:73332263-73332285 CTGTAATCCCAGCTACTCAAGGG + Intergenic
1010550404 6:77215275-77215297 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1011041542 6:83034923-83034945 CTGTAATCCCAGCACTTGGAAGG + Intronic
1011313989 6:86011043-86011065 CTGTAATCCCAGCTATAGCGGGG + Intergenic
1011386027 6:86799112-86799134 CTGTAGTCCCAGCTACTTCAGGG - Intergenic
1011482695 6:87811029-87811051 CTGTAATCTCAGCTATTGGGAGG - Intergenic
1011618965 6:89224212-89224234 CTGTAATCCCAGCTACTACTTGG - Intronic
1011622385 6:89255313-89255335 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1011685248 6:89818685-89818707 CTGTAATCCCAGCTACTGAGAGG + Intronic
1012023043 6:93950483-93950505 CTGTAATACCAGCTATTCTAGGG - Intergenic
1012271440 6:97217374-97217396 CTGTAATCCCAGCTACTCAAGGG - Intronic
1012464691 6:99504260-99504282 CTGTAATCCCAGCTACTGGGTGG - Intronic
1012800936 6:103826879-103826901 CTGTAGTCCCAGCTACTCCAAGG + Intergenic
1013057439 6:106597464-106597486 CTGTAATCCCAGCTATGGAGAGG - Intronic
1013070175 6:106721993-106722015 CTGTAATCCCAGCATTTGGAAGG - Intergenic
1013144849 6:107378661-107378683 CTGTAATCCCAGCTACTGAAGGG + Intronic
1013256019 6:108386336-108386358 CTGTAATCCCAGCTATTTGGGGG + Intronic
1013531290 6:111021044-111021066 CTGTAATCCCAGCTATTCAGGGG + Intronic
1013780103 6:113719540-113719562 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1013782853 6:113747986-113748008 CTGTAATCCCAGCTACTTGATGG + Intergenic
1013786477 6:113787180-113787202 CTGTAATCCCAGCTATTTAGGGG + Intergenic
1013791312 6:113840217-113840239 CTGTAATCCCAGCTACTCGAGGG - Intergenic
1013810955 6:114043877-114043899 CTGTAATCCCAGATTTTGAAGGG + Intergenic
1014468414 6:121784435-121784457 CTGTAATCCCAGCTACTGGGTGG + Intergenic
1014907704 6:127049788-127049810 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1015224785 6:130844918-130844940 CTGTAATCCCAGCTACTGGGGGG + Intronic
1015505691 6:133985021-133985043 CTGTAAGCCCAGCACTTGGAAGG + Intronic
1015521870 6:134139677-134139699 CTGTAATCCCAGCTACATCAGGG + Intergenic
1015582587 6:134741923-134741945 CTGTAATCCCAGCTATCGTGAGG + Intergenic
1015607184 6:134970253-134970275 CTGTAATCCCAGCTGCTGTAAGG - Intronic
1015780406 6:136859900-136859922 CTGTAATCCCAGCTACTGGGAGG + Intronic
1015908973 6:138147586-138147608 CTGTAATCCCAGCTATTCACGGG + Intergenic
1015963617 6:138675655-138675677 CTGTAATCCCAGCTATTTGGGGG - Intronic
1016083307 6:139881779-139881801 CTGTAAATCCATCAAATGCAAGG + Intergenic
1016405558 6:143725702-143725724 CTGTAATCCCAGCTACTGGGAGG + Intronic
1016715613 6:147224301-147224323 CTGTAATCCCAGCTACTGGGAGG + Intronic
1016911689 6:149205527-149205549 CTGGAAACCCTCCTAATGCATGG - Intergenic
1017162181 6:151375679-151375701 CTGTAATCCCAGCTACCCCAGGG - Intronic
1017181429 6:151556331-151556353 CTGTAATCCCAGCTATTGGGAGG + Intronic
1017238347 6:152140573-152140595 CTGTAATCCCAGCTACTCGAGGG + Intronic
1017312146 6:152986690-152986712 CTGTAATCCCAGCACTTGGAAGG + Intergenic
1018028665 6:159824872-159824894 CTGTAATCCCAGCTACTTGAGGG + Intergenic
1018222411 6:161594038-161594060 CTGTAATCCCAGCTACTTGAGGG + Intronic
1018413997 6:163585611-163585633 CTGTAATCCCAGCTATTTGGGGG - Intergenic
1018418897 6:163624958-163624980 CTGTAATCCCAGCTACTTAAGGG - Intergenic
1018419854 6:163631667-163631689 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
1018476693 6:164149606-164149628 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1018623740 6:165757087-165757109 CTGTAATCCCAGCTACTGGGAGG - Intronic
1018884602 6:167923743-167923765 CTGTAATCCCAGCTACTGGGAGG - Intronic
1019378596 7:709897-709919 CTGTAATCCCAGCATTTGGAAGG - Intronic
