ID: 950664515

View in Genome Browser
Species Human (GRCh38)
Location 3:14487146-14487168
Sequence TTCACCCAGGGAGCCCCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950664515_950664519 -6 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664519 3:14487163-14487185 GGTGAAAGGCCACAGTATTTTGG 0: 1
1: 1
2: 0
3: 16
4: 134
950664515_950664524 21 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664524 3:14487190-14487212 GTAGGCAAATTGCAACATTCTGG 0: 1
1: 0
2: 1
3: 10
4: 84
950664515_950664523 3 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664523 3:14487172-14487194 CCACAGTATTTTGGGTTGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 181
950664515_950664520 -5 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664520 3:14487164-14487186 GTGAAAGGCCACAGTATTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 170
950664515_950664525 27 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664525 3:14487196-14487218 AAATTGCAACATTCTGGACATGG 0: 1
1: 0
2: 1
3: 25
4: 223
950664515_950664521 -1 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664521 3:14487168-14487190 AAGGCCACAGTATTTTGGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950664515 Original CRISPR TTCACCCAGGGAGCCCCCGC TGG (reversed) Exonic
900870110 1:5296330-5296352 TTCTCTCAGGGAGCCCCTGCAGG - Intergenic
901810734 1:11765699-11765721 TTCACCCAGGGAGACAGAGCTGG + Intronic
902434809 1:16391630-16391652 CTCACACAGGGAGCCCACGAAGG - Intronic
906104373 1:43283141-43283163 TTTCTCCAGGGAGCCCCCTCTGG - Intronic
915031854 1:152886685-152886707 TCCACCCTGGGAGCCTCCACTGG + Intergenic
917279187 1:173363738-173363760 GCCACCCAGGGAGCCTCCACAGG + Intergenic
917737641 1:177935026-177935048 TACACCAAGGGAGCCACTGCAGG + Intronic
920693558 1:208164756-208164778 TGCCCCCAGGGAGCCGCTGCCGG - Intronic
922745301 1:228039785-228039807 TTCACCCAGGCTGGCCCCTCTGG - Intronic
1065102082 10:22340964-22340986 TCCGCCCCGGGAGGCCCCGCGGG + Intergenic
1067044294 10:42975672-42975694 TTGAGCCAGGGTGCACCCGCAGG + Intergenic
1073042253 10:100615624-100615646 TCCCCCCAGGGTGCCCCAGCGGG - Intergenic
1073250024 10:102115405-102115427 TTCACCAGGGGAGCCCAGGCTGG - Intronic
1075486128 10:122823234-122823256 TGCACGCAGGGAGCCCCCAGTGG - Intergenic
1076114864 10:127888257-127888279 CTCTCCCAGGGAGCCCAGGCTGG + Intronic
1076881924 10:133243788-133243810 ATCACCCTGGGAGCCCCCGAGGG - Intergenic
1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG + Intronic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1077053470 11:578225-578247 ATAACCCAGGAAGCCTCCGCAGG - Intronic
1078170309 11:8924618-8924640 TTCAACCAGGGACCCCCAGTGGG + Intronic
1080311885 11:30904172-30904194 TTCACCCAGGGATCCACAGCTGG - Intronic
1080802193 11:35618951-35618973 GTCAGCCAGGCAGCCCCGGCCGG + Exonic
1083641213 11:64146369-64146391 ATAAGCCAGGGAGCCCCCGCAGG - Intronic
