ID: 950664519

View in Genome Browser
Species Human (GRCh38)
Location 3:14487163-14487185
Sequence GGTGAAAGGCCACAGTATTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950664515_950664519 -6 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664519 3:14487163-14487185 GGTGAAAGGCCACAGTATTTTGG 0: 1
1: 1
2: 0
3: 16
4: 134
950664510_950664519 2 Left 950664510 3:14487138-14487160 CCATCTCCCCAGCGGGGGCTCCC 0: 1
1: 0
2: 4
3: 22
4: 345
Right 950664519 3:14487163-14487185 GGTGAAAGGCCACAGTATTTTGG 0: 1
1: 1
2: 0
3: 16
4: 134
950664513_950664519 -4 Left 950664513 3:14487144-14487166 CCCCAGCGGGGGCTCCCTGGGTG 0: 1
1: 0
2: 4
3: 24
4: 247
Right 950664519 3:14487163-14487185 GGTGAAAGGCCACAGTATTTTGG 0: 1
1: 1
2: 0
3: 16
4: 134
950664514_950664519 -5 Left 950664514 3:14487145-14487167 CCCAGCGGGGGCTCCCTGGGTGA 0: 1
1: 0
2: 1
3: 16
4: 152
Right 950664519 3:14487163-14487185 GGTGAAAGGCCACAGTATTTTGG 0: 1
1: 1
2: 0
3: 16
4: 134
950664505_950664519 29 Left 950664505 3:14487111-14487133 CCTGGGCATTTGTGGTCATTTCA 0: 1
1: 0
2: 1
3: 21
4: 238
Right 950664519 3:14487163-14487185 GGTGAAAGGCCACAGTATTTTGG 0: 1
1: 1
2: 0
3: 16
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950664519 Original CRISPR GGTGAAAGGCCACAGTATTT TGG Exonic