1019688732 7:2397693-2397715 CTGTAATCCCAGCTATGGGGAGG - Intergenic
1019699125 7:2464700-2464722 CTGTAGTCCCAGCTACTCCATGG - Intergenic
1019838351 7:3413566-3413588 CTGTAATCCCAGCTACTGGGAGG + Intronic
1019840471 7:3437642-3437664 CTGTAGTCCCACCTATTTCAGGG + Intronic
1020060135 7:5145231-5145253 CTGTAATCCCAGCAATTGGGAGG - Intergenic
1020102898 7:5404993-5405015 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1020204077 7:6102235-6102257 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1020735106 7:11938634-11938656 CTGTAATCCCAGCTACTCGAGGG - Intergenic
1020937479 7:14485767-14485789 CTGTAATCCCAGCTACTGGGAGG + Intronic
1021109126 7:16674019-16674041 CTGTAATCCCAGCTACTGGGAGG - Intronic
1021380256 7:19957350-19957372 CTGTAATCCCAGCTACTCGAGGG - Intergenic
1021442544 7:20693242-20693264 CTGTAGTCCCAGCTACTGGAAGG + Intronic
1021696676 7:23282888-23282910 CTGTAATCCCAGCTATTCGGAGG + Intergenic
1021955096 7:25816297-25816319 CTGTAAGCCCAGCTACTTGAAGG + Intergenic
1022000929 7:26225397-26225419 CTGTAATCCCAGCTATTGAGAGG + Intergenic
1022129005 7:27386640-27386662 CTGTAATCCCAGCTACTCGAGGG - Intergenic
1022308771 7:29175295-29175317 CTGTAATCCCAGCTACTGAGGGG - Intronic
1022619748 7:31971017-31971039 CTGTAATCCCAGCTACTCCAGGG + Intronic
1022699943 7:32750316-32750338 CTGTAATCCCAGCTATTTGGAGG + Intergenic
1022800005 7:33767707-33767729 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1022894237 7:34733295-34733317 CTGTAATCCCAGCTACTGGGAGG + Intronic
1022908554 7:34878469-34878491 CTGTAATCCCAGCTACTGTAGGG - Intergenic
1022935892 7:35176031-35176053 CTGTAATCCCAGCTATTCGGAGG + Intergenic
1023303674 7:38800711-38800733 CTGTAATCCCAGCTACTCCAGGG + Intronic
1023423327 7:40007546-40007568 CTGTAATCCCAGCTATTCAGGGG - Intronic
1023426346 7:40041066-40041088 CTGTAATCCCAGCTCTTTGAGGG + Intronic
1023427165 7:40050099-40050121 CTGTAATCCCAGCTATCGGTAGG - Intronic
1023437873 7:40156891-40156913 CTGTAAACCCAGCTACTCAGAGG + Intronic
1023574140 7:41606864-41606886 CTGTAATCCCAGCTACTGAGGGG + Intergenic
1023751325 7:43375768-43375790 CTGTAATCCCAGCTACTGGAGGG + Intronic
1023752876 7:43388743-43388765 CTGTAATCCCAGCTACTCGAGGG - Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1023809233 7:43898877-43898899 CTGTAATCCCAGCTCTTGGGAGG + Intronic
1023839652 7:44089234-44089256 CTGTAATCCCAGCTACTGGTTGG - Intergenic
1024062605 7:45710148-45710170 CTGTAATCACAGATATTGAAAGG + Intronic
1024327370 7:48119932-48119954 CTGTAATCCCAGCTATTCAGGGG - Intergenic
1024497159 7:50061576-50061598 CTGTAATCCCAGCTAATAAAGGG + Intronic
1024578836 7:50785455-50785477 CTGTACACCCAGCACCTGCAGGG + Intronic
1024726642 7:52204418-52204440 CTGTAATCCCAGCTACTCAAGGG - Intergenic
1024968115 7:55043482-55043504 CTGTAATCCCAGCTACTACTTGG - Intronic
1025059098 7:55788871-55788893 ATGTAATCCCAGCTCTTGGAAGG - Intergenic
1025262679 7:57430327-57430349 CTGTAATCCCAGCTACTGCGGGG - Intergenic
1025620872 7:63169586-63169608 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1025851230 7:65245881-65245903 CTGTAATCCCAGCTACTAGAGGG + Intergenic
1025915926 7:65865995-65866017 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1026001282 7:66560579-66560601 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1026025725 7:66741878-66741900 CTGTAATCCCAGCATTTGGAAGG + Intronic
1026026859 7:66752370-66752392 CTGTAATCCCAGCTACTGGGAGG + Intronic
1026049441 7:66932635-66932657 CTGTAATCCCAGCTATTGGGAGG - Intronic
1026133985 7:67643330-67643352 CTGTATGCCCAGCTCTTGCAAGG + Intergenic
1026174355 7:67982914-67982936 CTGTAATCCCAGCTAACTCAGGG - Intergenic
1026204328 7:68242644-68242666 CTGTAGTCCCAGCTACTGGAAGG - Intergenic
