ID: 950668799

View in Genome Browser
Species Human (GRCh38)
Location 3:14513050-14513072
Sequence GACTCTGGTCTGACTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950668799_950668813 23 Left 950668799 3:14513050-14513072 CCTGCTCTAGTCAGACCAGAGTC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 950668813 3:14513096-14513118 CTGTCGGCTAGTGTGGCGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 68
950668799_950668810 16 Left 950668799 3:14513050-14513072 CCTGCTCTAGTCAGACCAGAGTC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 950668810 3:14513089-14513111 CTCTTGGCTGTCGGCTAGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 52
950668799_950668807 7 Left 950668799 3:14513050-14513072 CCTGCTCTAGTCAGACCAGAGTC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 950668807 3:14513080-14513102 GAACCAGGCCTCTTGGCTGTCGG 0: 1
1: 0
2: 1
3: 20
4: 191
950668799_950668806 0 Left 950668799 3:14513050-14513072 CCTGCTCTAGTCAGACCAGAGTC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 950668806 3:14513073-14513095 GGGGCTGGAACCAGGCCTCTTGG 0: 1
1: 0
2: 2
3: 26
4: 387
950668799_950668805 -8 Left 950668799 3:14513050-14513072 CCTGCTCTAGTCAGACCAGAGTC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 950668805 3:14513065-14513087 CCAGAGTCGGGGCTGGAACCAGG 0: 1
1: 0
2: 4
3: 36
4: 393
950668799_950668816 29 Left 950668799 3:14513050-14513072 CCTGCTCTAGTCAGACCAGAGTC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 950668816 3:14513102-14513124 GCTAGTGTGGCGGGCGGGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 127
950668799_950668815 28 Left 950668799 3:14513050-14513072 CCTGCTCTAGTCAGACCAGAGTC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 950668815 3:14513101-14513123 GGCTAGTGTGGCGGGCGGGAAGG 0: 1
1: 0
2: 1
3: 19
4: 248
950668799_950668814 24 Left 950668799 3:14513050-14513072 CCTGCTCTAGTCAGACCAGAGTC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 950668814 3:14513097-14513119 TGTCGGCTAGTGTGGCGGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 53
950668799_950668812 20 Left 950668799 3:14513050-14513072 CCTGCTCTAGTCAGACCAGAGTC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 950668812 3:14513093-14513115 TGGCTGTCGGCTAGTGTGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 87
950668799_950668811 19 Left 950668799 3:14513050-14513072 CCTGCTCTAGTCAGACCAGAGTC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 950668811 3:14513092-14513114 TTGGCTGTCGGCTAGTGTGGCGG 0: 1
1: 0
2: 1
3: 3
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950668799 Original CRISPR GACTCTGGTCTGACTAGAGC AGG (reversed) Intronic
900383136 1:2395326-2395348 GTCTCTGGTCTGGCAGGAGCAGG - Intronic
901680818 1:10911736-10911758 GAGTCTGCTCTGACCTGAGCTGG + Intergenic
903221846 1:21873668-21873690 GACTCTGGCCTGGCTGGGGCAGG + Intronic
907516039 1:54994053-54994075 GACACTGGTCTGAGGAGAGGGGG + Intergenic
908633837 1:66139825-66139847 ACCTCTTCTCTGACTAGAGCTGG - Intronic
912210497 1:107551730-107551752 GACTCTAGTCTGGATAGAGAAGG + Intergenic
912313086 1:108642652-108642674 TACTCTGTCCTGACAAGAGCAGG - Intronic
915786370 1:158617262-158617284 GACTCTGATCTGCCCAGAGTGGG - Intronic
916028530 1:160856174-160856196 GATTTTGCCCTGACTAGAGCTGG - Intronic
917976355 1:180241664-180241686 AGCTCAGGTCTGACTAGATCTGG + Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922814866 1:228441381-228441403 GACTCTGTACTGACTGCAGCTGG + Intergenic
1062786378 10:268776-268798 GACACTGGTGTGACTGGAGAGGG + Intergenic
1063076915 10:2726245-2726267 GATGCTGATTTGACTAGAGCAGG - Intergenic
1066416514 10:35226735-35226757 GAGTATGGTATGTCTAGAGCTGG + Intergenic
1067087408 10:43250236-43250258 GACACTGGTTTCACTACAGCTGG + Intronic
