ID: 950667421

View in Genome Browser
Species Human (GRCh38)
Location 3:14505849-14505871
Sequence CACTCAGCACAGCTGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950667421_950667431 7 Left 950667421 3:14505849-14505871 CCCATTTCCAGCTGTGCTGAGTG 0: 1
1: 0
2: 0
3: 22
4: 194
Right 950667431 3:14505879-14505901 GGAGGTCGTTGCTCCTCTCTGGG 0: 1
1: 0
2: 0
3: 15
4: 164
950667421_950667430 6 Left 950667421 3:14505849-14505871 CCCATTTCCAGCTGTGCTGAGTG 0: 1
1: 0
2: 0
3: 22
4: 194
Right 950667430 3:14505878-14505900 GGGAGGTCGTTGCTCCTCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950667421 Original CRISPR CACTCAGCACAGCTGGAAAT GGG (reversed) Intronic
900619220 1:3579377-3579399 ACCGCAGCACAGCTGTAAATGGG - Intronic
900918783 1:5657784-5657806 CACTCTGCTCATCTGGAAATGGG + Intergenic
901269037 1:7936125-7936147 CACTGTGCCCAGCTGGAAAGTGG - Intronic
901294195 1:8147835-8147857 CACTCAGCCTGGCTGGAAAATGG - Intergenic
901850599 1:12012465-12012487 CACACAGGACAGCTGGAGAATGG + Exonic
902098213 1:13963892-13963914 CAGATAGCACAGCTGGCAATTGG - Intergenic
903019815 1:20386161-20386183 TCCTCAGCACAGCTGTAAAAGGG + Intergenic
907377441 1:54055252-54055274 CACTGTGCCCAGCTGGAAAGAGG + Intronic
908400756 1:63771021-63771043 CACTAACCACAGCATGAAATAGG + Intergenic
908645583 1:66274459-66274481 CACTGCGCCCAGCTGAAAATGGG + Intronic
911035846 1:93546410-93546432 CACTCACCTCTGCTAGAAATAGG - Intronic
911244666 1:95503834-95503856 CATCCAGCTCAGTTGGAAATGGG - Intergenic
912562853 1:110562677-110562699 CAATTAGTAGAGCTGGAAATTGG - Intergenic
914784462 1:150816114-150816136 CTCTCAACAAAGATGGAAATTGG + Intronic
917482099 1:175421107-175421129 CAAGCAGCAGAGCTGGACATGGG + Intronic
919243082 1:194939890-194939912 GGCTCAGCCGAGCTGGAAATGGG + Intergenic
920358758 1:205397028-205397050 AAATCAGCACAGTTAGAAATGGG - Intronic
920963942 1:210686904-210686926 CACTTCAAACAGCTGGAAATTGG - Intronic
921187812 1:212684977-212684999 CAGTCAGGACAGCTGGATTTTGG + Intergenic
922506463 1:226128843-226128865 CACACAGGACAGCTGGAGAGGGG + Intergenic
922715682 1:227870006-227870028 CACTCACCACAGCTGGCACAGGG - Intergenic
1062971878 10:1654517-1654539 CACACTGCACAGGTGGAAAGAGG - Intronic
1063146330 10:3298180-3298202 CAGACAGCAGAGGTGGAAATGGG + Intergenic
1063209058 10:3862208-3862230 CACTCAACACTGCTGGCCATTGG + Intergenic
1063757909 10:9036643-9036665 CACCCAGAGCACCTGGAAATGGG + Intergenic
1067764518 10:49075083-49075105 CACTGTGCACAGGTGCAAATGGG + Intronic
1069067959 10:63964457-63964479 CACTAAGCACATGAGGAAATAGG - Intergenic
1070855154 10:79602891-79602913 CACCCAGGGCAGCTGGAAAAGGG + Intergenic