1026218981 7:68375083-68375105 CTGTAATCCCAGCTACTCCTAGG + Intergenic
1026667420 7:72355029-72355051 CTGTAGTCCCAGCTATTCCGGGG - Intronic
1026716624 7:72794938-72794960 CTGTAATCCCAGCTACTGGGAGG - Intronic
1026763951 7:73147927-73147949 CTGTAATCCCAGCTACTTGAGGG - Intergenic
1026804093 7:73418741-73418763 CTGTAATCCCAGCTATTCAGAGG - Intergenic
1026826969 7:73590044-73590066 CTGTAGTCCCAGCTACTGGAAGG + Intergenic
1026990890 7:74584922-74584944 CTGTAATCCCAGCTACTCCGGGG - Intronic
1027026240 7:74853753-74853775 CTGTAAGCTAAGCAATTGCAGGG - Intergenic
1027040420 7:74957696-74957718 CTGTAATCCCAGCTACTTGAGGG - Intergenic
1027061515 7:75090361-75090383 CTGTAAGCTAAGCAATTGCAGGG + Intergenic
1027083217 7:75244661-75244683 CTGTAATCCCAGCTACTTGAGGG + Intergenic
1027224986 7:76238045-76238067 CTGAAAAACCAGCTCTTGAATGG + Intronic
1027373549 7:77532096-77532118 CTGTAAGCCCAGCTACTGGGAGG + Intergenic
1027820016 7:83030820-83030842 CTATAAACCCAGCCATTGTAAGG - Intronic
1028937045 7:96477033-96477055 CTGTAATCCCAGCACTTGGAAGG + Intergenic
1028941094 7:96522766-96522788 TTGTAATCCCAGCTACTCCAGGG + Intronic
1029093868 7:98069778-98069800 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1029487032 7:100849591-100849613 CTGTCATCCCAGCTACTCCAAGG + Intronic
1029574567 7:101394993-101395015 CTGTAATCACAGCTATTCAAGGG - Intronic
1029662277 7:101970676-101970698 CTGTAATCCCAGCTACTCGAGGG - Intronic
1029899525 7:104023923-104023945 CTGTAGACCCAGCTACTGGGGGG + Intergenic
1029913640 7:104183010-104183032 CTGTAATCCCAGCTACTCGAGGG + Intronic
1030006353 7:105124382-105124404 CTGTAATCCCAGCAATTGGGAGG + Intronic
1030035344 7:105403984-105404006 CTGTAATCCCAGCTATTTTTGGG - Intergenic
1030119598 7:106095469-106095491 CTGTAATCCCAGCTACTGGGAGG - Intronic
1030172985 7:106623552-106623574 CTGTAATCCCAGCACTTTCAGGG + Intergenic
1030238010 7:107288239-107288261 CTGTAATCCCAGCTACTCAAAGG + Intronic
1030269568 7:107655878-107655900 CTGTAATGCCAGCTACTTCAGGG + Intergenic
1030574498 7:111268854-111268876 CTGTAATCCCAGGTATTGGAAGG - Intronic
1030876592 7:114820564-114820586 CTGTAATCCCAGCTACTGCGGGG + Intergenic
1031516885 7:122711773-122711795 CTGTAATCCCAGCTATTCAGGGG - Intronic
1031655583 7:124350589-124350611 CAGTAGAGCCACCTATTGCAGGG - Intergenic
1031695716 7:124850607-124850629 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1032067209 7:128780525-128780547 CTGTAATCCAAGCTACTGAAAGG + Intergenic
1032181369 7:129681827-129681849 CTGTAATCCCAGCACTTGGAAGG + Intronic
1032218839 7:129978650-129978672 CTGTAATCCCAGCTACTTGAGGG - Intergenic
1032356388 7:131215169-131215191 CTGTAATCCCAGCTATTTGGTGG - Intronic
1032963786 7:137071855-137071877 CTGTAATCCCAGCTATGGGGAGG + Intergenic
1033117459 7:138638148-138638170 CTGTAATCCCAGCTACTTGAGGG + Intronic
1033126034 7:138708172-138708194 CTGTAATCCCAGCTACTCAAGGG - Intronic
1033178356 7:139148796-139148818 CTGTAATCCCAGCTACTGGGGGG + Intronic
1033217205 7:139501735-139501757 CTGTAATCCCAGCCTTTGGAAGG + Intergenic
1033286321 7:140043651-140043673 CTGTAATCCCAGCTACTCCTCGG - Intronic
1033335304 7:140447237-140447259 CTGTAATCCCAGCTCTTGGGAGG - Intergenic
1033343491 7:140509817-140509839 CTGTAATCCCAGCTACTTCGAGG - Intergenic
1033397251 7:140986877-140986899 CTGTAATCCCAGCTACTCAAAGG - Intergenic
1033672895 7:143510759-143510781 CTGTGATCCCAGCTATTCAAGGG + Intergenic
1034132462 7:148732594-148732616 CTGTAATCCCAGCCTTTGGAAGG - Intronic
1034619228 7:152444577-152444599 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1034619990 7:152449501-152449523 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1035154492 7:156901115-156901137 CTGTAATCCCAGCGCTTTCAGGG - Intergenic
