ID: 950664520

View in Genome Browser
Species Human (GRCh38)
Location 3:14487164-14487186
Sequence GTGAAAGGCCACAGTATTTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950664510_950664520 3 Left 950664510 3:14487138-14487160 CCATCTCCCCAGCGGGGGCTCCC 0: 1
1: 0
2: 4
3: 22
4: 345
Right 950664520 3:14487164-14487186 GTGAAAGGCCACAGTATTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 170
950664513_950664520 -3 Left 950664513 3:14487144-14487166 CCCCAGCGGGGGCTCCCTGGGTG 0: 1
1: 0
2: 4
3: 24
4: 247
Right 950664520 3:14487164-14487186 GTGAAAGGCCACAGTATTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 170
950664515_950664520 -5 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664520 3:14487164-14487186 GTGAAAGGCCACAGTATTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 170
950664505_950664520 30 Left 950664505 3:14487111-14487133 CCTGGGCATTTGTGGTCATTTCA 0: 1
1: 0
2: 1
3: 21
4: 238
Right 950664520 3:14487164-14487186 GTGAAAGGCCACAGTATTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 170
950664514_950664520 -4 Left 950664514 3:14487145-14487167 CCCAGCGGGGGCTCCCTGGGTGA 0: 1
1: 0
2: 1
3: 16
4: 152
Right 950664520 3:14487164-14487186 GTGAAAGGCCACAGTATTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950664520 Original CRISPR GTGAAAGGCCACAGTATTTT GGG Exonic