ID: 950665742

View in Genome Browser
Species Human (GRCh38)
Location 3:14493769-14493791
Sequence CGGCCAGGAGTGGCACCGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950665734_950665742 25 Left 950665734 3:14493721-14493743 CCGTGTGCGGCTTGCGGCTGATG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 950665742 3:14493769-14493791 CGGCCAGGAGTGGCACCGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 131
950665736_950665742 -5 Left 950665736 3:14493751-14493773 CCAAGACATCACCCGCCTCGGCC 0: 1
1: 0
2: 0
3: 21
4: 204
Right 950665742 3:14493769-14493791 CGGCCAGGAGTGGCACCGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950665742 Original CRISPR CGGCCAGGAGTGGCACCGCC AGG Exonic
900530244 1:3149468-3149490 CAGCCAGGAGTGGCAGGGCAGGG - Intronic
901026559 1:6281543-6281565 CGGCCAGGAGAGAGCCCGCCTGG - Intronic
901062339 1:6477619-6477641 CTGCCAGCAGCTGCACCGCCGGG - Exonic
903267012 1:22163623-22163645 CTGCTAGGATTGGCACTGCCAGG - Intergenic
903366595 1:22809101-22809123 GGGCCTGCAGAGGCACCGCCGGG - Intronic
906525914 1:46493183-46493205 CGGGCAGCAGTGGCGTCGCCCGG - Intergenic
906719754 1:47996756-47996778 CGGCGAGCAGCGGCCCCGCCAGG + Exonic
907272775 1:53300529-53300551 CGGCCAGGGTGGGCACAGCCTGG - Intronic
912710082 1:111943848-111943870 GGCCCAGGAGTGGCATGGCCAGG + Intronic
915543930 1:156585252-156585274 CAGTAAGGAGAGGCACCGCCAGG - Intronic
920456473 1:206105277-206105299 CGGCCCAGAGTGGCACTGTCTGG + Intergenic
922616289 1:226963058-226963080 TGCCCAGGAGTGGGACAGCCTGG + Intronic
1062908965 10:1199880-1199902 CTGCGAGGGATGGCACCGCCGGG + Intronic
1064113675 10:12559760-12559782 CGGGCAGTAGTGGCAGTGCCAGG + Intronic
1065019837 10:21494980-21495002 CGTCCAGGAGAGGGACCCCCGGG - Exonic
1066088102 10:31990859-31990881 AGGCCAGGAGTTGCTCAGCCTGG + Intergenic
1066421090 10:35265619-35265641 CGGCCGGGAGCGGCACCTTCAGG - Intronic
1073604735 10:104882758-104882780 TGGCCAGGAGTGGCACTGGGTGG - Intronic
1073863212 10:107770829-107770851 CTGCCAGCAGTGGCACAGCAGGG - Intergenic
1075334221 10:121597438-121597460 TGGCCAGGGGTGGCACTGCTGGG - Intronic
1076784885 10:132744950-132744972 CTGCCAGGGGCTGCACCGCCGGG - Intronic
1077062168 11:622265-622287 CTGCCAGGACAGGCACCACCAGG - Intronic
1077284911 11:1761347-1761369 CGGTCACGGCTGGCACCGCCTGG + Exonic
1077488036 11:2848044-2848066 AGGCCAAGAGTGGCCCCACCTGG + Exonic
1077976363 11:7252216-7252238 CGGCCAGCAGCTGCAGCGCCTGG - Exonic
1083170577 11:60921985-60922007 AGGCCAGGAGTAGCAGGGCCCGG - Exonic
1083277960 11:61608150-61608172 TTCCCAGGAGTGGAACCGCCGGG + Intergenic
1083895636 11:65618481-65618503 CGACCAGGAGCGGCTCAGCCAGG - Exonic
1084090570 11:66876946-66876968 CAGGCAGGAGTGGCACCTCATGG - Intronic
