ID: 950667014

View in Genome Browser
Species Human (GRCh38)
Location 3:14503751-14503773
Sequence AGGGCCCAGCGTTGGGCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950667006_950667014 -1 Left 950667006 3:14503729-14503751 CCTGAGGAGTCTTCGGGGCCCCA 0: 1
1: 1
2: 0
3: 6
4: 104
Right 950667014 3:14503751-14503773 AGGGCCCAGCGTTGGGCTCGAGG 0: 1
1: 0
2: 0
3: 8
4: 163
950666998_950667014 26 Left 950666998 3:14503702-14503724 CCTGGCAGGCGGGTGGGCGGGCT 0: 1
1: 1
2: 10
3: 55
4: 307
Right 950667014 3:14503751-14503773 AGGGCCCAGCGTTGGGCTCGAGG 0: 1
1: 0
2: 0
3: 8
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950667014 Original CRISPR AGGGCCCAGCGTTGGGCTCG AGG Intronic
900097762 1:947211-947233 AGGGCCCAGGGTCGGGGTCTGGG - Intronic
900154345 1:1198062-1198084 AGGGCCCAGCCATGGACTGGGGG - Intergenic
900316082 1:2057101-2057123 AGTGGCCAGCGTAGGGCCCGCGG + Intronic
900678178 1:3901234-3901256 AGGGTCCGGCGTCGGGCTGGGGG + Intergenic
901067148 1:6499600-6499622 AGGGCCCAGAGTGGGGCCTGTGG + Intronic
903907543 1:26696976-26696998 GGGGCCCCGCGTAGGGCTCCAGG - Exonic
903969457 1:27109411-27109433 AGGGCCCAGCCTTGAGCTCCAGG - Intronic
904674810 1:32192440-32192462 AGGCCCCAGGGTTGGGGTGGGGG + Intronic
905923549 1:41734359-41734381 ATGGCCCAGCGTTTGGCCCAGGG + Intronic
906401656 1:45509042-45509064 AGGGCCAATCGTTGGGCAGGTGG - Exonic
906691865 1:47798054-47798076 CGGGCCCTGTGTTGGGCTAGGGG + Intronic
912924822 1:113904908-113904930 AGAGCCTAGGGTGGGGCTCGCGG - Exonic
915475571 1:156150874-156150896 AGGACCCAGGGCTGGGCTCCAGG + Intronic
916046708 1:161005385-161005407 AGGGCCCAGTGTTGGCCTGCTGG + Intronic
920697475 1:208192226-208192248 AGGGCCCAGAGGTGGGCCAGAGG - Intronic
922749014 1:228062148-228062170 AGGGCCCAGAGATGGGCATGGGG - Intergenic
1067155773 10:43780136-43780158 TAGGCCCAGCCTTGGGCTCCTGG + Intergenic
1067284112 10:44894971-44894993 TGGGCACAGCGCTGGGCCCGCGG - Intergenic
1075272331 10:121063098-121063120 AGTGCCCAGCATTGGGCTGAGGG - Intergenic
1076445773 10:130512817-130512839 AGGGCCCAGAGTCTGGCTTGTGG + Intergenic
1076451080 10:130557412-130557434 GTGTCCCAGCTTTGGGCTCGTGG + Intergenic
1076705917 10:132301514-132301536 AAGGCCCCGCAGTGGGCTCGGGG + Intronic
1076792299 10:132784098-132784120 AGCGCCCAGCCGGGGGCTCGGGG - Intergenic
1081998308 11:47378268-47378290 AGGGCCACGGGTTGGGCTGGTGG + Intronic
1083087846 11:60168737-60168759 GGGCCCCAGGGTTGGGCTTGGGG - Intergenic
1084327583 11:68410694-68410716 GGGGCCCTGCCTTGGGCACGGGG + Intronic
1089386449 11:118071271-118071293 AGGGCTCAGGGTTGGGATCCAGG + Intergenic
