ID: 950667647

View in Genome Browser
Species Human (GRCh38)
Location 3:14506854-14506876
Sequence CTGTCCACACTGGGCACAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 253}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950667638_950667647 16 Left 950667638 3:14506815-14506837 CCACCCTCGGTGGCCGAGCTGTC 0: 1
1: 0
2: 14
3: 50
4: 140
Right 950667647 3:14506854-14506876 CTGTCCACACTGGGCACAGCCGG 0: 1
1: 0
2: 3
3: 39
4: 253
950667643_950667647 -7 Left 950667643 3:14506838-14506860 CCAAGACTCCACAGCACTGTCCA 0: 1
1: 0
2: 1
3: 25
4: 231
Right 950667647 3:14506854-14506876 CTGTCCACACTGGGCACAGCCGG 0: 1
1: 0
2: 3
3: 39
4: 253
950667640_950667647 12 Left 950667640 3:14506819-14506841 CCTCGGTGGCCGAGCTGTCCCAA 0: 1
1: 0
2: 0
3: 1
4: 95
Right 950667647 3:14506854-14506876 CTGTCCACACTGGGCACAGCCGG 0: 1
1: 0
2: 3
3: 39
4: 253
950667637_950667647 22 Left 950667637 3:14506809-14506831 CCAAAGCCACCCTCGGTGGCCGA 0: 1
1: 0
2: 0
3: 2
4: 72
Right 950667647 3:14506854-14506876 CTGTCCACACTGGGCACAGCCGG 0: 1
1: 0
2: 3
3: 39
4: 253
950667634_950667647 25 Left 950667634 3:14506806-14506828 CCCCCAAAGCCACCCTCGGTGGC 0: 1
1: 0
2: 1
3: 12
4: 142
Right 950667647 3:14506854-14506876 CTGTCCACACTGGGCACAGCCGG 0: 1
1: 0
2: 3
3: 39
4: 253
950667639_950667647 13 Left 950667639 3:14506818-14506840 CCCTCGGTGGCCGAGCTGTCCCA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 950667647 3:14506854-14506876 CTGTCCACACTGGGCACAGCCGG 0: 1
1: 0
2: 3
3: 39
4: 253
950667641_950667647 3 Left 950667641 3:14506828-14506850 CCGAGCTGTCCCAAGACTCCACA 0: 1
1: 0
2: 0
3: 14
4: 166
Right 950667647 3:14506854-14506876 CTGTCCACACTGGGCACAGCCGG 0: 1
1: 0
2: 3
3: 39
4: 253
950667636_950667647 23 Left 950667636 3:14506808-14506830 CCCAAAGCCACCCTCGGTGGCCG 0: 1
1: 0
2: 0
3: 6
4: 63
Right 950667647 3:14506854-14506876 CTGTCCACACTGGGCACAGCCGG 0: 1
1: 0
2: 3
3: 39
4: 253
950667635_950667647 24 Left 950667635 3:14506807-14506829 CCCCAAAGCCACCCTCGGTGGCC 0: 1
1: 0
2: 1
3: 21
4: 186
Right 950667647 3:14506854-14506876 CTGTCCACACTGGGCACAGCCGG 0: 1
1: 0
2: 3
3: 39
4: 253
950667642_950667647 -6 Left 950667642 3:14506837-14506859 CCCAAGACTCCACAGCACTGTCC 0: 1
1: 0
2: 4
3: 17
4: 234
Right 950667647 3:14506854-14506876 CTGTCCACACTGGGCACAGCCGG 0: 1
1: 0
2: 3
3: 39
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950667647 Original CRISPR CTGTCCACACTGGGCACAGC CGG Exonic