ID: 950664521

View in Genome Browser
Species Human (GRCh38)
Location 3:14487168-14487190
Sequence AAGGCCACAGTATTTTGGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950664515_950664521 -1 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664521 3:14487168-14487190 AAGGCCACAGTATTTTGGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 169
950664514_950664521 0 Left 950664514 3:14487145-14487167 CCCAGCGGGGGCTCCCTGGGTGA 0: 1
1: 0
2: 1
3: 16
4: 152
Right 950664521 3:14487168-14487190 AAGGCCACAGTATTTTGGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 169
950664510_950664521 7 Left 950664510 3:14487138-14487160 CCATCTCCCCAGCGGGGGCTCCC 0: 1
1: 0
2: 4
3: 22
4: 345
Right 950664521 3:14487168-14487190 AAGGCCACAGTATTTTGGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 169
950664513_950664521 1 Left 950664513 3:14487144-14487166 CCCCAGCGGGGGCTCCCTGGGTG 0: 1
1: 0
2: 4
3: 24
4: 247
Right 950664521 3:14487168-14487190 AAGGCCACAGTATTTTGGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950664521 Original CRISPR AAGGCCACAGTATTTTGGGT TGG Exonic