1090435568 11:126683979-126684001 AGGGCCCAGGGTTTGGCTCCGGG + Intronic
1091277327 11:134361409-134361431 AGGCGCCAGCGTGGGCCTCGCGG + Intronic
1091550067 12:1530332-1530354 AGGGCCCGGCGCTGGGCGAGTGG - Intronic
1101612182 12:106302452-106302474 AGCGCCCGGCGTTGGGGGCGGGG - Intronic
1104013173 12:124946571-124946593 ATGGCCCTGCCTTGGGCTCCTGG + Intergenic
1104959052 12:132479579-132479601 GGGGACCAGCCTTGGGCTCCGGG - Intergenic
1108747279 13:53408801-53408823 AGGGCCCAGAAGTGGGGTCGTGG + Intergenic
1112466826 13:99652178-99652200 AGGGCCCACCCTTTGGCTCTGGG + Intronic
1113902020 13:113802810-113802832 GGGGCCCAGGGTGGGGCTTGGGG - Intronic
1114952954 14:27780117-27780139 ATGGCCCAGCTTTGGTCTCTGGG - Intergenic
1120173607 14:81270992-81271014 AGGGTCCAGTGTTGAGCACGAGG + Intronic
1121020619 14:90578077-90578099 AGGGGCCACCGCCGGGCTCGTGG + Intronic
1122897755 14:104768895-104768917 AGGGCCCAGAGTTGGGGCCAAGG - Intergenic
1122902422 14:104787331-104787353 GGGCCCCAGCGCTGGGCTGGGGG + Intronic
1123031855 14:105455737-105455759 GGGCTCCAGCATTGGGCTCGTGG + Intronic
1123058300 14:105582780-105582802 AGGGCCCAGCGATTGGGTCCAGG + Intergenic
1123797236 15:23783980-23784002 AGGGCCCAGCACTGGGATTGAGG + Intergenic
1124087480 15:26564495-26564517 AGGGCTCACCCTTGGGCTCTGGG - Intronic
1124834792 15:33186036-33186058 AGGGCCCAGCCTTGGGAAGGAGG - Intronic
1128227533 15:66012716-66012738 AGGGCCCAGTTTAGGGCTTGTGG - Intronic
1128243514 15:66117588-66117610 AGGGCCCAGTGATGGACTCAGGG - Intronic
1129413196 15:75361002-75361024 AGGGCCCAGGGTGGGGCTAAAGG + Intronic
1131157822 15:90085570-90085592 AGGGCCCAGCACAGGGCTGGAGG + Intronic
1131266120 15:90916316-90916338 GGGGTCCAGCCTAGGGCTCGAGG + Intronic
1131303873 15:91224136-91224158 AGGGCCCAGGGATGGGCTGTGGG + Intronic
1132178467 15:99733550-99733572 AGGGCCCGGGGCGGGGCTCGGGG + Intronic
1132286335 15:100665766-100665788 AGGGGCCAGGGTTGAGCTCTTGG - Intergenic
1135150537 16:20001557-20001579 AAGGCCCAGAGATGGGCTCTCGG - Intergenic
1135548419 16:23380666-23380688 AGGGCCCAGTGTTGGGGCTGCGG - Exonic
1136290515 16:29268670-29268692 CGGGCCCAGCGTGGGGCTCCAGG - Intergenic
1138458126 16:57132894-57132916 AGGGCCCAGCCTTGCGGTCAGGG - Intronic
1141431506 16:83972539-83972561 AGGGCCTAGCGTGAGGCTGGCGG - Intronic
1142096397 16:88242190-88242212 AGGGCCCAGTGTGGGGCTCCAGG - Intergenic
1142188957 16:88708527-88708549 AGGACCCAGCTTTGGGCGTGGGG - Intronic
