ID: 950667468

View in Genome Browser
Species Human (GRCh38)
Location 3:14506065-14506087
Sequence TCCCAAAGGCAGGAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 426}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950667468_950667475 0 Left 950667468 3:14506065-14506087 CCCTCCACTTCCTGCCTTTGGGA 0: 1
1: 0
2: 3
3: 43
4: 426
Right 950667475 3:14506088-14506110 GCTCTGAAGGTCCAGCCCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 284
950667468_950667474 -1 Left 950667468 3:14506065-14506087 CCCTCCACTTCCTGCCTTTGGGA 0: 1
1: 0
2: 3
3: 43
4: 426
Right 950667474 3:14506087-14506109 AGCTCTGAAGGTCCAGCCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950667468 Original CRISPR TCCCAAAGGCAGGAAGTGGA GGG (reversed) Intronic
900093320 1:929966-929988 TCCCAGAGGCAGGTAGAGGGAGG + Intronic
901319284 1:8329919-8329941 TGGAACAGGCAGGAAGTGGAAGG + Intronic
902718512 1:18289285-18289307 TCCCAAAGTCATAAAGCGGAAGG - Intronic
902903095 1:19533788-19533810 CCAGCAAGGCAGGAAGTGGAAGG + Intergenic
903471097 1:23587987-23588009 TCCTGAAGGCAGGAAGGGAAGGG + Intronic
904586886 1:31585614-31585636 TCCCACAGGCAGCACCTGGAGGG + Intronic
905168092 1:36094996-36095018 AACCAAAGGCAGGTAGTGGCTGG - Intergenic
906319435 1:44807233-44807255 GGCCAAAGGCAGAAGGTGGAAGG - Intergenic
906750469 1:48254101-48254123 TCCTTGGGGCAGGAAGTGGATGG + Intergenic
910347193 1:86253599-86253621 TCTTAAAGGAAGGAACTGGAGGG - Intergenic
911117786 1:94264536-94264558 GCCCAAAAGAAGCAAGTGGAAGG - Intronic
911339562 1:96620240-96620262 TCCCCAAAGCAGGAAGTCTATGG + Intergenic
911509659 1:98795721-98795743 TCCCAAAGGAAGGAAGAGAAAGG - Intergenic
911646288 1:100340605-100340627 TCTCATAAGCAGTAAGTGGAGGG + Intergenic
911872539 1:103117411-103117433 TCAAAAAGGGAGGAACTGGAAGG + Intergenic
912143138 1:106756338-106756360 TCCAAAAGACAGGAAATGGAAGG - Intergenic
912652363 1:111450477-111450499 TCACACAGCCAGTAAGTGGAGGG - Intronic
912662617 1:111546424-111546446 TCCCAAAGGCTGGGAGAGGAAGG - Intronic
912885504 1:113468084-113468106 ACACAAAGACAGAAAGTGGAAGG - Intronic
913277318 1:117151519-117151541 ACCAATAGGCAGGAAGTGGGCGG - Intronic
914420369 1:147523169-147523191 TCGAAAAGGCAGGAAGTACAAGG + Intergenic
914433941 1:147643439-147643461 TACCTAAGGCAGGAGGTAGAAGG + Exonic
915540795 1:156564704-156564726 TCCCAATGGCAGTAACTGGCTGG - Intronic
916763320 1:167836381-167836403 TCCCAAAGCCAGAAAATGGTGGG + Exonic
916865276 1:168849850-168849872 CCAAAAAGGCAGGAAATGGATGG - Intergenic
917319182 1:173760969-173760991 TCCCAAAGGCAGCAGATGGTTGG - Intronic
918014523 1:180620174-180620196 TCCCAATGGCAGAAGGTGGAAGG - Intergenic
918094663 1:181324923-181324945 TCCCAGATGCAGGAGATGGAAGG - Intergenic
918433296 1:184484516-184484538 CCCCGAAGGCAGGAACTGCATGG + Intronic
918648313 1:186927971-186927993 GTCGAAAGGCAGGCAGTGGAGGG + Intronic
918760950 1:188406389-188406411 GCCCAAAGGCATAATGTGGAAGG - Intergenic
919914076 1:202129398-202129420 TCCCAAAGAAAGGAGGAGGAAGG - Exonic
920161468 1:204001588-204001610 TCCAAAAGGGAGAAACTGGAGGG - Intergenic
920367180 1:205454351-205454373 TCCTAAAGGCATGAAGAGGAAGG - Intronic
920770964 1:208884833-208884855 TCCCAAAGGCATGGCCTGGAGGG + Intergenic
920938705 1:210460120-210460142 TCCAAGGGGTAGGAAGTGGAAGG + Intronic
921273850 1:213497679-213497701 TCCCAAAGAAAGCAGGTGGAGGG + Intergenic
921798939 1:219379957-219379979 CCCAAAAGGCAGGAACTGGCTGG + Intergenic
922600387 1:226847052-226847074 TCCAAAAGGGAGAAAATGGAAGG - Intergenic
923705010 1:236336893-236336915 TCAGAAAGGCAGGAAGTGGCTGG + Intergenic
924078672 1:240369143-240369165 TAGAAAAGGCAGGAGGTGGAGGG - Intronic
924507705 1:244701640-244701662 TCCAAAAGGGAGAAAATGGAAGG - Intronic
924944415 1:248836805-248836827 TCCCAGAGACATGAAGAGGATGG - Intergenic
1064136897 10:12758765-12758787 TCCTAAGGGCAGGAGGTGGTGGG + Intronic
1064484015 10:15766521-15766543 TCCCAAACCCAGGATGCGGAAGG + Intergenic
1066499300 10:35974483-35974505 TCTCACAGGGAGGAAGAGGAAGG - Intergenic
1066535186 10:36383495-36383517 TACCAGATGCAGGAAGTGGGAGG - Intergenic
1067340735 10:45401196-45401218 TTCCAAGGGAAGAAAGTGGAAGG + Intronic
1067354966 10:45515773-45515795 TCCCAATAGCTGGAAGAGGAAGG - Intronic