1087275288 11:96154998-96155020 TTCTCCCAGGGAGTGCCTGCTGG + Intronic
1089046046 11:115503365-115503387 TTCACGCAGGGAGCGCGCGGAGG + Intronic
1089151581 11:116368620-116368642 TTGACTCAGGGAACCCCAGCAGG + Intergenic
1096362354 12:50998958-50998980 TTAAACCTGGGAGCCCCTGCAGG + Intronic
1096472750 12:51889436-51889458 TTAACGCCGTGAGCCCCCGCTGG - Exonic
1096575268 12:52548858-52548880 TTCACTCAGGGAACCCAGGCAGG - Intronic
1096576205 12:52554358-52554380 TTCACCCATGGGGCTCCAGCAGG - Intergenic
1102045689 12:109828781-109828803 TTTACCCAGGGATGCCCAGCTGG - Intronic
1103415463 12:120739533-120739555 GGTCCCCAGGGAGCCCCCGCCGG - Exonic
1104044692 12:125153524-125153546 TTGACCCAGGGAGGCCCTTCTGG - Intergenic
1107585989 13:41848811-41848833 TGCAGACAGGGAGCCCCTGCAGG - Intronic
1113763972 13:112869395-112869417 TAAACCCAGGGAGCCCCAGCTGG + Intronic
1121422347 14:93824596-93824618 TGCTCCCAGGGAGCCCCAGCAGG + Intergenic
1121645482 14:95515189-95515211 TTCAACCAGAGAGGCCCCTCTGG - Intergenic
1122115442 14:99525197-99525219 TTCACCCAGCGAGTCCTCGCTGG - Intronic
1122201989 14:100128359-100128381 TTCATCCAGGAAGCCTCCGCGGG - Intronic
1122337833 14:101005538-101005560 TTCTCCCAGGGAGCAGGCGCTGG + Intergenic
1122718379 14:103708413-103708435 TTCACCCAGGGACCAGCCTCAGG - Intronic
1130063423 15:80585716-80585738 TTTCCCCAGGGAGTGCCCGCAGG + Intronic
1131250655 15:90828089-90828111 GACACCCAGGGCGCCCCAGCAGG + Intergenic
1134078422 16:11308506-11308528 TTCACCCAGGGAGGGTCCGAAGG - Intronic
1134742464 16:16560073-16560095 TTAGCCCAGGGAGACCCCACTGG + Intergenic
1134925099 16:18152386-18152408 TTAGCCCAGGGAGACCCCACTGG - Intergenic
1136540139 16:30924158-30924180 TGCGCCCAAGGAGCCCCCGTTGG + Intronic
1137777811 16:51071172-51071194 TTCTCCCTTAGAGCCCCCGCAGG + Intergenic
1142131062 16:88431676-88431698 CTCAGCCAGGGATGCCCCGCCGG + Exonic
1142711967 17:1728300-1728322 CTCACCCAGGGAGGTCTCGCTGG - Exonic
1142879281 17:2871739-2871761 TTGACCCAGTGAGCCACCTCTGG + Intronic
1144765013 17:17727834-17727856 TTCACCCCAGGAGACCCCCCGGG + Intronic
1145974795 17:28977805-28977827 TCCACCCAGTGAGCCACAGCCGG + Intronic
1148089369 17:45013662-45013684 CTCCCCCAGAGAGCCCCTGCTGG + Intergenic
1152181665 17:78825877-78825899 TTCTCCCAGGAAGCCGCCTCTGG + Intronic
1152586740 17:81192690-81192712 CTCTCCCAGGGACCCCTCGCTGG - Intronic
1152800746 17:82329658-82329680 TTAACCCAGGGAGACCCCGTCGG - Intronic
1152924549 17:83081047-83081069 TTCCCCCGGGGAGGCTCCGCCGG - Intronic
1156298914 18:35818212-35818234 TGCACCCAGGGAGCACCACCAGG + Intergenic
1157711518 18:49852970-49852992 GTCACCAAAGGAGCCCCAGCAGG - Intronic
1161302814 19:3551235-3551257 CTCACCCTGGGAGCCCTGGCTGG - Intronic
1161375338 19:3936961-3936983 TTCACCCAGAAAGCCACAGCCGG - Intronic
1161480987 19:4510571-4510593 TTCACCCAAGGGGCCGCCCCAGG - Exonic
1161650255 19:5479993-5480015 CTCGCCCAGGGAGCCGCCGGTGG - Intergenic