1035380633 7:158438253-158438275 CTGTAATCCCAGCTACTGGGAGG + Intronic
1036046919 8:5153301-5153323 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1036163405 8:6409005-6409027 CTGTAATCCCAGCTACTGGGAGG - Intronic
1036764199 8:11536661-11536683 CTGTAATCCCAGCACTTGCGAGG - Intronic
1036774135 8:11598424-11598446 CTGTAATCCCAGCTACTCGAAGG + Intergenic
1036947477 8:13107921-13107943 CTGTAATCCCAGCTATTCAGGGG + Intronic
1037174393 8:15929982-15930004 CTGTAATCCCAGCTACTCGAAGG - Intergenic
1037580404 8:20242361-20242383 CTGTAATCCCAGCACTTGAAAGG + Intergenic
1037604545 8:20426081-20426103 CTGAAAACCAAGCCATAGCAGGG - Intergenic
1037856596 8:22375610-22375632 CTGTAATCCCAGCTATTATTAGG - Intronic
1038169799 8:25119932-25119954 CTGTAATCCCAGCACTTGGAGGG - Intergenic
1038550148 8:28460545-28460567 CTGTAATCCCAGCTATTTGGCGG - Intronic
1038573130 8:28680266-28680288 CTGTAATCCCAGCTACTCCGAGG + Intronic
1038736070 8:30170761-30170783 CTGTAATCCCAGCTATTGGGAGG - Intronic
1038793546 8:30690417-30690439 CTGTAATCCCAGCACTTGCAAGG - Intronic
1038822396 8:30964768-30964790 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1038948642 8:32389880-32389902 CTGTAACCCCAGTTATTGGAAGG - Intronic
1039499394 8:38004716-38004738 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1039500867 8:38015827-38015849 CTGTAATCCCAGCTACTTGACGG - Intergenic
1039531424 8:38266655-38266677 CTGTAATCCCAGCAATTGGGAGG - Intronic
1039715011 8:40098792-40098814 CTGTAATCCCAGCTACTTGAGGG + Intergenic
1039811493 8:41053330-41053352 CTGTAACCCCAGCTACTCCGGGG + Intergenic
1039902427 8:41762628-41762650 CTGGAAACCCAGCTCATGCCTGG - Intronic
1040004136 8:42604260-42604282 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1040570123 8:48600915-48600937 CTGTAACCCCAGCTACTGGGAGG - Intergenic
1040591901 8:48800700-48800722 CTGTAATCCCAGCTATTCAGGGG + Intergenic
1041072812 8:54141972-54141994 CAGTAATCCCAGCTATTTCGAGG - Intronic
1041126614 8:54647290-54647312 CTGTAATCTCAGCTATTGAGAGG + Intergenic
1041614665 8:59892541-59892563 CTGTAATCCCAGCTATTTGGAGG - Intergenic
1041689310 8:60673607-60673629 CTGTAGTCCCAGCTACTGGAAGG - Intergenic
1041826936 8:62106192-62106214 CTGTGAATCCATCTATTCCAGGG - Intergenic
1041851685 8:62400292-62400314 CTGTAATCCCAGCTACTGGGGGG - Intronic
1042132249 8:65599010-65599032 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1042195161 8:66225861-66225883 CTGTAACCCCAGCTATCGGGAGG - Intergenic
1042221059 8:66474485-66474507 CTGTAATCCCAGCACTTTCAGGG - Intronic
1042264022 8:66890186-66890208 CTGTAACCCCAGCTACTGGGAGG - Intronic
1042451189 8:68949098-68949120 CTGTAATCCCAGCTATTCAGAGG - Intergenic
1042603963 8:70527806-70527828 CTGTAATCCCAGCTACTGGTAGG - Intergenic
1043271395 8:78338635-78338657 CTGTAATCCCAGCTCTTGGGAGG + Intergenic
1043440042 8:80269030-80269052 CTGTAATCCCAGCAATTTGAAGG + Intergenic
1043449782 8:80354806-80354828 CTGTAATCCCAGCTATTAGTAGG - Intergenic
1043617349 8:82143351-82143373 CTGTAATCCCAGCTACTAGAAGG - Intergenic
1043883981 8:85576740-85576762 CTGTAATCCCAGCTATTCTGGGG + Intergenic
1044116028 8:88335195-88335217 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1044149861 8:88762391-88762413 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1044182822 8:89217075-89217097 CTGTCATCCCAGCTAATCCAGGG + Intergenic
1044665993 8:94634985-94635007 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1044676234 8:94731536-94731558 CTGTAATCCCAGCTACTGGGAGG - Intronic
1044980096 8:97708088-97708110 CTGTAATCCCAGCTACTGGGAGG - Intronic
1045031834 8:98144396-98144418 CTGTAATCCCAGCTATTTGGGGG - Intronic
1045230698 8:100303813-100303835 CTGTAATCCCAGCTACTGGCAGG + Intronic