1067514193 10:46922806-46922828 TCCAAAAGGGAGAAACTGGAAGG - Intronic
1067648061 10:48129025-48129047 TCCAAAAGGGAGAAACTGGAAGG + Intergenic
1067656266 10:48194281-48194303 TCCCAAAGCCAGTAAGTGGTAGG + Intronic
1067688024 10:48479474-48479496 TCCCGAGGGCTGGCAGTGGAAGG + Intronic
1067838082 10:49653906-49653928 GCCCACAGGCAGGAGGAGGAGGG - Intronic
1069565583 10:69461433-69461455 TCTCCCAGGCAGGAAGTGGGAGG - Intronic
1069801373 10:71084008-71084030 TCCCAAAGTCACAAAGTGGGTGG - Intergenic
1069926599 10:71854977-71854999 TCCCAGAGGGTGGTAGTGGAAGG - Intergenic
1070703292 10:78618844-78618866 CCCCAAAGGGAGGAAGTCAAAGG + Intergenic
1071289500 10:84177890-84177912 GCTCAGAGGCAGGAAGTTGAGGG + Intronic
1071457597 10:85862868-85862890 ACCCAGAGGGAGGAAATGGAGGG + Intronic
1073322774 10:102625791-102625813 TCTCTAAAGCAAGAAGTGGACGG - Intronic
1073563077 10:104513466-104513488 TCACAAAGCCAGCAAGAGGAAGG - Intergenic
1074035806 10:109737250-109737272 TCCCAAGGGCAGGAATTAAATGG + Intergenic
1074155431 10:110794781-110794803 TACCAAAGGCACTAAGTGAATGG - Intronic
1074569723 10:114613456-114613478 TCCAGAGGGCAGGAAGAGGAAGG - Intronic
1074813915 10:117130809-117130831 TCCCAAAGCCAGGGAGGGAAGGG + Intronic
1074973352 10:118561037-118561059 TCCCAGAGACAGGAAGTACAGGG - Intergenic
1075207927 10:120462772-120462794 TCCCAAAGGCAGCGGATGGAAGG - Intronic
1077201700 11:1310617-1310639 TCCCAAAAGCACGAGGAGGAAGG - Intergenic
1077209933 11:1365560-1365582 CCCCAGTGACAGGAAGTGGATGG + Intergenic
1077562207 11:3271108-3271130 ACCCACAGGCAGGAAGGAGAGGG - Intergenic
1077568101 11:3316928-3316950 ACCCACAGGCAGGAAGGAGAGGG - Intergenic
1077670695 11:4154674-4154696 TCCCACAGGGAGGAATGGGATGG - Intergenic
1078038368 11:7833076-7833098 TCTAAAAGGGGGGAAGTGGAAGG - Intergenic
1078719493 11:13871411-13871433 TCCTAAGGGCATGAGGTGGAAGG + Intergenic
1079368230 11:19827955-19827977 TACCAAGGGGAGGAAGGGGAGGG + Intronic
1079573344 11:21972036-21972058 TACCAAAGGCAGGAAGTGGGAGG - Intergenic
1080451321 11:32381193-32381215 TGCACAAGTCAGGAAGTGGAAGG - Intergenic
1080668283 11:34354934-34354956 GCTCCAGGGCAGGAAGTGGAGGG - Intronic
1082133449 11:48518666-48518688 TCCCAGTGGTAGAAAGTGGATGG + Intergenic
1083144101 11:60745585-60745607 TTCCAAAGGCAGGAAACGGTGGG + Intergenic
1084533458 11:69743061-69743083 TGGCTAAGGCAGGAAGAGGAGGG - Intergenic
1084703906 11:70804811-70804833 TCCCACAGGCTGGCAGTGGTAGG - Intronic
1085422552 11:76376038-76376060 TACCAAAGGCTGGAAGGGCAGGG + Intronic
1087463189 11:98471204-98471226 GCCCAAAGACAGGAACTAGAAGG - Intergenic
1087818620 11:102686927-102686949 TGCCAAAGGTGGGAAGTGGGAGG - Intergenic
1087859283 11:103133556-103133578 ATTCAAAAGCAGGAAGTGGAGGG + Exonic
1088210486 11:107449758-107449780 TCCAAAAGACAGGAAAAGGAAGG + Intronic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089201363 11:116726414-116726436 TTCCAAAGGCAGTAAGTGGCAGG - Intergenic
1090532978 11:127610292-127610314 TACCAAAGGAAGGAAGAGGTGGG + Intergenic
1091704714 12:2685982-2686004 TTCCAAAGGCAGGGTGTGCAGGG + Intronic
1091711287 12:2742321-2742343 TTCCAAAGGCAGGGTGTGCAGGG + Intergenic
1091776336 12:3187367-3187389 GCACAAAGGCAGGCAGAGGAAGG - Intronic
1091953214 12:4612948-4612970 TCCCAAAGGTAAGAAATGGCAGG - Intronic
1092279112 12:7086323-7086345 TCCTCAAGGCAGGAGGTGGGAGG + Intronic
1092504760 12:9086100-9086122 TGCCAAAAGCTGGAAGAGGAAGG + Intronic
1092559191 12:9592120-9592142 TCACAGAGGCACGTAGTGGAAGG + Intergenic
1092911091 12:13145481-13145503 TCCCAAGGGCAGGATGGAGAAGG + Intergenic
1094241756 12:28235132-28235154 TTCATAAGACAGGAAGTGGAAGG + Intronic
1094768098 12:33620773-33620795 TGCCAGAGCCAGAAAGTGGAAGG + Intergenic
1095773162 12:45984989-45985011 TCCAAAAGTAAGGAAGTGGCTGG - Intronic
1095992267 12:48043694-48043716 CCCAAAAGGCAGGCAGTTGAAGG + Exonic
1096517563 12:52165562-52165584 GCCCAAGGGAGGGAAGTGGAAGG - Intergenic
1096783833 12:54006043-54006065 CCCCAAAGGTGGGAAGTGGGAGG - Intronic
1097182990 12:57181363-57181385 TCCCCAAGGTAAGAAGAGGAAGG - Intronic
1099392607 12:82098994-82099016 TTCCAAAGGCTGGAAGTCCAAGG - Intergenic
1101589319 12:106112098-106112120 TCCCAAAAGGAGGGACTGGAGGG + Intronic
1101646962 12:106640254-106640276 TGGCAGAGGCAGGAAGTGGCTGG + Intronic