1163251268 19:16127675-16127697 TGCACCCAAGAAGCCCCGGCTGG - Intronic
1163288850 19:16365578-16365600 GTCCCCCAGGGTGCCCCTGCCGG - Intronic
1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG + Exonic
1163584817 19:18157804-18157826 ATCACTCAGGGAGGCCCCGCAGG + Intronic
1164840179 19:31387348-31387370 TTCTCCCTGGGAGCCCCCTGAGG - Intergenic
1164860988 19:31562085-31562107 TTGACCCAGGGATCTCCTGCAGG + Intergenic
1165454028 19:35900512-35900534 TTCCCCCGCGGAGCCGCCGCCGG + Exonic
1166746107 19:45142571-45142593 TTCCTCCTGGGAGCCCCAGCAGG - Intronic
1167199040 19:48051219-48051241 TTCTCCCCTGGAGCCTCCGCAGG + Intronic
1167641868 19:50686834-50686856 GACGCCCAGGGAGCCCCCGGGGG + Intronic
925025257 2:602146-602168 TCCACACCGGGAGCCCACGCGGG + Intergenic
927637057 2:24824300-24824322 TTCTTTCAGGCAGCCCCCGCTGG - Intronic
927739129 2:25551467-25551489 TTCAGCCAAGGATCCCCAGCCGG - Intronic
928334861 2:30389133-30389155 TCCTCCCAGAGAGCCACCGCAGG + Intergenic
932002362 2:67896412-67896434 TACAGCCAGGCAGCCCACGCTGG + Intergenic
937874265 2:126809471-126809493 TTCTCTCAGGGAGCTCCCTCTGG - Intergenic
938236001 2:129707876-129707898 TTCCCCCAGGGAGCCCATGCAGG - Intergenic
945040945 2:205743415-205743437 ATCATCCAGGGAGCCCGCGGAGG + Exonic
946253823 2:218429496-218429518 AGCACCCAGGAAGACCCCGCTGG - Intronic
947944480 2:234089879-234089901 TTCTCCCCTGGAGCCCCCACAGG - Intergenic
948864666 2:240769195-240769217 TTCCCCCAGGGAAGCCCTGCTGG - Exonic
1168766992 20:388425-388447 AGCATCCAGGGAGCCCCTGCTGG + Intronic
1170893067 20:20392111-20392133 CCCACCCAGGGCGCCCCAGCAGG + Intronic
1175252863 20:57620214-57620236 CTCACCCCGGGAGCTACCGCTGG + Intronic
1175929036 20:62484955-62484977 TGCACCCAGGGAGCACTGGCTGG + Intergenic
1179422895 21:41250190-41250212 TTCATCCAGGAAGCCCTCCCTGG - Intronic
1179479160 21:41666799-41666821 TTCTCCCAGAGAGGCCCCTCCGG - Intergenic
1179603817 21:42499228-42499250 TGCACCCAGGAAGCCCCAGGAGG + Intronic
1179987579 21:44930158-44930180 TCCACCCAGGAAGCCCCTGAAGG + Intronic
1181100148 22:20533483-20533505 TCCACCCAGGGAGGCCCAGCAGG - Intronic
1181647767 22:24243065-24243087 GTCACTCAGGGAGACCCAGCAGG + Intronic
1184707533 22:46224742-46224764 TTCACCCCAGCAGCCCCTGCAGG - Intronic
1185275653 22:49949295-49949317 TCCACCCAAGGAGCCCCGTCAGG - Intergenic
1185349248 22:50326103-50326125 TTCCTCCAGGGAGGCCCCGCAGG - Intronic
950664515 3:14487146-14487168 TTCACCCAGGGAGCCCCCGCTGG - Exonic
961733673 3:128986647-128986669 TGCACCCAGGTAGACCACGCCGG + Intronic
968864287 4:3197913-3197935 TTCACTCAGGGGGCCCATGCAGG + Intronic
969455487 4:7297530-7297552 TTCACCCAGGGAGACTCAGCAGG - Intronic
971490559 4:27207939-27207961 TTCACCCAGGCAATCCCGGCTGG - Intergenic
975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG + Exonic
980191572 4:129531463-129531485 TTCACCCTGAGAGCACCAGCTGG - Intergenic
996819133 5:127606390-127606412 TTCACCCAGGCAGCCACTGAAGG + Intergenic