1045679002 8:104639032-104639054 CTGTAATCCCAGCTACTCCAAGG + Intronic
1045881104 8:107041719-107041741 CTGTAAACCCAGCACTTGGGAGG - Intergenic
1046006831 8:108496410-108496432 CTGTAACCCCAGCTACTACTTGG - Intergenic
1046347773 8:112957574-112957596 CTGTAATCCCAGCTACTCGAGGG - Intronic
1046453028 8:114418661-114418683 CTGTAAACCGTGCAATTACATGG + Intergenic
1046638531 8:116699930-116699952 CTGTAATCCCAGCTCTCGGAAGG - Intronic
1047153205 8:122287688-122287710 CTGGAGACCCAGCAATTACAAGG - Intergenic
1047245207 8:123136705-123136727 CTGTAATCCCAGCTTTTGGGAGG - Intronic
1047340535 8:123976385-123976407 CTGTAATCCCAGCTACTGGGTGG + Intronic
1047412295 8:124633645-124633667 CTGTAATCCCAGCTACTCGAGGG + Intronic
1047494591 8:125400512-125400534 CTGTAATCCCAGCACTTGGAAGG + Intergenic
1047498922 8:125427810-125427832 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1047556708 8:125939802-125939824 TTGGAAACCCAGTTATTGGATGG + Intergenic
1048390171 8:133955495-133955517 CTGTAATCCCAGCTATTCAGGGG + Intergenic
1048766396 8:137848810-137848832 CTGTAATCCCAGCTACTTGAGGG + Intergenic
1048838818 8:138546846-138546868 CTGTAATCCCAGCTACTCCTTGG - Intergenic
1048998389 8:139808336-139808358 CTGTAATCCCAGCTACTCAAGGG + Intronic
1049696899 8:143988586-143988608 CTGTAATCCCAGCTATTGGGGGG - Intronic
1049928279 9:430993-431015 CTGTAATCCCAGTTACTACATGG - Intronic
1049939061 9:527422-527444 CTGTAATCCCAGCTACTTGAGGG - Intronic
1049967183 9:790399-790421 CTGTAGACTCAGCTATTCAAGGG - Intergenic
1049981493 9:908193-908215 CTGTAATCCTAGCTCTTGGAGGG + Intronic
1050104519 9:2151609-2151631 CTGTAATCCCAGCTATTGGGAGG + Intronic
1050118623 9:2286198-2286220 CTGTAATCCCAGCTACTCCCAGG - Intergenic
1050210617 9:3251590-3251612 CTGTAATCCCAGCTATTTGGGGG - Intronic
1050383458 9:5057702-5057724 CTGTAATCCCAGCTATCGGGAGG - Intronic
1050421584 9:5471310-5471332 CTGTAATCCCAGCTACTCGAGGG - Intergenic
1050513746 9:6420580-6420602 CTGTAGTCCCAGCTACTTCAGGG + Intronic
1050536279 9:6633662-6633684 CTGTAATCCCAGCACTTGGAAGG + Intronic
1050639718 9:7654465-7654487 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1050832950 9:10037006-10037028 CTGTAGTCCCAGCTACTTCAAGG - Intronic
1050923788 9:11238194-11238216 CTGTGAATCCATCTAGTGCAGGG + Intergenic
1051020660 9:12538704-12538726 CTGTAATCCCAGCTATTCGGGGG + Intergenic
1051275677 9:15395613-15395635 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1051400642 9:16678388-16678410 CTGTAATCCCAGCTATTTGGAGG - Intronic
1051419398 9:16874752-16874774 CTGCAATCCCAGCTACTGGAAGG + Intergenic
1051430071 9:16972689-16972711 CTGTAAACCCAGCACTTTGAAGG - Intergenic
1051477448 9:17523357-17523379 CTGTAATCCCAGCTACTCAAGGG - Intergenic
1051617441 9:19019604-19019626 CTGTAATCCCAGCTACTCGAGGG + Intronic
1051625205 9:19092490-19092512 CTGTAATCCCAGCTACTCCGGGG + Intronic
1051727178 9:20100132-20100154 CTGCCATCCCAGCTATGGCAGGG - Intergenic
1051837400 9:21356657-21356679 CTGTAATCCCAGCACTTGGAAGG - Intergenic
1051942179 9:22521066-22521088 CTATAATCCCAGATATTGGAAGG - Intergenic
1052225545 9:26080912-26080934 CTGTAACTCCAGCTACTCCAGGG + Intergenic
1052756492 9:32547955-32547977 CTGTAATCCCAGCTACTACTGGG - Intronic
1052925139 9:34009219-34009241 CTGTAATCCCAGCTACTTGAAGG - Intronic
1052934475 9:34081483-34081505 CTGTAATCCCAGCTATTCAGAGG + Intergenic
1052934956 9:34085377-34085399 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1052936252 9:34095508-34095530 CTGTAGTCCCAGCTACTGGAGGG - Intronic
1052972186 9:34383399-34383421 CTGTAAACCCAGCTACTCAGGGG + Intronic
1053079053 9:35159543-35159565 CTGTAATCCCAGCTATTCGAAGG - Intergenic