1073410830 10:103340552-103340574 CACTAATCACAGCAGGAACTTGG - Intronic
1074569355 10:114610636-114610658 CACTTGCCACAGCAGGAAATGGG - Intronic
1075061852 10:119262173-119262195 CAATCAGCCCACCAGGAAATAGG + Intronic
1075934203 10:126325626-126325648 CACTCAAGGAAGCTGGAAATTGG + Intronic
1076301089 10:129426878-129426900 CACTCAGAGCAGCTGCAAAGAGG - Intergenic
1078967217 11:16359908-16359930 CACTTAGCTCATCTGCAAATGGG - Intronic
1081661805 11:44892998-44893020 CACACAGCACAGCTAGAACGAGG - Intronic
1081953902 11:47072012-47072034 AACTCAGCAAAACTGCAAATGGG - Intronic
1082105472 11:48216857-48216879 CACTCTGCACAGCTGGATCCTGG - Exonic
1086359849 11:86047171-86047193 CACTCAGACCACATGGAAATGGG - Intronic
1086491290 11:87360017-87360039 CAAGCAGCACAGCTGCCAATGGG - Intergenic
1087132922 11:94684394-94684416 CCATCAGCACACCTGGTAATAGG + Intergenic
1088112454 11:106277900-106277922 CCCTCAGCACAGCTGGTACTTGG - Intergenic
1091330968 11:134730565-134730587 CACCCAGCACACCTGGAAAGAGG - Intergenic
1092565420 12:9660037-9660059 AACTCACTCCAGCTGGAAATAGG + Intergenic
1094371901 12:29748175-29748197 CAGATAGCACAGCTGGAATTGGG - Intronic
1098520176 12:71426498-71426520 CCCTCAGGATTGCTGGAAATGGG - Intronic
1101336167 12:103798993-103799015 CAGTTACCTCAGCTGGAAATGGG - Intronic
1104191930 12:126490325-126490347 CATACTGCACAGCTGGAAACAGG + Intergenic
1104381513 12:128311983-128312005 CTTTCAGCACAGCTGGAAGTTGG - Intronic
1104963130 12:132497632-132497654 CACTCAGCTCATCTGGACAGGGG - Intronic
1107390430 13:39957458-39957480 CACTCAGCTCAGCTAGAAGGAGG + Intergenic
1107920024 13:45196841-45196863 GAGTCAGGACAGCTGGAAGTGGG + Intronic
1110241000 13:73266663-73266685 CCTTCAGCACAGCTGAAATTGGG + Intergenic
1110524335 13:76518282-76518304 AACTCTGCACGGCTGGAAAGTGG - Intergenic
1110779785 13:79451639-79451661 CCCTCAGCAGAGCTGAAAACTGG + Intergenic
1114182372 14:20377652-20377674 CACTCAGCCCAGATGGTGATCGG - Exonic
1114985144 14:28217481-28217503 TAATCACCACAGCTGGAAATGGG + Intergenic
1117497691 14:56321817-56321839 TTCTCAGCACAGGAGGAAATGGG - Intergenic
1117931689 14:60849659-60849681 CACTAAGCACAGGTGGACAGTGG + Intronic
1120814710 14:88843282-88843304 TACTCAGCTAAGCTGGACATTGG - Intronic
1123760478 15:23428088-23428110 CACTCATCACAGCTGCAATCTGG - Intergenic
1124342902 15:28901467-28901489 CCTTCAGCACAGCTGGGATTTGG + Intronic
1124345993 15:28922069-28922091 CACTCAGTGCAGCTGGGAAAAGG - Intronic
1125477720 15:40058695-40058717 CAGTCAGCAAAGCTGGGAGTCGG + Intergenic
1125649336 15:41301439-41301461 AATTCAGCACATTTGGAAATAGG - Intergenic
1126226024 15:46270715-46270737 CACTCAGCAGTGATGGACATAGG + Intergenic
