ID: 950664515

View in Genome Browser
Species Human (GRCh38)
Location 3:14487146-14487168
Sequence TTCACCCAGGGAGCCCCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950664515_950664523 3 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664523 3:14487172-14487194 CCACAGTATTTTGGGTTGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 181
950664515_950664525 27 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664525 3:14487196-14487218 AAATTGCAACATTCTGGACATGG 0: 1
1: 0
2: 1
3: 25
4: 223
950664515_950664520 -5 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664520 3:14487164-14487186 GTGAAAGGCCACAGTATTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 170
950664515_950664524 21 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664524 3:14487190-14487212 GTAGGCAAATTGCAACATTCTGG 0: 1
1: 0
2: 1
3: 10
4: 84
950664515_950664521 -1 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664521 3:14487168-14487190 AAGGCCACAGTATTTTGGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 169
950664515_950664519 -6 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664519 3:14487163-14487185 GGTGAAAGGCCACAGTATTTTGG 0: 1
1: 1
2: 0
3: 16
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950664515 Original CRISPR TTCACCCAGGGAGCCCCCGC TGG (reversed) Exonic