ID: 950664525

View in Genome Browser
Species Human (GRCh38)
Location 3:14487196-14487218
Sequence AAATTGCAACATTCTGGACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950664517_950664525 15 Left 950664517 3:14487158-14487180 CCCTGGGTGAAAGGCCACAGTAT 0: 1
1: 0
2: 5
3: 8
4: 105
Right 950664525 3:14487196-14487218 AAATTGCAACATTCTGGACATGG 0: 1
1: 0
2: 1
3: 25
4: 223
950664522_950664525 1 Left 950664522 3:14487172-14487194 CCACAGTATTTTGGGTTGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 165
Right 950664525 3:14487196-14487218 AAATTGCAACATTCTGGACATGG 0: 1
1: 0
2: 1
3: 25
4: 223
950664515_950664525 27 Left 950664515 3:14487146-14487168 CCAGCGGGGGCTCCCTGGGTGAA 0: 1
1: 0
2: 3
3: 20
4: 123
Right 950664525 3:14487196-14487218 AAATTGCAACATTCTGGACATGG 0: 1
1: 0
2: 1
3: 25
4: 223
950664513_950664525 29 Left 950664513 3:14487144-14487166 CCCCAGCGGGGGCTCCCTGGGTG 0: 1
1: 0
2: 4
3: 24
4: 247
Right 950664525 3:14487196-14487218 AAATTGCAACATTCTGGACATGG 0: 1
1: 0
2: 1
3: 25
4: 223
950664518_950664525 14 Left 950664518 3:14487159-14487181 CCTGGGTGAAAGGCCACAGTATT 0: 1
1: 0
2: 1
3: 10
4: 132
Right 950664525 3:14487196-14487218 AAATTGCAACATTCTGGACATGG 0: 1
1: 0
2: 1
3: 25
4: 223
950664514_950664525 28 Left 950664514 3:14487145-14487167 CCCAGCGGGGGCTCCCTGGGTGA 0: 1
1: 0
2: 1
3: 16
4: 152
Right 950664525 3:14487196-14487218 AAATTGCAACATTCTGGACATGG 0: 1
1: 0
2: 1
3: 25
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950664525 Original CRISPR AAATTGCAACATTCTGGACA TGG Exonic