1126427133 15:48540024-48540046 CACTCAGCACTGCAGTAATTTGG + Intronic
1126812171 15:52418149-52418171 AACTCAGCTTAGCTGGAAAATGG + Intronic
1127532827 15:59861877-59861899 CACAAAACAGAGCTGGAAATGGG + Intergenic
1128718355 15:69926913-69926935 CACTCACAACAGCTGGGAGTTGG + Intergenic
1128892078 15:71340483-71340505 CTCCCAGCACAGCGGAAAATGGG - Intronic
1129760308 15:78125359-78125381 CAGTCAGCAGAACTGGAAATGGG + Intronic
1129894728 15:79094807-79094829 CAGTCCCCACAGCTGGAAACCGG + Intergenic
1130298231 15:82662161-82662183 CACATACCACAGCTGGAAGTTGG + Exonic
1130744452 15:86635919-86635941 GAGTCAGCACAGTTGGAGATAGG + Intronic
1133405768 16:5523325-5523347 CACCGCGCCCAGCTGGAAATTGG - Intergenic
1134033801 16:11014291-11014313 CACACAGCACAGCTGTGAAAAGG - Intronic
1138302651 16:55945475-55945497 CCAGCAGCACAGCTGCAAATTGG + Intronic
1138393888 16:56689879-56689901 TACCCAGCACACCTGCAAATAGG + Intronic
1140548633 16:75838010-75838032 CACTCAGCACTGATGAAACTTGG - Intergenic
1140728524 16:77835443-77835465 GACTCAGCACAGCTGGACCATGG - Intronic
1141635082 16:85310264-85310286 CACTTTGCACATCTGGAAATGGG + Intergenic
1141829819 16:86503996-86504018 CACTTAGCACAGATGGGACTGGG - Intergenic
1143085356 17:4412129-4412151 CACACATCAAAGGTGGAAATGGG - Intergenic
1146268834 17:31471351-31471373 CACTGCGCCCAGCTGGAAATGGG + Intronic
1148317878 17:46720092-46720114 CAAAGAGCAGAGCTGGAAATTGG + Intronic
1148830389 17:50426884-50426906 CACTGAGGACAGAAGGAAATAGG - Intronic
1151735507 17:75937632-75937654 CAGTGAACACAGGTGGAAATTGG + Intronic
1152653224 17:81506280-81506302 GGCTCAGCACAGCTGGGGATTGG - Intergenic
1153333510 18:3898603-3898625 CATACAGCACAGCTGGGGATGGG + Intronic
1156703395 18:39851392-39851414 GAGTCAGCACAGTCGGAAATAGG - Intergenic
1157756004 18:50218395-50218417 AGTTCAGCACAGCTGGATATGGG + Intergenic
1159044842 18:63359679-63359701 AACTCAGCACAGCTGTATAAAGG - Intronic
1160247555 18:77171014-77171036 CACTCAGCAAAGCAATAAATTGG - Intergenic
1160628253 18:80228172-80228194 CTCTGAGCACAGCTGGAAAAGGG + Intronic
1160812298 19:1018057-1018079 GACTCAGCACCCCTGGACATGGG - Intronic
1161994786 19:7705591-7705613 CACTGTGCCCAGCTGGAATTTGG + Intergenic
1163176654 19:15569029-15569051 CACTCAGAACACCTGGAAGTGGG + Intergenic
1163477040 19:17532555-17532577 CACCCAGCACAGCAGGGGATGGG - Intronic
1164285366 19:23810723-23810745 CTCTCAGCATAGCTATAAATGGG + Intronic
1165426591 19:35749228-35749250 CTCTGATCACTGCTGGAAATGGG - Intronic
1165447181 19:35862695-35862717 CCCTGTGCAGAGCTGGAAATGGG - Intronic
1166265184 19:41677327-41677349 CAGTCAGCCCTGCAGGAAATAGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