1053170607 9:35878347-35878369 CTGTAATCCCAGCTACTCAAAGG - Intergenic
1053180144 9:35961732-35961754 CTGTAATCCCAGCTACTTCGGGG + Intergenic
1053247034 9:36542990-36543012 CTGTAAACCCAGCTACTCGGAGG + Intergenic
1053331085 9:37208205-37208227 CTGTAATCTCAGCTATTCGAGGG - Intronic
1053375452 9:37602113-37602135 CTGTAATCCCAGCTACTGGGAGG + Intronic
1053401994 9:37833008-37833030 CTGTAGTCCCAGCTATTGAGAGG - Intronic
1054257668 9:62831718-62831740 CTGTAATCCCAGCTACTCCGGGG - Intergenic
1054729494 9:68686371-68686393 CTGTAATCCCAGCTACTACTTGG + Intergenic
1054787043 9:69220026-69220048 CTGTAATCCCAGCTATCGGGAGG + Intronic
1054850229 9:69839952-69839974 CTGTAATCCCAGCTATTCAGAGG + Intronic
1055005417 9:71499998-71500020 CTGTAATCCCAGCTACTCGAGGG - Intergenic
1055013472 9:71591857-71591879 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1055244839 9:74227146-74227168 CTGAAAACCCTGCTAATACATGG + Intergenic
1055294894 9:74824271-74824293 CTGTAATCCCAGCTATTCAGGGG - Intronic
1055530044 9:77175121-77175143 CTGTAGTCCCAGCTACTCCAAGG - Intergenic
1055533360 9:77210364-77210386 CTGTAGTCCCAGCTACTGCAGGG - Intronic
1055608756 9:77998966-77998988 CTGTAATCCCAGCTACTTCGGGG + Intronic
1055703796 9:78975540-78975562 CTGTAATCCCAGCTACTCCTTGG - Intergenic
1055992646 9:82123984-82124006 CTGTAAACCCAGCTACTCGGGGG + Intergenic
1056013371 9:82355919-82355941 CTGTAGACCCAGCTATTCAGGGG - Intergenic
1056025570 9:82491229-82491251 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1056101337 9:83303039-83303061 CTCTGAACCCTGCTATTCCAGGG + Intronic
1056134093 9:83614226-83614248 CTGTAGTCCCAGCTACTGGATGG - Intergenic
1056221449 9:84454047-84454069 CTGTAATCCCAGCTATTTGTGGG - Intergenic
1056556992 9:87697829-87697851 CTGTAGTCCCAGCTACTTCAGGG + Intronic
1056984315 9:91347158-91347180 CTGTAATCCCAGCTACTTGAGGG - Intronic
1057103118 9:92383016-92383038 CTGTAATCCCAGCTACTGGGAGG - Intronic
1057111723 9:92478573-92478595 CTGTAATCCCAGCTACTTGAAGG - Intronic
1057219645 9:93249594-93249616 CTGTAATCCCAGCTACTCAAGGG - Intronic
1057238418 9:93386334-93386356 CTGTAATCCCAGCTACTACTCGG + Intergenic
1057242333 9:93422567-93422589 CTGTAATCCCAGCACTTTCAGGG + Intergenic
1057524857 9:95789713-95789735 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1057587039 9:96337857-96337879 CTGTAATCCCAGCTACTACAGGG + Intronic
1057588417 9:96349780-96349802 CTGTAATCCCAGCGATTGGGAGG - Intronic
1057762390 9:97887412-97887434 CTGTAATCCCAGCTATTTTGGGG - Intergenic
1057990996 9:99769487-99769509 CTGTAATCCCAGCATTTTCAAGG + Intergenic
1058030066 9:100186270-100186292 CTGTAATCCCAGCTACTGAGGGG - Intronic
1058405071 9:104663562-104663584 CTGTAATCCCAGCTCCTGCTGGG + Intergenic
1058677309 9:107411335-107411357 CTGTAATCCCAGCTACTACTCGG - Intergenic
1058891185 9:109362115-109362137 CTGTAGTCCCAGCTACTTCAAGG + Intergenic
1058953907 9:109928223-109928245 CTGTAATCCCAGCTATTCGGGGG - Intronic
1059037035 9:110765694-110765716 CTGTAATCCCAGCTACTCGAGGG - Intronic
1059144473 9:111886026-111886048 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1059157772 9:112005154-112005176 CTGTAATCCCAGCACTTTCAGGG + Intergenic
1059499550 9:114739299-114739321 CTGGAAACCCACCTAGTCCAAGG - Intergenic
1059860220 9:118452149-118452171 CTGTAGTCCCAGCTACTCCAGGG + Intergenic
1060391853 9:123284236-123284258 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1060546256 9:124462187-124462209 CTGTAATCCCAGCTACTTGAGGG - Intronic
1060582279 9:124760187-124760209 CTGTAATCCCAGCTGCTCCAGGG + Intronic
1060627351 9:125125706-125125728 CTGTAATCCCAGCTACTCAAGGG + Intronic
1060660574 9:125402852-125402874 TTGTAATCCCAGCTACTGCCAGG - Intergenic