1084120541 11:67066482-67066504 AGGCCAGGCCTGGCACCGCCTGG - Intronic
1084372094 11:68751144-68751166 CGGCCAGGAGAGGGGCCGGCCGG + Intronic
1084978016 11:72814026-72814048 CGGCCAGGAGCGCGACGGCCTGG + Intergenic
1089706918 11:120284661-120284683 TGGCCAGGAGAGGCAGCCCCAGG - Intronic
1090484723 11:127102730-127102752 AGGCCAGGAGTGCCACTGTCGGG + Intergenic
1090735639 11:129610307-129610329 TGGCAGGGAGTGCCACCGCCAGG + Intergenic
1091319727 11:134640901-134640923 GGGCCAGGCGTGGCACTGGCTGG + Intergenic
1092388305 12:8052779-8052801 CGGCCATCAGTGCCACCTCCTGG + Exonic
1095984227 12:47988909-47988931 AGGCCAGGAGTGGCAGCACAGGG - Intronic
1099222966 12:79935416-79935438 AGGCCAGCAGTGGAACCGCAAGG + Intronic
1102375546 12:112418796-112418818 CGGCCGGGAATGGCAGCGCGGGG - Intronic
1102538198 12:113597862-113597884 CAGCCATGTGTGGCACAGCCAGG - Intergenic
1103763959 12:123269144-123269166 CAGCCAGGAGTGGCACAGCTGGG - Intronic
1104399038 12:128460561-128460583 TGGCAATGAGTGGCACCGCCTGG - Intronic
1104403951 12:128502118-128502140 CAGCCAGGGTTGGCACTGCCTGG + Intronic
1104973411 12:132541493-132541515 CTGCCTGGGGGGGCACCGCCAGG - Intronic
1106208514 13:27620853-27620875 CCGCCAAGAGTGGCACAGCTGGG + Exonic
1106248669 13:27968326-27968348 GCGCCAGGAGGGGCACGGCCCGG - Intronic
1107771072 13:43787533-43787555 CGGCCCAGAGTGGCTCGGCCGGG + Intergenic
1110423024 13:75335019-75335041 CAGCAGGGAGTGGCACAGCCTGG - Intronic
1122017534 14:98808742-98808764 AGGCCAGAAGAGGCACCGCTGGG - Intergenic
1123063955 14:105606814-105606836 CGGGCAGGAGAGGAACAGCCCGG - Intergenic
1124248982 15:28095249-28095271 AGGGCAGGAGTGGCCCAGCCAGG + Intronic
1125742038 15:41972163-41972185 CGGCCGGGAGGGGCAGCGGCGGG + Intronic
1125749491 15:42019093-42019115 TGCCCAGGAGTGGCAGAGCCAGG + Intronic
1128374413 15:67065400-67065422 CAGCCAGGACTGCCGCCGCCCGG + Intronic
1129273956 15:74433461-74433483 CAGCCAGGAGCCGCAACGCCCGG - Intronic
1131063165 15:89416857-89416879 CAGCCCGGAGTGTCCCCGCCAGG - Intergenic
1131248280 15:90814595-90814617 TGGCCAGGAGTGGCAAAGCTGGG - Intronic
1131529679 15:93180666-93180688 CTGCCAGGAGAGACACTGCCAGG + Intergenic
1132976267 16:2712610-2712632 CGGCCAGAAGTGAGACCCCCGGG - Exonic
1138360759 16:56425460-56425482 CAGCCAGGAGCGGCCCGGCCCGG - Exonic
1138551214 16:57749722-57749744 TGGCCAGGAGCGGCCCAGCCTGG - Intronic
1141672319 16:85498777-85498799 TGGCCAGGGGTGGCACAGGCAGG + Intergenic
1145310289 17:21697603-21697625 CAGCCAGGAGGGGCACTGCTGGG - Intronic
1146950187 17:36900210-36900232 GGGCCAGGGCTGGCACAGCCTGG + Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1152798160 17:82317975-82317997 AGGCCAGAATTGGCACCCCCTGG + Intergenic