1202645744 1_KI270706v1_random:139674-139696 CACTGTGCTCAGCTGAAAATAGG - Intergenic
925052718 2:829768-829790 CACTATGCAGAGCTGGAAAAGGG - Intergenic
925577237 2:5373121-5373143 CACTCACAACAGCCGGAAAGGGG - Intergenic
925595110 2:5547844-5547866 CACTCAGCCCATCCTGAAATAGG - Intergenic
925669580 2:6296867-6296889 GACCCAGCACAGATGAAAATGGG + Intergenic
928391996 2:30917375-30917397 CCCTCAGCACTACTGGTAATAGG - Intronic
931794950 2:65700287-65700309 CACTGAGAAAAGGTGGAAATTGG + Intergenic
933782554 2:85812415-85812437 CACTTGGCAGAGCTGGAACTGGG - Intergenic
933898720 2:86834141-86834163 CACTCAGCACTCCTGGGAATGGG - Intronic
934676731 2:96254610-96254632 CACTCAGCCCAGCTGTAGAGGGG - Intronic
937255927 2:120555604-120555626 GACCCAGCACAGCTGGGATTTGG + Intergenic
942516189 2:176755705-176755727 CAGTAAGCACAGCTGTAGATAGG - Intergenic
943670557 2:190655789-190655811 CACTTAGCACAGTTGGAATCTGG + Intronic
943757704 2:191574250-191574272 CACTGAGCACTTCTAGAAATGGG - Intergenic
944465630 2:199997015-199997037 GAATCAGCAAGGCTGGAAATAGG + Intronic
944744216 2:202639077-202639099 CATTCATCACAGCTGCAAACTGG - Intronic
946994076 2:225371048-225371070 GCCTCAGCACAGCTGGATCTAGG - Intergenic
947792796 2:232877387-232877409 TGCTCAGCACAGCAGGAAGTGGG + Intronic
1169308766 20:4517551-4517573 CCCTCAACACAGCAGGAAATGGG + Intergenic
1170818966 20:19739782-19739804 CACACAGCAGAGTGGGAAATGGG - Intergenic
1171087379 20:22250394-22250416 CTCACAGCACACCAGGAAATTGG + Intergenic
1171431536 20:25085945-25085967 CACTCACAACAGCTGGAAGAAGG - Intergenic
1171908590 20:30921353-30921375 CACACACCACAGCTGGACTTCGG - Intergenic
1172083155 20:32358431-32358453 CCCTCAGCAGAGCGGGAAAGCGG + Exonic
1174446495 20:50594552-50594574 TACCCAGGACAGCTGGAAATAGG - Exonic
1174690605 20:52500477-52500499 CTCTCAGCAGAGCTGTAAACCGG - Intergenic
1176025759 20:62984802-62984824 CACTCAACAAAGCTGGATCTTGG + Intergenic
1178670213 21:34583419-34583441 CACCCACCTCAGCTGGAGATAGG + Intronic
1182750345 22:32636626-32636648 CACTCAGTATAGTTGGAACTGGG + Intronic
1183143833 22:35971083-35971105 CACTCTGCACAGCTTAAAAGAGG - Intronic
1183246474 22:36697559-36697581 CATTCAGCTCACCTGGAAAGAGG + Intronic
1184533863 22:45073192-45073214 TCCTCAGCACAGCTTGTAATTGG + Intergenic
1184991900 22:48176036-48176058 CACCCAGCTCAGCTGCAAAGTGG + Intergenic
950667421 3:14505849-14505871 CACTCAGCACAGCTGGAAATGGG - Intronic
951394900 3:22153286-22153308 CACTCAGCCCAGCAGGTGATAGG - Intronic
951522678 3:23624070-23624092 TCCTCAGCAGAGCTGGACATAGG - Intergenic
953436915 3:42884709-42884731 CAGGCAGCACAGCAGGAAATGGG - Intronic
953864634 3:46573628-46573650 CTCTCAGAACAGCTGGAAGCTGG + Intronic