1101894547 12:108746048-108746070 TCACAAAGCCAGGAAATGGCAGG - Intergenic
1102430046 12:112875975-112875997 TCACACAGCCAGGAAGTGAAGGG - Intronic
1102711649 12:114933284-114933306 GGCCAAAGGCAGGAAGAGGAAGG + Intergenic
1104217469 12:126748266-126748288 TCCCAAAGCTACGAAGGGGATGG + Intergenic
1104645800 12:130496533-130496555 TCCCTCCTGCAGGAAGTGGATGG - Intronic
1104787782 12:131460807-131460829 TCATAAAGGCAGGAAGGGGAGGG + Intergenic
1108339186 13:49480197-49480219 TCTAAAAGGCAGGCAATGGATGG - Exonic
1108572460 13:51764991-51765013 TTGCAAGAGCAGGAAGTGGAGGG - Exonic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1115197730 14:30819701-30819723 TCACAAAAGCAGGAAATTGATGG - Intergenic
1115342948 14:32311620-32311642 TCCCAAAGGCAAGTAGTGGCAGG - Intergenic
1115687215 14:35808886-35808908 TCCCGGCGGCAGAAAGTGGAGGG + Exonic
1115805040 14:37041193-37041215 TCCTGAAGGAAGGCAGTGGAGGG + Intronic
1116976645 14:51123959-51123981 TCCCAAAGGAAGAAAATGAAGGG + Intergenic
1117772000 14:59142955-59142977 TCCCAAAGGCAGGCTGGGCACGG + Intergenic
1118445883 14:65850984-65851006 TCCGAGAGGCAGGAAGGGCAAGG - Intergenic
1118571375 14:67199023-67199045 TTCAAAAGGCAAGAAGAGGATGG + Intronic
1118760622 14:68878559-68878581 TCGGGAAGGCAGGAAGAGGAAGG + Intronic
1118882473 14:69841247-69841269 TCCCCCAGGTAGGAAGTGGAGGG - Intergenic
1119424892 14:74528758-74528780 TCCCAAAGGGAGGGAAAGGAAGG - Intronic
1120036221 14:79701601-79701623 TTCCAGGGGCAGGAAGTAGAGGG + Intronic
1121700594 14:95951190-95951212 TACCAAGGGCAGTCAGTGGAAGG - Intergenic
1121806562 14:96831029-96831051 TCCCACAGCCAGGAAGTGCAAGG - Intronic
1122057949 14:99117861-99117883 CCTCAAAGGCAGCAAGGGGACGG - Intergenic
1122427547 14:101620614-101620636 GCCCTCAGGCAGGATGTGGATGG + Intergenic
1123472569 15:20566030-20566052 TCCCCAGAGCAGGAAGTGGTAGG - Intergenic
1123508904 15:20975361-20975383 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123566126 15:21549110-21549132 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123602386 15:21986397-21986419 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123645434 15:22434323-22434345 TCCCCAGAGCAGGAAGTGGTAGG + Intergenic
1123732874 15:23161021-23161043 TCCCCAGAGCAGGAAGTGGTAGG - Intergenic
1123751007 15:23358398-23358420 TCCCCAGAGCAGGAAGTGGTAGG - Intronic
1124283380 15:28382316-28382338 TCCCCAGAGCAGGAAGTGGTAGG - Intronic
1124299318 15:28529297-28529319 TCCCCAGAGCAGGAAGTGGTAGG + Intronic
1125727295 15:41874602-41874624 TGACAAAGGGAGGCAGTGGAAGG + Intronic
1126575262 15:50190354-50190376 TCCAAAAGGAAGGTAGTGAAAGG - Intronic
1126840189 15:52710185-52710207 TCCCAAAGGAAGGCAGAGGAAGG + Intergenic
1127476481 15:59338673-59338695 TCCCACAGGCAGGAGGAGCAAGG + Intronic
1128509215 15:68303195-68303217 TCCCAAGGAAAGGTAGTGGAGGG - Intronic
1129027314 15:72589415-72589437 TCCCAAAGGCAGGATGAGATTGG + Exonic
1129137563 15:73568380-73568402 TCCAAAAGGCAGGCTGAGGAAGG + Intronic
1129792141 15:78348581-78348603 ACCCAAAGACAAGCAGTGGAGGG + Intergenic
1130628043 15:85536096-85536118 GCCCAAAGAGAGGAAGTGGCCGG - Intronic
1130678187 15:85973043-85973065 TCCCCAAAGTAGGAAGAGGAGGG + Intergenic
1130885475 15:88089208-88089230 GCACAAAGCCAGGAAGTGGTAGG - Intronic
1131511443 15:93051474-93051496 CCCCAAAAGCAGGTAGGGGAGGG + Intronic
1131800087 15:96059583-96059605 TCCCAAGGGTTGGAAATGGAGGG - Intergenic
1132179999 15:99745043-99745065 TCCCACAGGAGGGAAGTGGCAGG + Intergenic
1202974493 15_KI270727v1_random:276200-276222 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1132641289 16:979765-979787 TCCCAGGGGCAGGGGGTGGAAGG + Intronic
1132808624 16:1787284-1787306 CCCCAAAGGCAGGGAGAGGCTGG + Intronic
1132828168 16:1915105-1915127 TGCCAAAGCCAGAAAGTGCAGGG + Intronic
1132929977 16:2454129-2454151 TCCCAAGGGCAGGCACTGGGTGG + Intronic
1136403581 16:30030967-30030989 CCCCAAAGGAAGGAGGTGGGCGG + Exonic
1136577248 16:31132051-31132073 GCCCAGAGGCAGGAAAAGGATGG + Exonic
1136654819 16:31703464-31703486 TGCTATAGGCAGGAAATGGAGGG + Intergenic
1137580833 16:49632549-49632571 GCCCAAAGGCAGGGAGAGGAAGG + Intronic
1138279505 16:55762053-55762075 TTCCTAAGGAAGGAAATGGATGG - Intergenic
1138289021 16:55831625-55831647 TTCCTAAGGAAGGAAATGGATGG + Intronic