1153736279 18:8071713-8071735 CGGCCAGGAGAGGCCCCGACTGG - Intronic
1160732585 19:648023-648045 CAGCCAAGCGTGGCGCCGCCGGG + Exonic
1161157454 19:2740019-2740041 CGGCCCGGAGAGGCCCCGCTCGG + Exonic
1161455853 19:4369473-4369495 CTGGCAGGAGTGGCTCCGTCAGG + Intronic
1163842263 19:19618623-19618645 CGGCCATGAGCGGCAGGGCCGGG + Exonic
1164879102 19:31715688-31715710 CAGCCAGGAGGAGCCCCGCCAGG + Intergenic
1165316485 19:35059589-35059611 AGGCCAGGAGGGGCTCCGGCTGG + Intronic
1166123539 19:40700215-40700237 AGGCCAGCAGTGGCACCACAAGG - Intronic
1166432112 19:42736833-42736855 CTGGCAGGAGTGGCAACTCCAGG + Intronic
1166435227 19:42762026-42762048 CTGGCAGGAGTGGCAACTCCAGG + Intronic
1166445097 19:42852052-42852074 CCGGCAGGAGTGGCAACTCCAGG + Intronic
1166452495 19:42914229-42914251 CTGGCAGGAGTGGCAACTCCAGG + Intronic
1166454988 19:42933511-42933533 CTGGCAGGAGTGGCAACTCCAGG + Intronic
1166464773 19:43022795-43022817 CTGGCAGGAGTGGCAACTCCAGG + Intronic
1166470903 19:43078977-43078999 CTGGCAGGAGTGGCAACTCCAGG + Intronic
1166482052 19:43182897-43182919 CTGGCAGGAGTGGCAACTCCAGG + Intronic
1166484535 19:43202012-43202034 CTGGCAGGAGTGGCAACTCCAGG + Intronic
1166491653 19:43265892-43265914 CAGGCAGGAGTGGCAACTCCAGG + Intronic
1166832233 19:45645565-45645587 GGGCCAGGATTGGCTGCGCCCGG + Exonic
1166876541 19:45901391-45901413 GGGCCAGGTGTGGCGGCGCCGGG - Exonic
1166894438 19:46015229-46015251 CGGCCAGGACTGCCGCCGTCTGG + Exonic
1168288215 19:55344904-55344926 AGGCCAGGGGTGGCATCGCCAGG - Intronic
1168458929 19:56538387-56538409 CGGCGAGGGGTGGGACCGCAGGG - Intergenic
925616161 2:5746341-5746363 CCACCATGAGTGGCAGCGCCTGG + Intergenic
930340737 2:50111427-50111449 AGGTCAGGAGTGAGACCGCCTGG + Intronic
933715130 2:85354462-85354484 CGGCCAGCAGCAGCACAGCCAGG + Exonic
936512244 2:113157561-113157583 CGGCCGGGGGTGCCCCCGCCCGG - Intronic
948423133 2:237872634-237872656 AGCCCAGGAGTGGTACAGCCTGG - Intronic
948431824 2:237923612-237923634 CGGCCAGCAAGGGAACCGCCTGG - Intergenic
948740913 2:240045433-240045455 TGGCCAGGAGTGGAAACACCAGG + Exonic
1168913156 20:1466426-1466448 CGGCGAGGAGAGGGAGCGCCTGG - Intronic
1170590352 20:17766776-17766798 CAGCCAGGAGTGGAACTGCTAGG + Intergenic
1175957107 20:62617033-62617055 TGGCCAGGAGAGGCACTGCCTGG + Intergenic
1178992563 21:37367488-37367510 CGGCCAGGAGCCGGAGCGCCGGG + Intronic
1180097156 21:45561407-45561429 AGGCCAGGAGTGGGAACACCGGG - Intergenic
1181438711 22:22924833-22924855 CCCCCAGGAGTGGCTCAGCCTGG - Intergenic
1182096623 22:27630367-27630389 AAGCCACGAGTGGCACAGCCTGG - Intergenic
1183725849 22:39589317-39589339 CACCCAGGAGTGGCCCCGCTGGG + Intronic
1184524565 22:45014258-45014280 AGGTCAGGAGTGGCACCGTCTGG + Intergenic