1142261036 16:89042540-89042562 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261046 16:89042573-89042595 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261056 16:89042606-89042628 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261066 16:89042639-89042661 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261076 16:89042672-89042694 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142300816 16:89256932-89256954 CGGGCCCAGGGTGGCGCTCGGGG + Intergenic
1142967638 17:3591163-3591185 TGGCCCCAGCGCTGGGCTCGGGG - Intronic
1143090446 17:4446617-4446639 AGGGCCCAGCCTTGGGCAGGAGG + Intronic
1144849278 17:18235846-18235868 AGAGCCCAGCGTGGGCCTGGCGG + Intronic
1145911924 17:28548054-28548076 AGCGCCCAGCATTGGGGTCCAGG + Exonic
1145977279 17:28991611-28991633 AGAGCCCAGGGTGGGGCTCCTGG + Intronic
1148053288 17:44779648-44779670 AGGGCCCAGCACTGAGCTCCGGG + Intronic
1148904922 17:50905772-50905794 AGGGCCCAGGTTTGGGGTCTGGG + Intergenic
1151783436 17:76262883-76262905 AGGGCCCAGCTGTGGGCACCTGG - Intergenic
1152003459 17:77662074-77662096 AGGGCCCAGCTTTGGGCCCCAGG - Intergenic
1152561675 17:81081830-81081852 AGGGCCCAGCGATGGCCCCCTGG - Intronic
1155168524 18:23249916-23249938 AGGGGCCAGCGCTGGGATCCTGG - Intronic
1158954153 18:62523573-62523595 AGGGCCCCGCGACGGGCCCGCGG - Exonic
1161809641 19:6464566-6464588 AGGCCCAGGCGTTGGGATCGGGG - Intronic
1162070866 19:8151453-8151475 GGGCCCCAGGGCTGGGCTCGGGG + Intronic
1162468081 19:10854751-10854773 AGGGTCTACCGTTGGGCTGGGGG + Intronic
1165757965 19:38305055-38305077 CGGGCCCAGCGCTGGGCAGGGGG - Intergenic
1166767299 19:45259197-45259219 TGGGCACAGGGTGGGGCTCGGGG + Intronic
1166939363 19:46353499-46353521 AGTGCCCAGCTTGGGGCTGGAGG + Intronic
1167502049 19:49854030-49854052 TGGGCCCAGCCTGGGGCACGGGG + Intronic
925147196 2:1589105-1589127 AGGGTCCAGCCTTGGCCTTGTGG - Intergenic
925196562 2:1930602-1930624 AGGGCACAGCGCTGGGCTGCTGG + Intronic
925592740 2:5526422-5526444 GGGGCCCAGGGTTGGGCCTGGGG - Intergenic
926334137 2:11850455-11850477 AGGGCCCAGTGTGTGGCTCGGGG + Intergenic
926669234 2:15560828-15560850 AAGGCACAGCGCTGGACTCGAGG - Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
934484364 2:94689318-94689340 ATGGCCCAGCTTTGGTCTCTGGG + Intergenic
935681164 2:105638444-105638466 CAGGCCCAGCATTGGGCTTGTGG + Intergenic
937046113 2:118852885-118852907 GGGGCCCTGCGTCGGGCTCCCGG - Intergenic
946179567 2:217941490-217941512 AGGGCAGAGCGTCGGGCTCTTGG + Intronic
946434313 2:219641792-219641814 AGAGCCCAGCCCTGGGCTGGGGG + Exonic
947722384 2:232377962-232377984 GGGGCCAAGCCTGGGGCTCGGGG + Intergenic
948824275 2:240566802-240566824 AGAGCCCCGCATTGGGCTCAGGG - Intronic