1138858496 16:60725341-60725363 CCTCAAAGGCAGGCACTGGAAGG - Intergenic
1139507997 16:67409178-67409200 TCCCCAAGGCTGTAAGTGGCGGG - Intronic
1139593705 16:67946666-67946688 GCCCAGAGGCAGGAAGCTGATGG - Intronic
1139949122 16:70660732-70660754 GGCCAAGTGCAGGAAGTGGAGGG + Intergenic
1140819320 16:78648361-78648383 TCCCCAAAGCAGTAAGTGCAGGG - Intronic
1142213292 16:88818536-88818558 GCCAAAAAGCAGGAAATGGAGGG + Intronic
1142218350 16:88840932-88840954 AACCAAGGCCAGGAAGTGGATGG + Intronic
1142273211 16:89101843-89101865 ACCAAAAGCCAGGAAGGGGAAGG + Intronic
1142663413 17:1447186-1447208 AGCCAAAGGCAGGAAATAGAAGG + Intronic
1142766427 17:2067042-2067064 TCCCAGAGGCTGTAAGAGGAGGG - Intronic
1142782576 17:2192581-2192603 TCCCAAAGAAAGGAAATGAATGG + Intronic
1142900655 17:3009530-3009552 TAACAAAGTCAGGAAGTGGGAGG - Intronic
1143260533 17:5595270-5595292 TCCCAAAGGCACCCAGTGGGTGG - Intronic
1144654612 17:17027643-17027665 TCACACAGCCAGGAAGTGGGGGG - Intergenic
1146641553 17:34545689-34545711 TCACACAGTCAGGAAGTAGAAGG + Intergenic
1146746460 17:35334546-35334568 TCCCAAAGGCAGCAGATGGTTGG + Intergenic
1148463197 17:47849936-47849958 TCCCAGAGGCAGGAGATGGTAGG - Intronic
1148832233 17:50441048-50441070 CCCCCAGGGCAGGATGTGGATGG + Intronic
1148896590 17:50842584-50842606 ACACAAAGGCAGGAAGGGGTGGG + Intergenic
1149926189 17:60704502-60704524 TCCCAAAGTCAGGAAGTACCTGG + Intronic
1150692137 17:67375973-67375995 TCCCAGAGGCAGGAAGGCAAGGG - Intergenic
1151126222 17:71847666-71847688 TGCCAAAGACAGCATGTGGATGG + Intergenic
1151169990 17:72237762-72237784 TTCCACAGGAAGGAAATGGAAGG - Intergenic
1151240269 17:72751972-72751994 GCACAGAGGCAGGAAGTAGAAGG - Intronic
1151476811 17:74348823-74348845 TTCCAAAGGCAGGAAGGGGATGG + Intronic
1152998054 18:426862-426884 TCCCACAGTCAGGAAGGGAAGGG + Intronic
1153066005 18:1045795-1045817 TCCCACCGGGAGGAAGTGGGAGG + Intergenic
1153549309 18:6244718-6244740 TACCAGAGGCTGGAAGTTGAGGG + Intronic
1154237045 18:12615840-12615862 TTCTAAAGGCAGGAAATGAAAGG - Intronic
1154358013 18:13637144-13637166 TCACATAGGGAGGCAGTGGATGG - Intronic
1155192230 18:23440357-23440379 TCCCACAGGCAGAAAGTAAAGGG - Intergenic
1155596381 18:27492991-27493013 TCCAACAGGCAGGAACTGGTGGG - Intergenic
1156901270 18:42302726-42302748 TCCCAAAGACAAGAGTTGGATGG - Intergenic
1157300476 18:46475240-46475262 ACCAAAAGGCAGGAGGAGGAGGG + Intergenic
1158207002 18:55004481-55004503 TCTCAAAGGCAGGAAGAGGCTGG + Intergenic
1158230923 18:55254208-55254230 TGCCAAGGGCTGGAAGTGGAGGG + Intronic
1158233868 18:55290400-55290422 TCCCAAAGACAGGGAGTGATTGG - Intronic
1158667865 18:59449159-59449181 TCCCACAGGTAGAAAGTGGCAGG - Intronic
1158933853 18:62346856-62346878 TCACAAAGGCAGTCAGGGGAGGG - Intronic
1159948503 18:74461247-74461269 TCCTACAGGCAGGAGTTGGAGGG - Intergenic
1160226037 18:77011600-77011622 TCCCAGAGCCAGGAAGAGGGAGG + Intronic
1160810270 19:1010254-1010276 TCCCAGAGGAAGGAGGTGGCTGG + Exonic
1160988549 19:1851365-1851387 TCCCAAAGGCACCAAAAGGATGG + Intergenic
1161407399 19:4098259-4098281 GTCCAGAGGCAGGAAGGGGATGG + Intronic
1161884044 19:6979675-6979697 TCCCAGATACAGGAAGAGGAGGG + Intergenic
1162311409 19:9909625-9909647 TCCCAAAGTCAGGAGGCGGAAGG - Intronic
1165824045 19:38695485-38695507 TCCCCCTGGCAGGAAGAGGAAGG - Intronic
1166160518 19:40949311-40949333 TCTCAGAGGCAGGAAGTTGCAGG - Intergenic
1166169397 19:41016904-41016926 TCTCAGAGGCAGGAAGTTGCGGG - Exonic
1166277818 19:41767230-41767252 TCCACAGGGCAGGTAGTGGAGGG - Intronic
1167353575 19:48990698-48990720 ACACACAGGCAGCAAGTGGAGGG + Intronic
1167815599 19:51878062-51878084 TCCTAAAGACAGAAAGTGAATGG + Intronic
925034213 2:673652-673674 TCCTGAAGGGAGGAAGTGGAGGG - Intronic
925260783 2:2526693-2526715 TTGCAAAGGCAGGAACAGGAAGG - Intergenic
925830758 2:7893284-7893306 TTCCAAAGGCAAGAAATGAAAGG - Intergenic
926679577 2:15653395-15653417 TCACCCAGGCAGGAAGTGGCTGG - Intergenic
927024209 2:19049025-19049047 TCCAAGAGCCAGGAAGTAGATGG - Intergenic
927252818 2:21013395-21013417 TCCCACAGACTTGAAGTGGAGGG + Exonic
928610519 2:32987486-32987508 TCCCAGAGGCAGGAAACTGATGG - Intronic
929952093 2:46419942-46419964 TACCAAAGGCACGAAATGGGGGG + Intergenic