957424061 3:80013895-80013917 CACTCAGTACAGGTAGAAATCGG + Intergenic
957453764 3:80414717-80414739 CACTCACAGCAGCTGTAAATCGG - Intergenic
958612982 3:96451576-96451598 CACTCAGAACAGCTGGGGATTGG - Intergenic
961052138 3:123755947-123755969 CACTCACAGCAGCTGGGAATGGG + Intronic
962025589 3:131543946-131543968 GACTCAGCAGAGATGGGAATTGG + Intronic
963222920 3:142830933-142830955 CACTCAGCACAGCTGACAGTAGG - Intronic
963490726 3:145996912-145996934 CAGTCAGCATCTCTGGAAATGGG - Intergenic
968108733 3:196024132-196024154 CACTCAGCATTGCTGGATGTCGG - Intergenic
969905093 4:10386440-10386462 CACTCCCCACAGCAGGGAATGGG - Intergenic
971292637 4:25359100-25359122 CAAGCAGCACAGCTGACAATGGG - Intronic
973920716 4:55682168-55682190 CTCTCAGCAAAGGTGGGAATGGG - Intergenic
974165140 4:58191575-58191597 CACCCAGCAGAGCTGGTACTGGG - Intergenic
975476898 4:74833854-74833876 AAATCAACACAGCTGGAAAGTGG - Intergenic
977828439 4:101561120-101561142 AACTCAGAACTGCTGGAAAATGG + Intronic
978167232 4:105623899-105623921 CACTCAGTACATCTGGCCATGGG - Intronic
979782377 4:124669258-124669280 CCTTCAGCTCAGCAGGAAATTGG - Exonic
980282346 4:130737624-130737646 CACCCAGCACAGATGGAGAGTGG - Intergenic
980562630 4:134497802-134497824 ATCTCAGCACACCTGTAAATAGG - Intergenic
982023398 4:151227987-151228009 CAGTCTGCACAGCTGGAATGTGG + Intronic
985470502 5:40360-40382 CACTCAGCATTGCTGGATGTCGG - Intergenic
986599470 5:9457311-9457333 CACTCTGCACAGGTAGAAATTGG - Intronic
992715413 5:79506410-79506432 CACTCAGGACAGACGGAAAAAGG + Intronic
993565643 5:89471493-89471515 TACTCAGTACAGCATGAAATAGG - Intergenic
993901866 5:93589413-93589435 CACCCAGGACAGCAGGTAATGGG + Intronic
998128233 5:139638230-139638252 CACTCAGCTGAGCAGGGAATGGG - Intergenic
1000494081 5:161956462-161956484 CACCCAGAACAGCTGTAGATAGG + Intergenic
1000991515 5:167916515-167916537 CACACAGTTCAGCAGGAAATTGG - Intronic
1001939040 5:175728295-175728317 CAATTAGCTCAGCTGGTAATTGG - Intergenic
1002424047 5:179165501-179165523 CCCTCAGCACAGCTAGGAACAGG - Intronic
1004146555 6:13072863-13072885 CACTCAGCAGGGCTGGAAGATGG + Intronic
1004219361 6:13732434-13732456 TACTCAGCACACTAGGAAATTGG - Intergenic
1008156307 6:48019195-48019217 CACACAGCACAGGTGGAAAGAGG + Intronic
1011386292 6:86801972-86801994 TAGCCACCACAGCTGGAAATAGG + Intergenic
1014185832 6:118433114-118433136 CAATGAGAACAGATGGAAATAGG + Intergenic
1016641827 6:146358530-146358552 CTCACAGCACAGCTGGAGCTGGG + Intronic
1016882425 6:148923862-148923884 CCCTCAGCCCAGCTGAAAACAGG - Intronic
1017956543 6:159182949-159182971 CACACAGCAGAGCTGGCATTTGG - Intronic