948915306 2:241031654-241031676 AGGGCCCATGGTGGGGCTCTGGG - Intronic
949014805 2:241702863-241702885 TGGGCACAGCTTTGGGGTCGCGG + Intronic
1169758756 20:9068820-9068842 AGGGCCCGGCGGTGGGCGGGCGG + Intronic
1171453204 20:25250296-25250318 AGAGGCCAGCGATGGGCTCAGGG + Intronic
1172778229 20:37420390-37420412 AGGGCCCCGCTTTGTGCTCCTGG + Intergenic
1172847453 20:37938393-37938415 AGGGCCCAGCCTGGGGCAGGAGG + Intronic
1173497995 20:43532933-43532955 AGGGCCCAGACTTGGCCTCAGGG + Intronic
1173626380 20:44476000-44476022 AGGGCACACGGATGGGCTCGCGG - Intronic
1174305618 20:49612382-49612404 AGGGACCAGCCTTGGGCTTCCGG - Intergenic
1174356209 20:49999560-49999582 AAGACCCAGCGCTGGGCACGGGG + Intergenic
1176247000 20:64102206-64102228 CGGGCCCAGCCTTGGGCCCCGGG + Intergenic
1176268459 20:64222987-64223009 AGGGGCCACCGCTTGGCTCGCGG + Intronic
1176305864 21:5122854-5122876 AGAGCCCAGGGGTGGGTTCGTGG - Intronic
1178933260 21:36838151-36838173 GCGTCCCAGCGTTGGGCTCCAGG - Intronic
1179851193 21:44139177-44139199 AGAGCCCAGGGGTGGGTTCGTGG + Intronic
1180089999 21:45529102-45529124 AGAGCCCAGTGTGGGCCTCGGGG + Intronic
1180948374 22:19709083-19709105 AGAGCTCAGCGCTGGGCTCCAGG - Intergenic
1181323391 22:22025820-22025842 AGGGCCCAGGGTAGGGGTCCAGG - Intergenic
1182526295 22:30922475-30922497 ATGGCCAAGCGCTGGGGTCGTGG + Intergenic
1183197753 22:36365069-36365091 AGCTCCCAGAGCTGGGCTCGGGG + Intronic
1183346354 22:37310430-37310452 ATGGCCAAGAGTTGGGCTCTGGG + Intronic
1183665473 22:39243774-39243796 AGCGCCCGGCGTCAGGCTCGCGG + Intronic
1183788068 22:40043288-40043310 AGAGTCCAGCGTTGTGCTCCTGG + Exonic
1183948523 22:41340021-41340043 GGGGTCCAGCGTGGGGCCCGGGG - Exonic
1185214042 22:49588279-49588301 AGGGTCCAGGGTGGGGCTGGGGG - Intronic
950667014 3:14503751-14503773 AGGGCCCAGCGTTGGGCTCGAGG + Intronic
953718458 3:45335425-45335447 AGAGTCCAGCCTTGGGCTCCAGG - Intergenic
960794814 3:121474255-121474277 AGGGCCCAGCATTGTGGTGGTGG - Intronic
962849167 3:139295090-139295112 AGGGCTCAGCGCTGGACTCCAGG - Intronic
968552502 4:1230872-1230894 AGGGCCCTCCTTTGGGCTCCGGG + Intronic
968949556 4:3683520-3683542 CAGGCCCAGCGTGGGGCCCGCGG - Intergenic
969319411 4:6402711-6402733 AGGGCCCAGCCTGGGGATCAGGG + Intronic
970001380 4:11368980-11369002 AGGGCCTAGCGTTGGGGGCTTGG - Intergenic
972785324 4:42321230-42321252 TTGGCCCAGCTTTGGGCTTGTGG + Intergenic
975207714 4:71663684-71663706 AGGGCCTAGAAGTGGGCTCGTGG - Intergenic
977400449 4:96524653-96524675 AGTGTCCAGTGTCGGGCTCGGGG + Intergenic
986560212 5:9053263-9053285 AGGAGCCAGCCTTGGGCCCGTGG - Intronic