931245257 2:60487094-60487116 GCCACAAGGCAGGAAGGGGAAGG + Intronic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
931397467 2:61900586-61900608 TCTAAAAGGGAGGAAGTAGAAGG + Intronic
931433977 2:62231549-62231571 ACCCAAAGGCAGTCAGAGGAGGG - Intergenic
931519179 2:63076701-63076723 TCCTAGAGACAGGAAGTAGAAGG - Intergenic
931720416 2:65063377-65063399 TCCCAAATGAAGGAAGTGCCAGG - Intronic
931764584 2:65443664-65443686 TTCTAAAGGCAGGAAGGGGTGGG - Intergenic
932293982 2:70609189-70609211 TGTTCAAGGCAGGAAGTGGAAGG - Intronic
932330176 2:70894296-70894318 GCCCAAGGGCAGGGAGAGGATGG - Intergenic
935361076 2:102246712-102246734 GCCCAAGGGCATCAAGTGGATGG + Intergenic
936993470 2:118389663-118389685 TTCCAAAGGCAGGAGGTGGAGGG + Intergenic
937015492 2:118601679-118601701 GTCCAAGGGCAGGAAGTGGGGGG + Intergenic
937755926 2:125538641-125538663 TGCCCAAGGCAGGAAGGGAAAGG - Intergenic
937976653 2:127586535-127586557 GCCCAAAGCCAGGATGTGGCAGG - Intronic
942223946 2:173798442-173798464 ACCCAGAGGCAGGAAATGAACGG + Intergenic
942318345 2:174714593-174714615 TTACAAAAGCAGGCAGTGGATGG - Intergenic
944540688 2:200750658-200750680 TCCCAAAGGCAGGAAGAGCTGGG - Intergenic
944786082 2:203071795-203071817 TCCAAAAGGGAGACAGTGGAAGG + Intronic
944811962 2:203335954-203335976 TACCAAAGGCTAGTAGTGGAGGG - Intronic
944963170 2:204900011-204900033 TCCCAAAAGCATCAAGTGAAAGG - Intronic
945128152 2:206536413-206536435 TACCAGGGGCAGGAGGTGGAGGG + Intronic
947887964 2:233590916-233590938 TACCAAAGGCAGAAAGTGTGTGG - Intergenic
948244772 2:236471176-236471198 TCACACAGCCAGGAAGTGGCTGG + Intronic
948388105 2:237594107-237594129 TCACAGAGGCTGGAAGCGGAGGG - Intronic
948778019 2:240299876-240299898 TCCCCAAGGCAGGATGTGGGTGG + Intergenic
948868784 2:240788036-240788058 TCCCACAGGCACGAAGCGGGGGG - Exonic
1168734708 20:122013-122035 TCCAAACAGGAGGAAGTGGAAGG - Intergenic
1169601241 20:7263120-7263142 GGCCAAAGGCATGATGTGGAGGG + Intergenic
1170151786 20:13234114-13234136 TCCAAAAGGTGGGAGGTGGAGGG - Intronic
1170263519 20:14439870-14439892 TCCCAGAGGCAGGAAGTCATGGG + Intronic
1170874160 20:20235030-20235052 TTTCAAAGGCGGGAAGTGGCTGG + Intronic
1171079038 20:22159109-22159131 TCCCAAAAGCAGACAGAGGATGG + Intergenic
1172177946 20:32984003-32984025 TTCCAAAGGTGGGGAGTGGAAGG + Intronic
1172301654 20:33854721-33854743 TCCCATGGGGAGGAAGTGTAGGG + Intergenic
1172576241 20:36010957-36010979 TCCCATTGTCAGGAATTGGAGGG - Intronic
1173639146 20:44587325-44587347 TCCCAGAGCCAGGAATTGTAGGG - Intronic
1174113025 20:48209198-48209220 TCCCCAAGGAAGGAAGAGGCTGG - Intergenic
1174217149 20:48924811-48924833 TCACAAACGTAGCAAGTGGAAGG - Intronic
1174482470 20:50841442-50841464 TCACAAAGTCAGGAAGTGGCAGG - Intronic
1175482498 20:59321396-59321418 TCCAAAAGGCAGCAAGGGGGTGG - Intronic
1175594442 20:60219652-60219674 TTCCAAGGGCAGGAAAGGGAGGG - Intergenic
1175618112 20:60420710-60420732 TCCCACAGGCAGGAAGTTCAGGG + Intergenic
1175798056 20:61784876-61784898 GCCCATAGCCAGGAAGGGGATGG - Intronic
1176144375 20:63559103-63559125 TCCCTGGGGCAGGAAGTGGGTGG - Intronic
1176227342 20:64008534-64008556 TGCCAAAGGCAGGAGCTGAAAGG - Intronic
1179033842 21:37743084-37743106 TCCCAGAGGCAGGCACTGGGTGG - Intronic
1179036973 21:37766632-37766654 TTCCAAAGGAAGGGAATGGATGG + Intronic
1179447872 21:41445813-41445835 TCCCTAAGGCAGTAAGGGGTGGG + Intronic
1179724646 21:43335381-43335403 GCCCACAGCCAGGAGGTGGACGG - Intergenic
1179953728 21:44726448-44726470 TCCCAGAGGAAGGAGGCGGAGGG + Intergenic
1181784334 22:25215748-25215770 TCACACAGCCAGGAAGTGGTAGG - Intergenic
1182088345 22:27576964-27576986 TCACACAGCCAGGAAGTGGTGGG - Intergenic
1182686211 22:32122983-32123005 TGCCAGAGGCAGGGAGTGCATGG + Intergenic
1183378293 22:37477932-37477954 TCACAAAGCCAGGAGGTGGCAGG + Intronic
1183862881 22:40682245-40682267 TTCCCAAGGCAAGAGGTGGAAGG + Exonic
1184014874 22:41778361-41778383 TCCCACAGCCAGAAAGTGGCAGG - Intronic
1184355972 22:43979913-43979935 TCTTAAAGGCAGGGAGTGGGAGG - Intronic
1184444344 22:44538730-44538752 TCACACAGCCAGGAAGTGGCAGG + Intergenic
1184843341 22:47065533-47065555 CCCCAAGGGCAGGCAGGGGAGGG - Intronic
1184988834 22:48154026-48154048 GCACAAAGCCAGGGAGTGGAGGG - Intergenic