1022990489 7:35702544-35702566 CACTGGGCACTGCTGGAACTGGG - Intergenic
1024558649 7:50625219-50625241 CACTCAGGACACATAGAAATTGG - Intronic
1025615437 7:63113291-63113313 AGGGCAGCACAGCTGGAAATGGG + Intergenic
1028201218 7:87964145-87964167 AGCTCAGAAGAGCTGGAAATAGG - Intronic
1031105038 7:117530314-117530336 CACAAAGCAGAGCTGGGAATGGG - Intronic
1032125928 7:129192844-129192866 TTCTCAGCAGATCTGGAAATAGG + Intronic
1032755776 7:134889370-134889392 CTCTAACCACAGCTGGAAAGGGG + Intronic
1032783731 7:135184650-135184672 CACTCAGCTCAGCTACAGATCGG + Exonic
1033922660 7:146413439-146413461 CACTATACATAGCTGGAAATAGG + Intronic
1034096800 7:148416273-148416295 CAATCAGCACAACTGGAGAGAGG + Exonic
1034296437 7:149976878-149976900 AAGTCAGCAGGGCTGGAAATCGG + Intergenic
1034521784 7:151625982-151626004 GACTCAGCACAGCTGGCTGTGGG + Intronic
1034809593 7:154119939-154119961 AAGTCAGCAGGGCTGGAAATCGG - Intronic
1036514800 8:9433967-9433989 CTCTCAGGAGAGCTGGAATTAGG - Intergenic
1037487885 8:19365657-19365679 AACTGAGCACAGCTGAAAATAGG - Intronic
1038242024 8:25818755-25818777 GACTCATCAGAACTGGAAATTGG + Intergenic
1038310892 8:26445507-26445529 CAATCAGGACAGCTGGGAAGAGG - Intronic
1041322515 8:56628435-56628457 CACTAAGCACTGCTGTAATTGGG + Intergenic
1048321463 8:133403747-133403769 CCCCCAGCCCAGCAGGAAATGGG - Intergenic
1049947764 9:614352-614374 CACTCCTCAAAGATGGAAATGGG - Intronic
1050741019 9:8821352-8821374 CATTCAGCACAGCAGGTAACAGG - Intronic
1053347991 9:37392247-37392269 CAGTCCTCACAGCTGGACATGGG + Intergenic
1059492634 9:114681847-114681869 CATTCAGCACAGGTGGAGACTGG + Intergenic
1059662557 9:116416412-116416434 CACTCAGCACATCTGTAATTGGG - Intergenic
1059701235 9:116777067-116777089 CACACAGCACAGCTTGAATCAGG - Intronic
1061076379 9:128343889-128343911 GACACAGCACATCTGTAAATTGG + Intronic
1061277921 9:129580107-129580129 AACTCAGCAGAGCTGAGAATTGG + Intergenic
1062286497 9:135775268-135775290 CCCTCAGCACAGCTGCACAGAGG - Intronic
1186103000 X:6176508-6176530 CAGTCAGCAGACCTCGAAATGGG + Intronic
1188372622 X:29387341-29387363 AACTCAGCACATTTAGAAATGGG - Intronic
1190305611 X:49079932-49079954 GACTCACCCCAGCTGGAAAAAGG + Intronic
1190512390 X:51186202-51186224 CAGTCAGCACATTTGGAAGTAGG + Intergenic
1190877123 X:54467952-54467974 CACTCAGCCCAGCTGGGCCTGGG + Intronic
1194731640 X:97462292-97462314 TACACAGCTCAGCTGAAAATGGG - Intronic
1196208808 X:112971809-112971831 TGTTCAGCACAGCTGGGAATAGG + Intergenic
1196602078 X:117613346-117613368 CGCTCAGCACATCTAGAAATTGG - Intergenic
1200828468 Y:7667126-7667148 CACTCAGTACAGAAGGAAAAAGG + Intergenic
1201492411 Y:14556757-14556779 CAGTCAGCAGACCTTGAAATTGG - Intronic