987281183 5:16415095-16415117 AGGGCCCAGCTATGAGCTCCAGG + Intergenic
997212725 5:132086929-132086951 ATGGCCCAGGGTATGGCTCGAGG - Intergenic
998162478 5:139821447-139821469 AGGGGCCAGAGTTGGGCCTGGGG + Intronic
998163510 5:139827116-139827138 AGGGCCTAGCCCTGGGCTAGAGG + Intronic
1001399265 5:171437133-171437155 AGGCCCCAGCCTTGGGCCTGGGG + Intronic
1002530574 5:179842125-179842147 AGGCCCAAGAGTTGGGCTAGGGG - Intronic
1002593539 5:180307081-180307103 AGGGCAGGGCGTTGGGCTTGGGG - Intronic
1002939162 6:1700762-1700784 AGGTCCCAGTGCTGGGCCCGAGG - Intronic
1006096690 6:31660704-31660726 CGGGCCCAGCGTCGGGGCCGCGG + Exonic
1007304188 6:40891613-40891635 AGAGCCCAGGGCTGGGATCGTGG - Intergenic
1007371487 6:41429152-41429174 AGGTCCCAGCTCTGGGCTCTGGG + Intergenic
1019140296 6:169938438-169938460 AGGGCCCAGCATAGGGCTTTGGG - Intergenic
1020094518 7:5361159-5361181 AGGGGCCAGCCCTGGTCTCGGGG + Intronic
1020125542 7:5530871-5530893 ACTGCCCAGCGTGGGGCGCGGGG - Intronic
1020130239 7:5555387-5555409 CGGGCCCGGCGTGGGGGTCGCGG - Intronic
1023512585 7:40969028-40969050 AGTGCCCTGAGTTGGCCTCGTGG - Intergenic
1026802912 7:73411101-73411123 AGCCCCCAGCCTTGGGCTAGGGG - Intergenic
1026959319 7:74398570-74398592 AGGGCCCAGCCCTGGGCAAGGGG + Intronic
1035267737 7:157700864-157700886 CTGGCTCAGCGGTGGGCTCGGGG + Intronic
1035404321 7:158587979-158588001 AGGGCCGGGCGTGGGGCTCCGGG - Intergenic
1035451578 7:158980435-158980457 GGGGTCCAGGGTTGGGCTCCAGG - Intergenic
1035751951 8:2002480-2002502 GGGGCCCAGCGGTCGGCGCGCGG - Exonic
1038828458 8:31032881-31032903 CGGGCCCGGCGTGGGGGTCGCGG - Exonic
1039475527 8:37837594-37837616 AGGGCACAGTGCTGGGCTGGGGG - Intronic
1043356994 8:79425344-79425366 AGGGCCCAGAGTTGAGGTTGAGG - Intergenic
1048572807 8:135669248-135669270 AGGGGGCAGCGTTGGGATGGAGG + Intergenic
1049154209 8:141056983-141057005 AGGGCTCAGTGCTGGGCACGAGG + Intergenic
1049289148 8:141792316-141792338 AGGGCCCTGGCTTGGGCTCCAGG + Intergenic
1049434214 8:142579094-142579116 AGGGCCTGGCCTGGGGCTCGGGG - Intergenic
1049774756 8:144399106-144399128 GGTGCCCAGGGTTGGGGTCGGGG - Exonic
1059373080 9:113859075-113859097 AGGCTCCAGAGTTGGGCTCCTGG + Intergenic
1060358242 9:122931172-122931194 AGGGCCCAGCAGTTGGCTTGGGG - Intronic
1062194812 9:135267109-135267131 AGGACCCAGACTTGGGCTCCCGG - Intergenic
1062342575 9:136100326-136100348 AGGGCCCAGGGTGAGGCTGGTGG - Intergenic
1185626197 X:1484051-1484073 AGGGCCCAGCTTTGGGTTTAGGG - Intronic
1199393693 X:147309760-147309782 AGGGCCTAGGCTTGGACTCGTGG - Intergenic