1060699157 9:125735753-125735775 CTGTAATCCCAGCTACTGTGGGG - Intergenic
1060860986 9:126954677-126954699 CTGTAATCCCAGCTATTCGAGGG + Intronic
1060935886 9:127515712-127515734 CTGTAATCCCAGCTACTTGAGGG + Intronic
1061173388 9:128975943-128975965 CTGTAATCCCAGCTACTCAAGGG - Intronic
1061302716 9:129714882-129714904 CTGGAAAGCCAGTCATTGCAGGG - Intronic
1061340198 9:129974077-129974099 CTGTAATCCCAGCAATTGGGAGG - Intronic
1061439397 9:130589970-130589992 CTGTAATCCCAGCACTTGGAAGG - Intronic
1061471268 9:130827770-130827792 CTGTAATCCCAGCTATTGGGAGG + Intronic
1061533284 9:131231312-131231334 CTGTAGACCCAGCTACTCAAAGG - Intronic
1061560618 9:131400438-131400460 CTGTAATCCCAGCTACTCGAAGG - Intronic
1061696911 9:132382941-132382963 CTGTAATCCCAGCTATTCAGAGG + Intronic
1061794220 9:133075197-133075219 CTGTAATCCCAGCTATTCAGAGG + Intronic
1061853902 9:133431085-133431107 CTGTAGTCCCAGCTACTCCAAGG - Intronic
1062223746 9:135436796-135436818 CTGTAATCCCAGCTACTACTAGG + Intergenic
1062283202 9:135761123-135761145 CTGTAATCCCAGCTATTTCTGGG - Intronic
1185557162 X:1030539-1030561 CTGTAATCCCAGCTACTCCAGGG + Intergenic
1185586462 X:1245007-1245029 CTTTAAACCCATCTATGGCCGGG + Intergenic
1185964032 X:4578997-4579019 CTGTAATCCCAGCTACTGGCAGG + Intergenic
1186079624 X:5916570-5916592 CTGTAATCCCAGCTATTTGGTGG - Intronic
1186174548 X:6911314-6911336 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1186486805 X:9939907-9939929 CTGTAATCCCAGCTACTCGAGGG - Intronic
1187053762 X:15720297-15720319 CTGTACTCCCAGCTATTGTGGGG - Intronic
1187148647 X:16661079-16661101 CTGTAATCCCAGCTACTGGGAGG - Intronic
1187154917 X:16713204-16713226 CTGTAATCCCAGCTACTCCGGGG - Intergenic
1187159254 X:16749176-16749198 CTGTAATCCCAGCTATTCATAGG - Intronic
1187340218 X:18414579-18414601 CTGTAATCCCAGCTACTTGAGGG - Intergenic
1187346672 X:18471641-18471663 CTGTAATCCCAGCTAAGGTAGGG - Intronic
1187395164 X:18912954-18912976 CTGTAGTCCCAGCTACTGGAGGG + Intronic
1187553391 X:20328114-20328136 TTGTACCCCCAGCTATTGCCTGG + Intergenic
1187683789 X:21795920-21795942 CTGTAATCCCAGCACTTGGAAGG - Intergenic
1187711249 X:22056676-22056698 CTGTAATCCCAGCTACTGGGAGG + Intronic
1187894921 X:23971880-23971902 CTGTAATCCCAGCTACTCGAAGG - Intergenic
1187922514 X:24219033-24219055 CTGTAATCCCAGCACTTGGAGGG + Intergenic
1188539282 X:31231755-31231777 CTGTAATCCCAGCTACTACCTGG + Intronic
1189117727 X:38360041-38360063 CTGTAATCCCAGCTACTCCTTGG - Intronic
1189294525 X:39909287-39909309 CTGTAATCCCAGTTATTGGGAGG - Intergenic
1189342983 X:40218651-40218673 CTGTAATCCCAGCTACTCCGGGG + Intergenic
1189454768 X:41176011-41176033 CTGTAATCCCAGCTACTGGGAGG - Intronic
1189504500 X:41598014-41598036 CTGTAATCCCAGCTACTTGAAGG + Intronic
1189615002 X:42774187-42774209 CTGTAATCCCAGCCACTCCAGGG + Intergenic
1189772557 X:44441005-44441027 CTGTAATCCCAGCTACTCTAGGG + Intergenic
1189772875 X:44443687-44443709 CTGTAATCCCAGCTACTCTAGGG + Intergenic
1189794068 X:44630725-44630747 CTATAATCCCAGCTACTGGAGGG + Intergenic
1189819014 X:44852220-44852242 CTGTAATCCCAGCTATTTGGGGG - Intergenic
1189820694 X:44867868-44867890 CTGTAATCCCAGCTACTACTTGG - Intergenic
1189983790 X:46535401-46535423 CTGTAACCCCAGCACTTGGAAGG - Intronic
1190008706 X:46763375-46763397 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1190011811 X:46791615-46791637 CTGTAATCCCAGCTACTGGGTGG + Intergenic
1190035916 X:47023782-47023804 CTGTAATCCCAGCTACTGGGAGG + Intronic
1190251898 X:48733230-48733252 CTGTAATCCCAGCTACTTGAGGG - Intergenic
1190299723 X:49050093-49050115 CTGTAATCCCAGCTATTCGTGGG - Intergenic
1190721462 X:53152359-53152381 CTTTCAAGCCAGCTATTTCAGGG + Intergenic
1190794427 X:53727712-53727734 CTGTAATCCCAGCTACTCAAGGG + Intergenic