1185181199 22:49364430-49364452 TCCGAGAGCCAGGAAGGGGAGGG - Intergenic
949621591 3:5818780-5818802 ATCCAAAGGCAGGAAATGAAGGG + Intergenic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
950430759 3:12949665-12949687 ACCCAGAGGAAGGAAGGGGATGG + Intronic
950667468 3:14506065-14506087 TCCCAAAGGCAGGAAGTGGAGGG - Intronic
950668631 3:14512145-14512167 GCCCAGAGGCAGGAAGGGGCAGG + Intronic
950830113 3:15865147-15865169 ACCCAGAGGCTGGAAGTAGAAGG + Intergenic
951712098 3:25593633-25593655 TTCCAAAGGCAGGAGCTGGTTGG - Exonic
951980705 3:28563630-28563652 TCCTAAAGACAGAAAGTAGAAGG + Intergenic
952061428 3:29515711-29515733 AGGCAAAGGCAGGAAGTGAAAGG - Intronic
952958866 3:38577325-38577347 TTGCAAGGACAGGAAGTGGAGGG - Intronic
954372633 3:50176707-50176729 TCCCCCAGCCAGGAAGTGTAAGG - Intronic
954948846 3:54450973-54450995 TCCAAATGGGAGGAATTGGAAGG + Intronic
956707199 3:72009450-72009472 TCCCAAAGGCAGGCTCTTGACGG - Intergenic
958193903 3:90218573-90218595 CCCCAAATGGAGGAACTGGATGG + Intergenic
958466170 3:94461838-94461860 TCCCAAATGCACTGAGTGGAAGG - Intergenic
958671032 3:97204489-97204511 TCACAAAGTTAGTAAGTGGATGG + Intronic
959197579 3:103204371-103204393 CCCCATAGGCAGGAAATGTATGG - Intergenic
959395138 3:105827603-105827625 AGCCAAAGGCAGAAAGGGGAGGG + Intronic
959429164 3:106231365-106231387 TCCCAAAGGGAGAGAATGGATGG - Intergenic
960015988 3:112888704-112888726 TCCAAAAGGCAGATAGTGAAGGG + Intergenic
961043600 3:123694108-123694130 TCACTAAGGCTGGAAGAGGAAGG + Intronic
961494054 3:127277853-127277875 TCCAAGAAGCAGGAAGTAGAGGG - Intergenic
961681465 3:128602944-128602966 TCCCAGAGGCAGGGATTGGAGGG - Intergenic
963039790 3:141060477-141060499 TCACACAGCCAGGAAGTGGCAGG - Intronic
965176918 3:165346641-165346663 ACCCTAAGGCAGGAAGTAAAAGG - Intergenic
965567776 3:170138871-170138893 CTCCAAATGAAGGAAGTGGAAGG - Intronic
965786246 3:172338353-172338375 TATCAGAGGCAGGAAGGGGAAGG + Intronic
966393236 3:179475026-179475048 ATCCAATGGCAGGAGGTGGAAGG + Intergenic
967571577 3:191035211-191035233 TTCCAAAAGAAAGAAGTGGATGG + Intergenic
967662915 3:192135194-192135216 TTCTAAAAGCAGGAATTGGAGGG - Intergenic
968496932 4:923671-923693 TCTCAAGGGCAGGGAGTGGAGGG + Intronic
969320783 4:6411234-6411256 TCACACAGCCAGGAAGTGGTGGG + Intronic
969492189 4:7505753-7505775 TCACAGAGTCAGGAAGAGGAAGG - Intronic
969725332 4:8915104-8915126 TCACAGAGCCAGGAAGTGGCCGG - Intergenic
970457571 4:16240100-16240122 TCCCTAGGGCAGGAAGTGAGAGG + Intergenic
971263349 4:25076660-25076682 TCCCAAAGGCTGGAAGTCTATGG - Intergenic
973777044 4:54253134-54253156 TCCAAGAGGTAGGAAGTGCAGGG + Intronic
974790257 4:66679765-66679787 TCCAAAAGGTAGGAAGTTGAAGG + Intergenic
976252076 4:83063125-83063147 TCCCATAGGCAGCAAGTTGCTGG - Exonic
976789277 4:88859441-88859463 GCCCAGAGGCAGGTGGTGGAGGG + Intronic
978283480 4:107045534-107045556 ACTCAAACCCAGGAAGTGGAGGG + Intronic
978385419 4:108172246-108172268 TCCAAAAGGAAGGAGGTGGCGGG + Intergenic
980030317 4:127821294-127821316 TCCCAAAGGAATGAATTGTAGGG + Intronic
981214314 4:142146546-142146568 TGCCAAGGGCTGGAAGAGGAAGG - Intronic
981868335 4:149455314-149455336 TCCCAAAGGCAGAATGTTGTGGG + Intergenic
982033203 4:151321337-151321359 AGCCAAGGGCAAGAAGTGGAGGG - Intronic
982497664 4:156110815-156110837 TAACTAAGGCAGGAAGTGGGAGG + Intergenic
982581681 4:157187439-157187461 TCCCAAAGCAAGGAAGAAGAGGG + Intergenic
983499524 4:168483218-168483240 TCACAAAGGGAGAAAATGGAAGG - Intronic
983520945 4:168708422-168708444 TCACAAAGGCAAGATGTGGCAGG + Intronic
985472578 5:54686-54708 TCCCAGAAGCCGGAAGTGGCCGG - Intergenic
985507954 5:295308-295330 TCCCAGAGGGAGAGAGTGGAGGG + Intronic
985549795 5:527224-527246 TGCCTGAGGCAGGAAGTGGTCGG - Intergenic
985740081 5:1610360-1610382 TCCCAGAGGGAGAGAGTGGAGGG - Intergenic
986274836 5:6264646-6264668 TCTGCAAGGCAGGAAGTGCAGGG + Intergenic
987075852 5:14381116-14381138 TTCCAAAGCCTGGAAGGGGAAGG - Exonic
987791356 5:22572441-22572463 TCACAAAAGCAGTTAGTGGAAGG + Intronic
989214035 5:38885143-38885165 TCACAAGGGCAGGAAGGAGAAGG + Intronic
989445533 5:41524328-41524350 ACTGGAAGGCAGGAAGTGGAAGG - Intergenic
990123395 5:52484112-52484134 TTCAAATGGCTGGAAGTGGAAGG - Intergenic
990167447 5:53010427-53010449 TTCAAAAGGCAGCAATTGGAAGG - Intronic
