ID: 950664523

View in Genome Browser
Species Human (GRCh38)
Location 3:14487172-14487194
Sequence CCACAGTATTTTGGGTTGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950664517_950664523 -9 Left 950664517 3:14487158-14487180 CCCTGGGTGAAAGGCCACAGTAT 0: 1
1: 0
2: 5
3: 8
4: 105
Right 950664523 3:14487172-14487194 CCACAGTATTTTGGGTTGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 181
950664518_950664523 -10 Left 950664518 3:14487159-14487181 CCTGGGTGAAAGGCCACAGTATT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 950664523 3:14487172-14487194 CCACAGTATTTTGGGTTGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 181
950664513_950664523 5 Left 950664513 3:14487144-14487166 CCCCAGCGGGGGCTCCCTGGGTG 0: 1
1: 0
2: 4
3: 24
4: 247
Right 950664523 3:14487172-14487194 CCACAGTATTTTGGGTTGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 181
950664515_950664523 3 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664523 3:14487172-14487194 CCACAGTATTTTGGGTTGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 181
950664514_950664523 4 Left 950664514 3:14487145-14487167 CCCAGCGGGGGCTCCCTGGGTGA 0: 1
1: 0
2: 1
3: 16
4: 152
Right 950664523 3:14487172-14487194 CCACAGTATTTTGGGTTGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 181
950664510_950664523 11 Left 950664510 3:14487138-14487160 CCATCTCCCCAGCGGGGGCTCCC 0: 1
1: 0
2: 4
3: 22
4: 345
Right 950664523 3:14487172-14487194 CCACAGTATTTTGGGTTGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950664523 Original CRISPR CCACAGTATTTTGGGTTGGT AGG Exonic