1073678742 10:105679264-105679286 GATTCTGCTCTGACTAGGGCTGG - Intergenic
1074963800 10:118471293-118471315 CTCTGTGGTCTGACTGGAGCTGG - Intergenic
1076130236 10:128008933-128008955 GTCTCTGGTCTGGCTGGGGCTGG + Intronic
1076156645 10:128210466-128210488 GTCTCTGCTCCCACTAGAGCGGG + Intergenic
1076537344 10:131188088-131188110 GACTCTGGTGCAATTAGAGCTGG + Intronic
1076856259 10:133116793-133116815 GACTCGGAACTGACCAGAGCTGG - Intronic
1083069042 11:59957504-59957526 CACTAAGTTCTGACTAGAGCTGG + Intergenic
1083595277 11:63916008-63916030 GACTGAGGTCTGGCTGGAGCAGG - Intronic
1085206039 11:74732393-74732415 GTTTCTGGTCTGGCCAGAGCTGG - Intergenic
1085829281 11:79882745-79882767 CACTCTGGTATGACTATGGCAGG - Intergenic
1089270575 11:117299149-117299171 GGCTCTGGTCTGACTGAAGGTGG - Intronic
1091243283 11:134069333-134069355 GACTCGGGCCTGGCTAGGGCGGG + Intronic
1095917082 12:47490617-47490639 CACTCAGGTCTGTTTAGAGCAGG + Intergenic
1100107021 12:91188065-91188087 GACTCTGGTCTGAGCAATGCTGG + Intergenic
1109928688 13:69183716-69183738 GACGAAGGTCTGACAAGAGCTGG + Intergenic
1110694139 13:78467707-78467729 CACACTGGTCTAACTAAAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1114783836 14:25570841-25570863 GACTCTCCTCTGGCTAGGGCTGG + Intergenic
1117634739 14:57729898-57729920 GATTCTCCTCTCACTAGAGCTGG + Intronic
1118750899 14:68807320-68807342 GCCTTTGGTCAGACAAGAGCAGG - Intergenic
1122298945 14:100720990-100721012 GACTCTGGTATGACAAAAGAGGG + Intergenic
1122760781 14:104023851-104023873 GAGTCTGACCTCACTAGAGCAGG - Intronic
1128600645 15:68992812-68992834 GCTTCTGGGGTGACTAGAGCAGG + Intronic
1131458164 15:92599232-92599254 GACTCTGCAGTGACTTGAGCCGG - Intergenic
1131531895 15:93200794-93200816 GTCTCTTCTCTGACTGGAGCTGG + Intergenic
1132878315 16:2149893-2149915 GAGTCTGGTCTGCCCTGAGCTGG - Intronic
1134250910 16:12573193-12573215 GGATCCGGTCTGCCTAGAGCCGG - Exonic
1135586340 16:23674438-23674460 GAGTCTGGTCTGTCAAAAGCAGG - Exonic
1141848159 16:86625385-86625407 CAATCTGGTCTGACCAGACCTGG - Intergenic
1145251164 17:21297776-21297798 GACTCTGGCCTGCCTGGTGCAGG + Intronic
1149013274 17:51880094-51880116 GGCTCTGGGGTGATTAGAGCAGG - Intronic
1150460496 17:65346292-65346314 GACTCTGGTCCTACTGGAGCTGG - Intergenic
1152054951 17:78017326-78017348 CACCCTGGTCTGAACAGAGCAGG - Intronic
1152523302 17:80872954-80872976 GAGCCTGGTCAGCCTAGAGCGGG + Intronic
1153792787 18:8595169-8595191 GACTCTGGTTTCATTAGAGCTGG + Intergenic
1158352881 18:56581581-56581603 GACTTTTGTCTGTCTAGATCTGG - Intergenic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1167521621 19:49959097-49959119 GCCCCTGGTCTGTCTAGAGCCGG - Intronic
1167523760 19:49971625-49971647 GTCCCTGGTCCGTCTAGAGCCGG + Intergenic
1167756303 19:51415635-51415657 GCCCCTGGTCCGTCTAGAGCCGG - Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
925346590 2:3176184-3176206 GAGTCTGGCCTGACTCCAGCTGG + Intergenic
929877517 2:45808971-45808993 GATTCTGGGCAGATTAGAGCCGG - Intronic
935627525 2:105183679-105183701 GACCCTTGTCTGCCTAGACCTGG + Intergenic
936171879 2:110184104-110184126 GAATCTGGTGTGATTAAAGCTGG + Intronic
939669081 2:144987469-144987491 GACTCTGGTCAGAGGAGAGGAGG - Intergenic
943077468 2:183213007-183213029 GACACTTGCCTGACCAGAGCAGG + Intergenic
948334449 2:237196363-237196385 GACTCTGGTGTAACAGGAGCAGG + Intergenic
1172122972 20:32609434-32609456 AACCCTGGTCTCCCTAGAGCTGG + Intergenic
1172257185 20:33529402-33529424 AACTCTGGTTTAACTAGTGCAGG + Intronic
1173890329 20:46503643-46503665 GATTGTGGGCTGAGTAGAGCTGG + Intronic
1174463644 20:50700581-50700603 GATTCTCCTCTGACTAGGGCTGG - Intergenic
1175032830 20:55972464-55972486 GACTGTAGTCTGTCCAGAGCAGG + Intergenic
1175740482 20:61416685-61416707 GGGTCTGGTCTGAGCAGAGCTGG - Intronic