990488666 5:56283094-56283116 TCCCAGAGGGAGGAAGAGGCTGG + Intergenic
990608690 5:57436347-57436369 ACCCAAAGGCAGGATATAGAGGG - Intergenic
990804874 5:59648835-59648857 TACCAAAGGGAGGAAGTGGCAGG + Intronic
990890852 5:60648326-60648348 TTCCAAAGGCAGGAAGGTGTGGG - Intronic
990958919 5:61372579-61372601 TCCAAAAAGCGGGAAGAGGAAGG - Intronic
991394666 5:66191705-66191727 TCCCCAAGTGAGGAAGTGGGAGG + Intergenic
992255525 5:74917202-74917224 TCTCATTGGCAGGAAGTGGAAGG - Intergenic
992369929 5:76132304-76132326 TCCCAAATTCAGGATCTGGATGG + Exonic
996394519 5:122999985-123000007 TACCAAAGGCAGAAAGTTGTGGG + Exonic
997431671 5:133845124-133845146 TCACAGAGGCAGGGTGTGGATGG + Intergenic
997641573 5:135452075-135452097 TCCCAAAGGCTGGATTTGTAGGG - Intronic
997882293 5:137601775-137601797 CTCCAAAGGCTTGAAGTGGAGGG - Intergenic
998828062 5:146125825-146125847 TCTCAATGGTAAGAAGTGGAAGG + Intronic
999085604 5:148886117-148886139 CCCCAAAGCCAGGAAGTAGAAGG - Intergenic
999129344 5:149271430-149271452 GCCCAAAGCCAGGAAATGGGTGG + Intergenic
999287076 5:150400542-150400564 ACCCAAAGACAAGAAATGGAAGG + Intergenic
999400982 5:151264053-151264075 TCCCACAGGCTGGAACTTGAGGG - Intronic
1000108884 5:158088129-158088151 TCAAATAGGCAGGTAGTGGAAGG + Intergenic
1000295234 5:159907798-159907820 TCACAAAGCCAGGAAGTGGCAGG + Intergenic
1000356052 5:160396918-160396940 ACCCAAAGACAGGATGTAGAAGG + Intronic
1001589667 5:172856716-172856738 TCCCAAAGGCTGTGAGGGGAGGG + Intronic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1001913740 5:175542224-175542246 TCCCCAAGGCAGGACTTTGAGGG - Intergenic
1002674559 5:180900469-180900491 TTTCAAGGGAAGGAAGTGGAAGG + Intronic
1002940761 6:1713514-1713536 TCCTAAAGGTAGGATGGGGATGG - Intronic
1003414452 6:5895509-5895531 TCCCCATGGCAGGAAAGGGAAGG - Intergenic
1004125031 6:12865014-12865036 AGCCAAGGGCAAGAAGTGGAGGG + Intronic
1004170915 6:13294961-13294983 TTGCAAAGGCAGGAAGAGAAGGG + Intronic
1005087894 6:22025610-22025632 TCCCAAGTGCAGGGGGTGGAGGG - Intergenic
1007291357 6:40789571-40789593 GCACAAAGGCAGGAAGCAGATGG + Intergenic
1007425034 6:41741053-41741075 TACCAGAGGCAGGAAGCGGAGGG - Intronic
1008207005 6:48672823-48672845 TGCCAAAGGGATGAAGTTGATGG - Intergenic
1009287715 6:61843134-61843156 TCACAAAGACAGAAAGTAGATGG + Intronic
1010280431 6:74017482-74017504 TCATAAAGGCAGGGAGTGGAAGG - Intergenic
1010389045 6:75315723-75315745 TCCCAGAGTCAGTAAGTGGCAGG + Intronic
1011507246 6:88059261-88059283 TCACACAGGCAGGAAGTGGTAGG + Intronic
1013164687 6:107579146-107579168 GCCAAAAGGCAGGCAGTGGGCGG + Intronic
1013409636 6:109872698-109872720 TCCCCAAGCCTGGAAGAGGAAGG - Intergenic
1013832289 6:114288532-114288554 TCCAAGAGACAGTAAGTGGAAGG - Intronic
1015895355 6:138011467-138011489 CCCCAAGGGCAAGAAATGGATGG - Intergenic
1016224584 6:141719916-141719938 TCCCAGAGCGAGGAAGTTGATGG - Intergenic
1018493619 6:164324423-164324445 TACCAGGGGCAGGGAGTGGAAGG - Intergenic
1018762746 6:166905661-166905683 TCTGAAAGGCAGGAAGCGGCAGG + Intronic
1019003870 6:168779826-168779848 GCCCACAGGCAGGAAATTGAGGG + Intergenic
1019576001 7:1737945-1737967 TCCCACAGGCAGGGCCTGGAGGG - Intronic
1022100100 7:27164430-27164452 GGCCGAAGGCAAGAAGTGGAAGG + Intronic
1022139674 7:27482386-27482408 GGCCAATGGTAGGAAGTGGAAGG - Intergenic
1022335855 7:29421329-29421351 GCCCAAAGGCAGGAAATGGGGGG - Intronic
1022689201 7:32629544-32629566 TCACAAAGACAGAAAGTAGATGG + Intergenic
1023076387 7:36486495-36486517 ACTCAAAGGCAGGCAGAGGAAGG - Intergenic
1023302832 7:38792177-38792199 TCTCATAGGTAGGAAGTGGCAGG + Intronic
1023564283 7:41508050-41508072 TCCCAAGGGCAGGAGGTAGCAGG + Intergenic
1024080201 7:45849490-45849512 TCCCAAAGGCATGAAGAAAAAGG - Intergenic
1024089949 7:45928536-45928558 TCCGAAAGGGAGAAATTGGAAGG - Intergenic
1024707087 7:51972566-51972588 TCCCAGAGGCTGGAAGGGGAAGG + Intergenic
1025124557 7:56334450-56334472 TCCCAAAGGCATGAAGAAAAAGG + Intergenic
1026120432 7:67532126-67532148 TTCCAAAGGGAGAAAGTGGAAGG + Intergenic
1028042346 7:86069868-86069890 TACCAGAGGCTGGAGGTGGAAGG - Intergenic
1028735362 7:94205402-94205424 TCCCAAAGGCAGAAGGAGAATGG + Intergenic
1029595758 7:101536895-101536917 ATGTAAAGGCAGGAAGTGGAGGG + Intronic