1190869136 X:54410596-54410618 CTGTAATCCCAGCACTTGGAAGG + Intergenic
1191764145 X:64678628-64678650 CTGTAGTCCCAGCTATTTCATGG - Intergenic
1191844690 X:65538218-65538240 CTGTAATCCCAGCTATTCTGAGG + Intergenic
1192120392 X:68449778-68449800 CTGTAATCCCAGCTACTGGGGGG - Intergenic
1192135517 X:68595622-68595644 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1192465831 X:71355169-71355191 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1192490331 X:71570914-71570936 CTGTAGTCCCAGCTACTGGAAGG - Intronic
1192499921 X:71643875-71643897 CTGTAATTCCAGCTATTGGGAGG + Intergenic
1192780659 X:74291327-74291349 CTGTAACCCCAGCTACTACTTGG + Intergenic
1193119486 X:77808294-77808316 CTGTAATCCCAGCTACTTGAGGG - Intergenic
1193439874 X:81526695-81526717 CTGTAAATCCATCTGTTCCAGGG + Intergenic
1194650260 X:96505882-96505904 CTGTAATCCCAGCTCTTGGGAGG - Intergenic
1194688280 X:96951586-96951608 CTGTAATCCCAGCTACTCCTTGG - Intronic
1194857404 X:98950527-98950549 CTGTAATCCCAGCTACTCGAGGG - Intergenic
1194998844 X:100622257-100622279 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1195009209 X:100718918-100718940 CTGTAATCCCAGCTACTGGGAGG - Intronic
1195073923 X:101308028-101308050 CTGTAATCCCAGCTACTGGGGGG + Intergenic
1195077014 X:101337013-101337035 CTGTAATCCCAGCTACTCGAGGG - Intergenic
1195529376 X:105934929-105934951 CTGTAATCCCAGCTCTTGGGAGG - Intronic
1195557904 X:106248317-106248339 CTGTAAAGCTATCTTTTGCAGGG - Intergenic
1196427460 X:115586106-115586128 CTGTAATCCCAGCTATTCGGAGG - Intronic
1196556639 X:117092737-117092759 CTAGAAAACCAGTTATTGCATGG + Intergenic
1196723049 X:118872685-118872707 CTGAAAACCCAGCTACAGAATGG - Intergenic
1196747101 X:119081005-119081027 CTGTAATCCCAGCTTTTGGGAGG + Exonic
1196807324 X:119600120-119600142 CTGTAATCCCAGCAATTGGGAGG + Intronic
1196815780 X:119664716-119664738 CTGTAATCCCAGCTACGGAAAGG + Intronic
1196833281 X:119792546-119792568 CTGTAATCTCAGCTACTGCGGGG + Intergenic
1196972693 X:121126677-121126699 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
1197224217 X:123940349-123940371 CTGTAATCCCAGCTACTCAAGGG - Intergenic
1197227312 X:123967004-123967026 CTGTAATCCCAGCTACTGGGAGG - Intronic
1197783708 X:130180340-130180362 CTGTAATCCCAGCACTTTCAGGG + Intronic
1197784295 X:130185415-130185437 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1197928639 X:131672955-131672977 CTGTAATCCCAGCTAGTGGGGGG + Intergenic
1197928832 X:131675332-131675354 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1198213385 X:134535344-134535366 CTGTAATCCCAGCTACTCGAGGG + Intergenic
1198453430 X:136791437-136791459 TTGTAAAACCATATATTGCATGG + Intergenic
1198462694 X:136878620-136878642 CTGTAATCCCAGCTACTGGGGGG + Intronic
1199073770 X:143508277-143508299 CTGTAATCCCAGCTACTTGAAGG - Intergenic
1199107444 X:143887086-143887108 CTGTAATCCCAGCTACTCCAGGG - Intergenic
1199263294 X:145800979-145801001 CTGTAATCCCAGCTACTCGAGGG - Intergenic
1200185760 X:154182420-154182442 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1200191412 X:154219558-154219580 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1200197167 X:154257362-154257384 CTGTAATCCCAGCTACTGGGAGG - Intergenic
1200669078 Y:6065067-6065089 CTGTAATCCCAGCTACTGGGAGG + Intergenic
1200780434 Y:7210712-7210734 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1200941547 Y:8787177-8787199 CTGTAATTCCAGCTATTGGGAGG + Intergenic
1201787158 Y:17797325-17797347 CTGTAGTCCCAGCTACTCCAGGG + Intergenic
1201814395 Y:18108663-18108685 CTGTAGTCCCAGCTACTCCAGGG - Intergenic
1202016055 Y:20407850-20407872 CAGAAAACCTAGCCATTGCATGG - Intergenic