ID: 950664524

View in Genome Browser
Species Human (GRCh38)
Location 3:14487190-14487212
Sequence GTAGGCAAATTGCAACATTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950664510_950664524 29 Left 950664510 3:14487138-14487160 CCATCTCCCCAGCGGGGGCTCCC 0: 1
1: 0
2: 4
3: 22
4: 345
Right 950664524 3:14487190-14487212 GTAGGCAAATTGCAACATTCTGG 0: 1
1: 0
2: 1
3: 10
4: 84
950664522_950664524 -5 Left 950664522 3:14487172-14487194 CCACAGTATTTTGGGTTGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 950664524 3:14487190-14487212 GTAGGCAAATTGCAACATTCTGG 0: 1
1: 0
2: 1
3: 10
4: 84
950664514_950664524 22 Left 950664514 3:14487145-14487167 CCCAGCGGGGGCTCCCTGGGTGA 0: 1
1: 0
2: 1
3: 16
4: 152
Right 950664524 3:14487190-14487212 GTAGGCAAATTGCAACATTCTGG 0: 1
1: 0
2: 1
3: 10
4: 84
950664513_950664524 23 Left 950664513 3:14487144-14487166 CCCCAGCGGGGGCTCCCTGGGTG 0: 1
1: 0
2: 4
3: 24
4: 247
Right 950664524 3:14487190-14487212 GTAGGCAAATTGCAACATTCTGG 0: 1
1: 0
2: 1
3: 10
4: 84
950664517_950664524 9 Left 950664517 3:14487158-14487180 CCCTGGGTGAAAGGCCACAGTAT 0: 1
1: 0
2: 5
3: 8
4: 105
Right 950664524 3:14487190-14487212 GTAGGCAAATTGCAACATTCTGG 0: 1
1: 0
2: 1
3: 10
4: 84
950664518_950664524 8 Left 950664518 3:14487159-14487181 CCTGGGTGAAAGGCCACAGTATT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 950664524 3:14487190-14487212 GTAGGCAAATTGCAACATTCTGG 0: 1
1: 0
2: 1
3: 10
4: 84
950664515_950664524 21 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664524 3:14487190-14487212 GTAGGCAAATTGCAACATTCTGG 0: 1
1: 0
2: 1
3: 10
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950664524 Original CRISPR GTAGGCAAATTGCAACATTC TGG Exonic