997632156 5:135377081-135377103 AGCACCCAGGGCGCCCCCACAGG + Intronic
1001052357 5:168423589-168423611 TGCAACCAGGGAGCCCCGGCTGG - Exonic
1002446851 5:179295314-179295336 TTCACCCAGGGAGAGCCAGGAGG - Intronic
1004570939 6:16844285-16844307 GGGACCCAGGGAGCACCCGCTGG + Intergenic
1006187464 6:32189482-32189504 TTCACAGAGGGAACCCCCGGTGG - Intronic
1007284600 6:40738399-40738421 TGTCCCCAGGGAGCCCCAGCCGG - Intergenic
1007644494 6:43369618-43369640 TCCACTCAGGGAGCGGCCGCAGG + Intergenic
1009879469 6:69547583-69547605 TTCACCCAGGGAGACCCGGGAGG - Intergenic
1015514339 6:134069701-134069723 TTCGCCCAGGGAACCGCTGCTGG + Intergenic
1016894371 6:149037873-149037895 CTGACCCAGGCAGCCCACGCTGG - Intronic
1017463357 6:154672103-154672125 TTCACCCAGAGAGACCCTCCTGG - Intergenic
1017665872 6:156719898-156719920 TCCACACAGGGATCCACCGCGGG + Intergenic
1019296116 7:276337-276359 TTCAGCCAGGGAGACCCTGAAGG - Intergenic
1019923149 7:4175402-4175424 CTCACGCAGGGAGCCCCGGCTGG - Intronic
1021939816 7:25668508-25668530 TTCACCCAGGGAGCTGCAGAGGG - Intergenic
1025220021 7:57099467-57099489 ACAACCCAGGGAGCACCCGCTGG - Intergenic
1026470981 7:70694149-70694171 TCCAGCCAGGGAGCCCGCGGCGG + Intronic
1026977334 7:74506694-74506716 TTGACCCAGGGGGCACCCACAGG - Intronic
1027333818 7:77127150-77127172 TGCACCCAGGGAGCTCCCGCAGG + Intronic
1029640636 7:101817038-101817060 TTTCCCCAAAGAGCCCCCGCGGG - Intronic
1029710045 7:102294569-102294591 CTCACTCAGGGAGCACCCACGGG + Intronic
1029781974 7:102744164-102744186 TGCACCCAGGGAGCTCCCGCAGG - Intergenic
1032086815 7:128888812-128888834 GGCACCCCGGGAGCCCCAGCAGG + Intronic
1033036417 7:137879948-137879970 TGCCCCCTGGGAGCCCTCGCTGG - Exonic
1034268187 7:149791217-149791239 TTCCCTGAGGGAGGCCCCGCTGG + Intergenic
1035453998 7:158997281-158997303 TTCCCCTGGGCAGCCCCCGCGGG + Intergenic
1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG + Intronic
1039457563 8:37717612-37717634 TTGGCCCAGAGAGCCCCTGCTGG - Intergenic
1039835543 8:41253610-41253632 TTTCCCCAGGGAGCCCCACCAGG + Intergenic
1049523947 8:143111194-143111216 TGAACAAAGGGAGCCCCCGCTGG - Intergenic
1050892079 9:10836383-10836405 TTCACCCAGGGATCCTGCACGGG - Intergenic
1055096993 9:72423886-72423908 TCCACCCAGGGAGCCCATGCCGG - Intergenic
1058401510 9:104625103-104625125 CTCGCCCAGGGAACCCCTGCTGG + Intergenic
1058826896 9:108783203-108783225 CTCACCCAGGAAGCCCAGGCAGG + Intergenic
1061192954 9:129092950-129092972 GTCACCCCTGGAGCCCCCTCTGG + Intergenic
1061862948 9:133477213-133477235 TTCACCCTGGGAGCAGCGGCCGG - Exonic
1062497505 9:136838676-136838698 TTCACCCACTGAGCGGCCGCAGG + Intronic
1062578128 9:137217963-137217985 TACAGCCAGTGAGCCCCTGCTGG + Intergenic
1192966451 X:76182660-76182682 TCATCCCAGGGGGCCCCCGCCGG + Intergenic
1201311441 Y:12601403-12601425 TTCACCCCTGGACCCCCTGCAGG - Intergenic
1201513277 Y:14788894-14788916 CTCACCCAGGGAGCTCCTCCAGG + Intronic