1175804581 20:61820450-61820472 GACTTTGGTTTGACCAGAACAGG - Intronic
1180144732 21:45912828-45912850 GGGTCTGGGCTGACTTGAGCTGG - Intronic
1182617904 22:31600882-31600904 GACTGTGTTCTGACTAGAAGTGG + Intronic
1185150467 22:49161104-49161126 GTCTCTGGGCCGACAAGAGCTGG - Intergenic
949258391 3:2077802-2077824 GAATCTTGTCTGACTACAACAGG + Intergenic
950668799 3:14513050-14513072 GACTCTGGTCTGACTAGAGCAGG - Intronic
951865554 3:27303038-27303060 GACCCTGGGCTGACTGCAGCTGG - Intronic
954139298 3:48596614-48596636 GACTCTGGTGTGGCCAGAGCTGG + Intergenic
961033991 3:123629623-123629645 GACTCTGGAGAGACAAGAGCAGG + Exonic
967205624 3:187118136-187118158 GACTCTGAGCTGAGTTGAGCTGG - Intergenic
970148928 4:13068786-13068808 GACTCTGTTGTGCCTAGAGAGGG + Intergenic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
973919924 4:55674214-55674236 GACTCCCCTCTGACTAGGGCTGG + Intergenic
974907512 4:68076448-68076470 CACTCTGGTCTGACAATATCAGG + Intronic
979155951 4:117391572-117391594 GATTCTCCTCTGGCTAGAGCTGG - Intergenic
987047079 5:14118438-14118460 GACTCTGATCTGGATATAGCAGG + Intergenic
990902836 5:60771773-60771795 GAAACTGATCTCACTAGAGCAGG - Intronic
992745437 5:79815838-79815860 GACTGTGGCCTGACTAGATGGGG + Intergenic
993943916 5:94095911-94095933 GACTCTGGTCTCAGAAGAGATGG - Intronic
998414416 5:141935743-141935765 CACGCTGGTCTGATTAAAGCAGG - Intronic
1001764673 5:174236095-174236117 GACTCTCGACTGACAAAAGCTGG - Intronic
1003585813 6:7388245-7388267 GAGCCTGATCTGAGTAGAGCAGG - Intronic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1009868255 6:69424890-69424912 GACTCTGGTCTGAATGTGGCAGG - Intergenic
1013603189 6:111724404-111724426 GACTGTGGTCTGTCTACATCAGG - Intronic
1020388013 7:7628865-7628887 GGCTCTCCACTGACTAGAGCAGG - Intergenic
1022998588 7:35784394-35784416 GACTCTAGTCTGACTTAAGCTGG + Intergenic
1023282477 7:38585269-38585291 GACTCAGGTCTGACTCGAGGTGG + Intronic
1023584985 7:41719827-41719849 GGCTCTGATCTGCCTAGACCAGG - Intergenic
1025823535 7:64993186-64993208 GCTTCTGGGGTGACTAGAGCAGG + Exonic
1028522123 7:91742946-91742968 GATTCCCCTCTGACTAGAGCTGG + Intronic
1033109153 7:138559552-138559574 GCTTCTGGGGTGACTAGAGCCGG + Intronic
1035237259 7:157506552-157506574 GACTCTGGGCGGACTCTAGCTGG - Intergenic
1036037939 8:5040688-5040710 GACTCTGGAATGCCTAGCGCTGG + Intergenic
1041394403 8:57376469-57376491 GACAGTGTTCTGACTGGAGCAGG - Intergenic
1042347185 8:67739653-67739675 TTCTCTGATCTGACTAGATCTGG + Intronic
1043033749 8:75170911-75170933 GACTCTGGTCAGATTAAATCAGG - Intergenic
1045185456 8:99832570-99832592 AACTCTGGTCTAACTATAGCTGG - Exonic
1046407297 8:113790949-113790971 GACTCTTCTCTGACGACAGCTGG - Intergenic
1048141147 8:131795822-131795844 GACTGTGGTCTACCTAGACCAGG + Intergenic
1048568871 8:135633289-135633311 CAGCCTGGTCTCACTAGAGCAGG + Intronic
1049290686 8:141800068-141800090 GGCTCTGGTCTGTCCACAGCAGG + Intergenic
1059164322 9:112064114-112064136 GACTCAGGTTTGCCTAGAGATGG - Intronic
1059230121 9:112712901-112712923 GACTATGGTATGCCTAGAGGTGG - Intronic
1059359564 9:113730882-113730904 GACACTGGTCTTACTAGACAAGG - Intergenic
1061809085 9:133152061-133152083 GACTCTGGTCATACTGGAACGGG - Intergenic
1187724986 X:22192813-22192835 GACTCTGGTCAGAGGACAGCCGG + Intronic
1194090806 X:89580687-89580709 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1196444927 X:115840918-115840940 GAATCCGGTCTTCCTAGAGCCGG - Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1199218013 X:145283025-145283047 GACTCTCCTCTGGCTAGAGCTGG + Intergenic
1199363978 X:146956885-146956907 GATTCCTCTCTGACTAGAGCTGG - Intergenic
1200279106 X:154761870-154761892 GCCTGTGGACTGACTAGATCTGG + Intergenic
1200443458 Y:3236747-3236769 GCTTCTGGGGTGACTAGAGCAGG + Intergenic