1184838162 22:47036339-47036361 CCTCCAGGAGTGACACCGCCAGG + Intronic
1185375616 22:50481563-50481585 CGGCCCGGGATGGCACCTCCAGG - Exonic
950310286 3:11952007-11952029 CAGTCAGGACTGGCAGCGCCAGG + Intergenic
950665742 3:14493769-14493791 CGGCCAGGAGTGGCACCGCCAGG + Exonic
956712154 3:72048322-72048344 AGGCCAGGAGGGGCACTGTCAGG + Intergenic
959035402 3:101357289-101357311 CCGCGAGGAGTGGCATTGCCTGG + Intronic
969444187 4:7234823-7234845 CTGCCTGGAGGGGCACAGCCTGG - Intronic
971172863 4:24251217-24251239 CAGCTAGTAGTGGCACAGCCAGG - Intergenic
985275545 4:188234144-188234166 TGGCCAGGTGTGGCACTCCCCGG - Intergenic
985645232 5:1081819-1081841 CGGCCACCAGTGGCACCTGCCGG - Intronic
1002190016 5:177473240-177473262 GGGCCAGGCGGGGCACTGCCGGG - Intronic
1010044077 6:71420439-71420461 CGGCCGGCGGTGGCACCGGCGGG + Intergenic
1017995859 6:159531223-159531245 GGGCCAGGAGTGCCACCACCTGG - Intergenic
1018853985 6:167662668-167662690 CCGCCAGGTGTGGCTCCTCCTGG - Intergenic
1020238454 7:6374440-6374462 CGGGCGGGAGCGGCCCCGCCCGG + Intergenic
1022220790 7:28311698-28311720 CGGCCAGGCATGGCAGAGCCAGG - Intronic
1028417470 7:90595954-90595976 CGGCCGGGAGGGGCGCGGCCGGG + Intronic
1030270060 7:107661133-107661155 GGGCCAGGCGTGGAACCGTCAGG - Intronic
1032087285 7:128890875-128890897 TGGCCGGGAGGGGCACCGCCAGG + Intronic
1036704118 8:11033945-11033967 CAGCCAGGAATGGCAGAGCCAGG + Intronic
1040951267 8:52940660-52940682 CCGCCAGGATTGCCACCACCAGG - Exonic
1045324851 8:101110267-101110289 CAGCCTGGAGTGGCAAAGCCAGG - Intergenic
1046005352 8:108474772-108474794 CTGTCTGGAGTGGCACAGCCTGG + Intronic
1049394895 8:142395402-142395424 CTGCCTGGAGTGGCCCCGACTGG - Intronic
1056406705 9:86282284-86282306 CGGCCGGGAGTGGGGCCGCAGGG - Intronic
1058585248 9:106500844-106500866 CAGCCAGCAGTGGCAACCCCTGG - Intergenic
1059102316 9:111483249-111483271 CGGGCAGAGGTGGCTCCGCCCGG + Intronic
1060685301 9:125605571-125605593 AGGGCAGGAGTGGTACCGCACGG + Intronic
1061144153 9:128787398-128787420 TGGCCAGGAGTGGCCCAGCCGGG - Intronic
1061407597 9:130401050-130401072 CAGCCAGGAGAGGCAGTGCCAGG - Intronic
1061475915 9:130866208-130866230 CAGCCAGGAGTGGCAGCATCAGG + Intronic
1061570514 9:131475151-131475173 CGGCCAAAAGTGGCATGGCCAGG - Exonic
1061727424 9:132589468-132589490 CGGCCAGGGGGGGCAGCGGCGGG - Exonic
1062049011 9:134437689-134437711 CGGCCTGGAGTGGCTCTGCCGGG + Intronic
1062574429 9:137199864-137199886 TGGCTAGGAGTGGCACTGGCAGG + Exonic
1062601063 9:137318789-137318811 CGCCCAGGAGTCCCACCGCCTGG + Intronic
1062624193 9:137435563-137435585 CTACCTGGAGTGGCACGGCCTGG + Intronic
1188841542 X:35023854-35023876 TGTCCAGGAGAGGCACTGCCAGG - Intergenic
1190087730 X:47410314-47410336 CCGACAGGAGTGGCACAGACTGG + Exonic