1029606135 7:101600585-101600607 ACACATAGGCAGGAAGTGGCAGG - Intergenic
1029634996 7:101777778-101777800 TCACAAAGGAAGGAAGAGGAAGG - Intergenic
1029847007 7:103422806-103422828 TCCCAAATGAAGGAAGTTAATGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030480131 7:110092815-110092837 TCCCTAAGGGTGGAAGTGAAGGG + Intergenic
1030644462 7:112044622-112044644 ACCCAAAGGTAGGTAGAGGAAGG - Intronic
1030913519 7:115282702-115282724 TCCCAAAGGAAGGAAAGGGCTGG + Intergenic
1032744741 7:134774315-134774337 TCCCACAGACAGGAAATTGAAGG - Intronic
1032894701 7:136237381-136237403 TTCCAAAGTCACGAAGGGGAAGG - Intergenic
1037131596 8:15413351-15413373 TCCAAAAGGGAGAAATTGGAAGG + Intergenic
1037216536 8:16460125-16460147 TTCCAAAGGCAGGAATAGAAAGG + Intronic
1037365823 8:18121500-18121522 TCCAAAAGACAGAAATTGGAAGG + Intergenic
1038090987 8:24252762-24252784 TCCCCATGGCAGAAGGTGGAAGG + Intergenic
1038315976 8:26484736-26484758 TCACCAAGGCAGGAAGTAAAGGG - Intronic
1038330208 8:26602232-26602254 TCCCAAAGGCAGCAAAGGCATGG - Intronic
1038444012 8:27590738-27590760 TCCCACAGGCTGGAGGTGGTGGG + Intergenic
1038927262 8:32154402-32154424 TGGGGAAGGCAGGAAGTGGAAGG - Intronic
1040548076 8:48417339-48417361 TCCCTTAGGCTGGGAGTGGACGG + Intergenic
1040692843 8:49960823-49960845 TCCCAAAGAGAGGAGGAGGAGGG - Intronic
1041545228 8:59034941-59034963 TCTCAAGGTCAGGAAGTGGAAGG + Intronic
1042395457 8:68286420-68286442 TCTGAAAGGCAGTAAGAGGAAGG - Intergenic
1042679782 8:71370211-71370233 TCTGAAAGGCAGGACGTGTAGGG - Intergenic
1043331780 8:79125603-79125625 TGCCAAGGGCAGGATGTAGATGG - Intergenic
1045080582 8:98621392-98621414 TCAAAAAGGCAAGAAGTGAAAGG - Intronic
1045117019 8:98993504-98993526 TACCAAAGGAAGGAAGTTAAAGG + Intergenic
1049263763 8:141653998-141654020 TCCCACAGCCAGCAAGAGGAAGG + Intergenic
1050587718 9:7130430-7130452 TCACAGAGGAAGGAAATGGAGGG - Intergenic
1050647974 9:7742584-7742606 TTCCGGAGGCAGGAAGTGCAAGG + Intergenic
1051709423 9:19915099-19915121 TGCCAAGGGCAGGTAGAGGATGG - Intergenic
1052712845 9:32078170-32078192 TCACGAAGGCAGAAAGAGGAAGG - Intergenic
1055877262 9:80958427-80958449 TCTGATAGGCAGGAAATGGATGG + Intergenic
1056575240 9:87851410-87851432 TCAGAAAGGAAGGAAGTGCATGG - Intergenic
1057454139 9:95191960-95191982 TCCATAAGGCAGCAAGAGGAGGG + Intronic
1058492814 9:105520060-105520082 TCCCAGCGGCAGAAAGTGGAGGG - Intronic
1058620512 9:106878142-106878164 TCACAAAGCTAGGAAGTGGCAGG - Intronic
1058839079 9:108888227-108888249 TGCCAAAGGCTGGCAGTGGAGGG + Intronic
1059381610 9:113931403-113931425 GCTCAAAGTCAGGGAGTGGAGGG + Intronic
1060206649 9:121686349-121686371 TCCCCAGGGCAGGAAGAGGAGGG - Intronic
1060802985 9:126556624-126556646 GCCCAGAGCCAGGAAGTGGTGGG - Intergenic
1185615269 X:1418355-1418377 TCCCCACGGCAGGAAGGAGAAGG - Intronic
1185615302 X:1418483-1418505 TCCCCATGGCAGGAAGGAGAAGG - Intronic
1185971639 X:4671587-4671609 TCCAAAAGGCAGGAGGGGTAAGG - Intergenic
1186129577 X:6452113-6452135 TCCCAAGGACAGGGTGTGGAGGG - Intergenic
1186177642 X:6942046-6942068 TCCAAAAGGCAGGAGGAGGGAGG + Intergenic
1186986333 X:15018275-15018297 TATCCAAAGCAGGAAGTGGAGGG + Intergenic
1187024543 X:15420376-15420398 TCCCACTAGCAGGAAGTGTATGG - Intronic
1187522554 X:20026440-20026462 TCACAGAGACAGGAAGTAGAAGG - Intronic
1189722758 X:43937085-43937107 GCCCAAAGGCAGTAAGTATATGG - Intergenic
1192190974 X:68990987-68991009 GGCGAAGGGCAGGAAGTGGAGGG - Intergenic
1192605440 X:72512100-72512122 TGCTAAAGGCAGGAAGTAAAGGG + Intronic
1193162410 X:78241948-78241970 GCCCAAAGACAGTAATTGGAGGG + Intergenic
1194523345 X:94944824-94944846 TCCCAAATACAGGACATGGATGG - Intergenic
1195913595 X:109914144-109914166 CCCCAAAGGAAAGAAGTGGAGGG - Intergenic
1197329997 X:125141904-125141926 TCACACAGCTAGGAAGTGGAGGG - Intergenic
1197870297 X:131057935-131057957 CCCCAAAGGCTGGAATTTGAAGG - Intergenic
1199729795 X:150620794-150620816 TCCCAGAGGAAGGAATTTGAGGG - Intronic
1200018175 X:153181026-153181048 TACCACAGGCAGGAAGTTGGGGG + Intronic
1200096697 X:153667924-153667946 TCCCCAAGGCAGGATTTGCAGGG + Intergenic
1200244032 X:154513240-154513262 TTTCAGAGGCAGGAAGTTGAGGG - Intronic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic