ID: 950670131

View in Genome Browser
Species Human (GRCh38)
Location 3:14521019-14521041
Sequence TGGTGGCTAAGGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 654}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950670131_950670143 30 Left 950670131 3:14521019-14521041 CCTTCTCCCCTCCTTAGCCACCA 0: 1
1: 0
2: 4
3: 65
4: 654
Right 950670143 3:14521072-14521094 ACAGCTGCTGCCGCTTCCTATGG 0: 1
1: 0
2: 1
3: 16
4: 160
950670131_950670140 7 Left 950670131 3:14521019-14521041 CCTTCTCCCCTCCTTAGCCACCA 0: 1
1: 0
2: 4
3: 65
4: 654
Right 950670140 3:14521049-14521071 TCAGTCCCTTAGCTCTCGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950670131 Original CRISPR TGGTGGCTAAGGAGGGGAGA AGG (reversed) Intronic
900135567 1:1115716-1115738 GGGTCCCTAAGGAGGGGAGGGGG - Intronic
900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG + Intergenic
901062049 1:6476067-6476089 TGCAGGCTAAGGAGGGGCGGGGG - Intronic
901428095 1:9196281-9196303 GGGGGGCTAAGGAGAGGTGACGG - Intergenic
901695604 1:11005655-11005677 TGGTGGGTAATTGGGGGAGATGG + Intergenic
902477818 1:16697425-16697447 TGGTGGCGAGGGAGGGGAGCAGG - Intergenic
902550834 1:17218754-17218776 TGGGTGCAAGGGAGGGGAGAAGG + Intronic
903475789 1:23618476-23618498 TTGTAGCTCAGGTGGGGAGAGGG - Intronic
903684353 1:25120090-25120112 AGGGGGCTCAGGAGGGAAGAAGG - Intergenic
903691777 1:25179282-25179304 TGGAGGCTATGCTGGGGAGAAGG - Intergenic
904404588 1:30277631-30277653 TGATTGCTGAGGAGGGGACAGGG + Intergenic
904476260 1:30766479-30766501 TGATGGAGAGGGAGGGGAGACGG - Intergenic
904590561 1:31613020-31613042 TGGTGGGAAAGGTGGGGAGCTGG - Intergenic
904756363 1:32770796-32770818 TGGTGGCTCAGAAGGGGCGGGGG + Exonic
904848550 1:33439357-33439379 TGGGGGCTAAGATGGGGAGCAGG + Intergenic
905230721 1:36513594-36513616 TGGAGGCCAAGGGGAGGAGAAGG - Intergenic
905349884 1:37338126-37338148 AGGAGGAGAAGGAGGGGAGAGGG + Intergenic
905985177 1:42274093-42274115 TGGTGGCTAGGGAGTAGAAATGG - Intronic
906686379 1:47765946-47765968 TGGTGGCGATGGCGGGGAGAAGG + Exonic
906687587 1:47772424-47772446 TGGTGGCTGAGGCGGAAAGAAGG + Intronic
906951824 1:50341073-50341095 TGGGGGTGAAGGAGGGGAGTGGG - Intergenic
907115112 1:51961283-51961305 TGGTAGAAAAGGAGGGGAGCTGG + Intronic
907352753 1:53846543-53846565 TGGAGGATAAGAAGGGGAGGAGG - Intergenic
907449558 1:54535478-54535500 GGGAGGCCAAGGAGGGCAGATGG + Intergenic
907553801 1:55327251-55327273 AGGTGGAGAAGGAGGGAAGAAGG + Intergenic
907589008 1:55647745-55647767 TGGGAGGTGAGGAGGGGAGAAGG + Intergenic
908789753 1:67769965-67769987 TGGGAGGGAAGGAGGGGAGATGG + Intronic
910049509 1:82958250-82958272 TGGTCGCTAAGGAGGGAGTAGGG - Intergenic
910197001 1:84652316-84652338 TGGAGGCTGAGGAGGGAGGATGG + Intronic
910344249 1:86217471-86217493 TGGGGACTCAGGAGGGAAGATGG + Intergenic
911165672 1:94722353-94722375 TGGTGGGAAAGGAGGGGACAGGG + Intergenic
911731842 1:101299684-101299706 TGGGGGCCAAGGTGGGAAGATGG - Intergenic
912155131 1:106908951-106908973 AGCTGGCTAGGGAGGGAAGAGGG + Intergenic
912260762 1:108109921-108109943 TGGTGGGGGAGGAGGGGAGTTGG - Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912723443 1:112039191-112039213 TGGTGGTTCAGGAGGGAAGCAGG - Intergenic
913017876 1:114757648-114757670 TGGTGACTAAAGTGGGGGGAGGG - Intronic
914214360 1:145611335-145611357 TGGGGGCAGGGGAGGGGAGAAGG - Intronic
914329912 1:146658171-146658193 TGGTGGCTGAGGTGGGAGGATGG - Intergenic
914466298 1:147931728-147931750 TGGGGGCAGGGGAGGGGAGAAGG - Intronic
914758908 1:150583056-150583078 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
914802446 1:150971514-150971536 TGGGGGAGGAGGAGGGGAGAAGG - Intronic
914986715 1:152464319-152464341 TGGTGGGGGGGGAGGGGAGAGGG - Intergenic
915106593 1:153538537-153538559 TGGAGGTTAATGAGGGCAGAGGG - Intronic
915243792 1:154542330-154542352 TGGAGGCTGAGGAGGGAGGATGG - Intronic
915461702 1:156074599-156074621 TTGTGGGTAAAGAGTGGAGAGGG + Exonic
915583743 1:156831887-156831909 TGGTGGCTGAGGAGGAGTCATGG + Intronic
915847681 1:159285097-159285119 AGGTGAGTTAGGAGGGGAGATGG + Intergenic
916093412 1:161327166-161327188 GGGAGGCTAAGGTGGGCAGACGG - Intronic
916323624 1:163533316-163533338 TGGTAGCAAAGAAGGGGAGGTGG + Intergenic
916503754 1:165409157-165409179 TGGGGGCCAAGGATGGGAAAGGG - Intronic
917114762 1:171591763-171591785 TGGTGGCTATGGAGGGTGCAGGG - Exonic
917165103 1:172103122-172103144 TGGTAGCTATGGAGGTGAGTGGG - Intronic
917349684 1:174063954-174063976 TGGTGGCTGAGGTGGGAAGATGG + Intergenic
917505994 1:175627685-175627707 GGGTGGGTAAGGATGGGGGATGG - Intronic
918992648 1:191717569-191717591 AGTTGGCTAAGGCTGGGAGAGGG + Intergenic
919478945 1:198062852-198062874 GGGAGGCTAAGGTGGGAAGATGG + Intergenic
919887627 1:201946383-201946405 TGGTGGGCAGGGAAGGGAGAGGG + Exonic
920150840 1:203906084-203906106 TGGTGGCTGGGGAGGGGAGTAGG + Intergenic
920724673 1:208422981-208423003 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
921018814 1:211217424-211217446 TGGAGGCTGAGGTGGGAAGATGG - Intergenic
922209925 1:223479048-223479070 TGGGGGGTGAGGAGGTGAGAGGG + Intergenic
922505718 1:226124258-226124280 TGGTGGCTCAGGAAGGCAGCTGG + Intergenic
922892633 1:229073382-229073404 TGGAGGCTTAGGAGGGAAGGAGG + Intergenic
922976733 1:229791146-229791168 TGGTGCCTATGGTGGGAAGAAGG - Intergenic
923083309 1:230681034-230681056 TGGTGGCTGGGGTGGGGAGGTGG - Intronic
923356829 1:233164865-233164887 TAGAGGCTGGGGAGGGGAGAAGG + Intronic
924525043 1:244838755-244838777 AGGTGGCTGATGAGAGGAGAGGG + Intronic
1064193371 10:13226410-13226432 TGGAGGCTAAGGCAGGGGGATGG - Intronic
1064302791 10:14137701-14137723 TGATGGCTAATGAAGAGAGATGG - Intronic
1064484087 10:15766986-15767008 TGGAGGCCAAGGTGGGCAGATGG - Intergenic
1064736008 10:18382532-18382554 TGGTGGGTGGGGAAGGGAGAAGG - Intronic
1065449549 10:25842492-25842514 TGATGGGTCAGGAGGGGAAAGGG - Intergenic
1065674107 10:28155878-28155900 TGGTGGCTGCTGAGAGGAGATGG - Intronic
1067131145 10:43566523-43566545 GGGAGGCTAAGGCGGGCAGATGG - Intronic
1067836231 10:49643557-49643579 GGATGCCTAAGGAGGGGAGAAGG + Intronic
1068512052 10:57978974-57978996 GAGAGACTAAGGAGGGGAGAGGG + Intergenic
1068822053 10:61388694-61388716 TGGTGTCTAGTGAGGGGAAACGG - Intergenic
1071305987 10:84299139-84299161 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
1071669873 10:87598357-87598379 GGGAGGCTAAGGCGGGCAGATGG + Intergenic
1071863648 10:89701737-89701759 TGGGGCCTAAGGTGGGGAAACGG + Intronic
1072231279 10:93416005-93416027 TGGTGGACTAGGAGGGCAGAGGG - Intronic
1072646031 10:97255045-97255067 TGGTTGCCAAGGATGGGAGGAGG + Intronic
1072731670 10:97850501-97850523 TGGGGGCTCAGGTGGGGCGAGGG - Intronic
1073303614 10:102485961-102485983 TGGAGGACAAGGAGGGGAGTTGG - Intronic
1073928363 10:108544290-108544312 TGGTAGCCAAGGTGGAGAGAGGG + Intergenic
1075312310 10:121424701-121424723 TGGTGTGGAAGGAGGGTAGAGGG + Intergenic
1075382470 10:122030595-122030617 TGAAGACTGAGGAGGGGAGATGG - Intronic
1075433478 10:122411277-122411299 AGGTGGAGAAGGAAGGGAGAGGG + Intronic
1075447230 10:122521550-122521572 TGGTGGGTGAGGGGAGGAGACGG - Intergenic
1076886059 10:133262949-133262971 ACGTGGCCAAGGCGGGGAGAAGG + Exonic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077106362 11:844173-844195 TGGTGGCTGTGGAGGTGAGGGGG + Intronic
1077198592 11:1293793-1293815 TGGCGGCTGAGGACGGGTGATGG + Intronic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1078233919 11:9466678-9466700 GGGAGGCCAAGGAGGGAAGACGG - Intronic
1080224297 11:29943389-29943411 AGGTGGATGAGGAGAGGAGAAGG - Intergenic
1080510707 11:32967311-32967333 TGGAGACTCAGAAGGGGAGAGGG + Intronic
1080840135 11:35976358-35976380 TGGTGGGAAAGGAGGGTAGGAGG + Intronic
1080972465 11:37294841-37294863 TAGAGGGTCAGGAGGGGAGAGGG + Intergenic
1081326026 11:41745463-41745485 GGGTGCCTAAGGCTGGGAGATGG + Intergenic
1081611851 11:44567615-44567637 TGGTGCCTGAGGTGGGGAGGAGG + Intronic
1081652472 11:44833663-44833685 TGATGGCTGGGCAGGGGAGAGGG + Intronic
1082811764 11:57482825-57482847 AGATGGCTGGGGAGGGGAGAGGG - Intergenic
1082900956 11:58251581-58251603 TGGGGGTTGAGGTGGGGAGATGG - Intergenic
1083139042 11:60706501-60706523 TGGGGGCTCTGGAGGGGAGAAGG - Intronic
1083316908 11:61821003-61821025 AGGTGGGTAAGGAGATGAGAGGG - Intronic
1083427574 11:62596527-62596549 GGGTAGCTAAGGGGGGCAGAGGG + Exonic
1083584557 11:63847322-63847344 TGGTAGGAGAGGAGGGGAGATGG + Intronic
1083831422 11:65236315-65236337 TGGAGCCTCAGGAGGGGATAGGG - Intergenic
1083850381 11:65362575-65362597 GGGAGGCCAAGGAGGGGAGGAGG + Intergenic
1083926384 11:65809531-65809553 TGGAAGCTAAGGAGGGGACTGGG - Intergenic
1084004859 11:66317235-66317257 TGGGGGCGGAGGAGGGGAGAAGG + Intergenic
1084584428 11:70049074-70049096 TGGTGGCTTATGAGAGGAGCTGG + Intergenic
1084935579 11:72584863-72584885 TGGTGGATGATGAGGTGAGAGGG - Exonic
1086095524 11:83046596-83046618 AGGAGACTAAGGTGGGGAGATGG - Intronic
1086281535 11:85195131-85195153 TAGTGGCTGAGGGTGGGAGATGG + Intronic
1086438414 11:86803921-86803943 TGGAGGCAAAGGAGGGGGAAAGG - Intronic
1087037244 11:93767842-93767864 TGGAGGCTAAGGTGGGAGGATGG - Intronic
1087367053 11:97233373-97233395 TGGTGGCTGAGGTGGGAGGATGG - Intergenic
1088276428 11:108091449-108091471 GGGAGGCTGAGGAGGGCAGATGG + Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088781110 11:113135114-113135136 TGGGAGCTAAGGAGGTGAGTGGG + Intronic
1089109031 11:116040078-116040100 TGGAGGCTAAGGGTAGGAGAAGG - Intergenic
1090202469 11:124866212-124866234 TGTTTGCTACGGAGGGGATAGGG + Intronic
1091387301 12:103427-103449 GGTTGGCTCAGGAGGGGAGGCGG + Intronic
1091387333 12:103504-103526 TGGGGGCTCAGGAGGGGAGGTGG + Intronic
1091387361 12:103579-103601 TGGGGGCTCAGGAGGGGAGGTGG + Intronic
1091387403 12:103692-103714 TGGGGGCTCAGGAGGGGAGGTGG + Intronic
1091668999 12:2439025-2439047 TGGGGGCAATGGAGTGGAGAGGG - Intronic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1092049806 12:5460345-5460367 TGGTGGCAGAGGAGGGAGGAGGG - Intronic
1093084727 12:14854127-14854149 TGGCAGCTGAGGAGGGAAGATGG - Intronic
1095747394 12:45675023-45675045 TGGTGGCTAGGGTGAAGAGAAGG + Intergenic
1096284383 12:50285422-50285444 GGGAGGCTAAGGCGGGAAGATGG + Intergenic
1096340694 12:50796287-50796309 TAGAGGCTAAGGCGGGAAGATGG + Intronic
1096464650 12:51841595-51841617 TGGTGGCTAAGTGTGGGAGGGGG - Intergenic
1096803328 12:54126104-54126126 TGGGGGCTGAGGAGGGGCTAAGG + Intergenic
1097023651 12:56037685-56037707 CAGGTGCTAAGGAGGGGAGAGGG + Exonic
1097501178 12:60404563-60404585 TGGGGGCTGAGGTGGGAAGAAGG + Intergenic
1097687516 12:62704718-62704740 TTGTGGCTAAGGAGATGAGCAGG - Intronic
1097737136 12:63194772-63194794 AAGTGGCCAGGGAGGGGAGATGG - Intergenic
1097962676 12:65547751-65547773 TGGAGGCTAAGGGGTGGGGAGGG - Intergenic
1099722040 12:86376144-86376166 GGGAGGCCAAGGAGGGCAGATGG + Intronic
1099732744 12:86526142-86526164 TGGTTGCTCAGGATGGGGGAGGG + Intronic
1100619508 12:96257542-96257564 TGATGGCCATGGAGGAGAGAAGG + Intronic
1100987866 12:100221688-100221710 GGGTGGCCAAGGTAGGGAGATGG + Intronic
1101201043 12:102436602-102436624 TTGTGGCAAAGGAGGGTGGAAGG + Intronic
1101323907 12:103697976-103697998 TGGTGTCTTATGAGCGGAGAGGG + Intronic
1101373417 12:104150927-104150949 TGGTGGTTGGGGAGGGGAGTTGG - Intergenic
1101443704 12:104722240-104722262 GGGAGGCTAAGGCGGGCAGATGG - Intronic
1101519615 12:105469283-105469305 TGGTGACTCAGGAGGCTAGAGGG + Intergenic
1101722292 12:107360510-107360532 TGCTGGCTGGGGAGGGGAGGTGG - Intronic
1101815382 12:108142080-108142102 AGGTGACAAAGGAAGGGAGACGG - Intronic
1101852349 12:108414020-108414042 TGGGGGCAAAGCAGGGAAGAGGG + Intergenic
1102591518 12:113959830-113959852 TGTTGCCCAAGGAGGAGAGAGGG - Intronic
1102676531 12:114663276-114663298 TGGTGGCAGTGGAGAGGAGAGGG + Intergenic
1102702812 12:114854443-114854465 TGACCCCTAAGGAGGGGAGAGGG + Intergenic
1102795735 12:115687489-115687511 TGATGGCCAAGGAGGGAAAATGG - Intergenic
1102882077 12:116493216-116493238 GGGAGGCTGAGGTGGGGAGATGG + Intergenic
1103390343 12:120568138-120568160 GGGAGGCTGAGGTGGGGAGATGG + Intronic
1103589403 12:121980585-121980607 GGGAGGCTAAGGAGGGTGGATGG - Intronic
1105323617 13:19350440-19350462 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1105496752 13:20937013-20937035 TGTTGGCTGGGGAGGTGAGAAGG + Intergenic
1105543292 13:21333377-21333399 AGGTGGCCAATGAGGGGAGGAGG - Intergenic
1105870329 13:24499057-24499079 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1106154055 13:27135820-27135842 AGCTAGCTAGGGAGGGGAGAAGG + Intronic
1106501879 13:30336684-30336706 TGGAGGCACTGGAGGGGAGAAGG - Intergenic
1107621263 13:42232887-42232909 AGGAGGCTTAGGAGGGAAGATGG + Intronic
1108150340 13:47527203-47527225 TGTGGACTAAGGAGGGGAGAAGG + Intergenic
1109793738 13:67283059-67283081 GGGAGGCTAAGGTGGGAAGATGG - Intergenic
1110451558 13:75642363-75642385 GGGAGGCTAAGGAGGGAGGATGG + Intronic
1110639593 13:77806894-77806916 TCTTGGCTAAGGAGCAGAGAGGG + Intergenic
1110756505 13:79181034-79181056 TGGAGGCTAAGGTGGGAGGATGG - Intergenic
1110956405 13:81558468-81558490 GGGAGGCCAAGGAAGGGAGATGG + Intergenic
1111876381 13:93902220-93902242 CAGAGGCTGAGGAGGGGAGAGGG - Intronic
1112458310 13:99581790-99581812 TGGTGGCCCAGGAAGGGTGATGG + Intergenic
1112566197 13:100552982-100553004 GGGTGGCTGGGGAGGGGAGGGGG + Intronic
1112598247 13:100829915-100829937 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
1112731834 13:102371421-102371443 TGCTGGCTAAGAAGGGAATAAGG - Intronic
1113460068 13:110476092-110476114 TGGGGGCTGAGCAGGCGAGATGG - Intronic
1113572146 13:111365717-111365739 TGGTTGCAAAGGAAGTGAGAAGG - Intergenic
1114716160 14:24827094-24827116 TGGAGGCTGAGGTGGGAAGATGG + Intronic
1115330167 14:32188526-32188548 GGGTGGCTAAGGTGGGAGGATGG + Intergenic
1116243602 14:42379397-42379419 TGGTCGCTCAGGAGAGGGGAGGG - Intergenic
1116945884 14:50834812-50834834 TGGGGGCTAAGGTGGGTGGATGG + Intergenic
1117154134 14:52920837-52920859 AGGTGGCTGAGGTGGGAAGATGG + Intronic
1117247517 14:53900692-53900714 TGGTGGCTTGGGAGGGGTGTTGG - Intergenic
1117590744 14:57265618-57265640 TGGAGGCTAAGGTGGGCAGATGG + Intronic
1118321876 14:64758133-64758155 GGGTGGATAGGGAGGGGTGAAGG - Intronic
1118594650 14:67426276-67426298 TAGTTGCTGAGGAGGGTAGAGGG + Intergenic
1118856672 14:69628805-69628827 TGGGGGCTGAGGTGGGGAGGCGG - Intronic
1118881929 14:69836216-69836238 TGGTGTGAAAGGAGGGGACAGGG - Intergenic
1118908404 14:70040790-70040812 TGGAGACAAAGGAGAGGAGAAGG + Intergenic
1119328817 14:73778665-73778687 GGGAGGCTGAGGAGGGGACATGG + Intronic
1119644937 14:76341311-76341333 TGGTGGCTGGGGAGGGGACGAGG - Intronic
1119705829 14:76782005-76782027 TGCTGGCTGAGGAGGGGTCAAGG + Exonic
1120636178 14:86954041-86954063 TGTTTGCTAAGGAGCAGAGATGG + Intergenic
1120647050 14:87086736-87086758 TGGTGGTTGGGGTGGGGAGAAGG + Intergenic
1121023860 14:90600059-90600081 TGGGGGCTGAGGACGGGAGGAGG + Intronic
1121202157 14:92127149-92127171 TGTGGGCACAGGAGGGGAGAAGG + Intronic
1121691938 14:95884283-95884305 TGGTGGGAGAGGAGGTGAGATGG - Intergenic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1123019513 14:105391112-105391134 TGGTGGCCACGGTGGGGAGGCGG + Intronic
1124031551 15:26016815-26016837 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
1124156138 15:27226543-27226565 TGGTGGCTCAGGCCGGGAGCAGG - Intronic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125716451 15:41822462-41822484 AGGTAGGCAAGGAGGGGAGAAGG - Intronic
1126512198 15:49490449-49490471 TAGTGGCTAAGGAGTGGCAATGG + Intronic
1126581285 15:50244732-50244754 GGTTGCCTAAGGAGGGGTGAAGG - Intronic
1126687295 15:51259538-51259560 AGGTGGCTAAGGAAGGGTCAGGG + Intronic
1126788609 15:52199729-52199751 TGGTGGCGAAGGAGGCCAGAAGG + Intronic
1127456084 15:59157397-59157419 TCATGGATAAGGAGGGGAGGGGG - Intronic
1127574482 15:60277297-60277319 AGGTGGGAAAGGATGGGAGAGGG + Intergenic
1128234717 15:66059657-66059679 TGCTGGCTGAGGAGTGGAGAGGG + Intronic
1128367014 15:67011619-67011641 TGGGGCCTAGGGAGGGGAAATGG - Intergenic
1129308292 15:74685153-74685175 GGGAGGCTAAGGTGGGCAGATGG + Intronic
1129690599 15:77711144-77711166 TGGTGGCAAAGGAGGAGCAAGGG - Intronic
1131009719 15:89006993-89007015 GGGAGGCTAAGGAGGGAGGATGG - Intergenic
1131012951 15:89033644-89033666 AGGAGGCTGAGGACGGGAGATGG - Intergenic
1132412255 15:101590596-101590618 TGATGGGTAAGGGGAGGAGACGG + Intergenic
1132763189 16:1520932-1520954 GGGTGGGTATGGAGGGGACAAGG + Intronic
1132940144 16:2502312-2502334 TGGTCACCACGGAGGGGAGAAGG + Exonic
1133012436 16:2921655-2921677 TGGAGGCTGAGGTGGGAAGATGG + Intronic
1133103806 16:3494427-3494449 TGGAGGCTTGGGAGTGGAGAAGG + Intronic
1134063265 16:11211549-11211571 TGGGGGTAAAGGAGGGGTGAGGG - Intergenic
1134185198 16:12079532-12079554 TTGTTGCTAAGGAAGGAAGAAGG + Intronic
1134371506 16:13630211-13630233 GGGAGGCTAAGGAGGGCAGATGG - Intergenic
1134604642 16:15560686-15560708 TGGAGGCTGAGGAGGGAGGATGG + Intronic
1134748481 16:16606614-16606636 GGGAGGCCAAGGAGGGGAGGGGG - Intergenic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1134908144 16:17999720-17999742 TGGGGGTTAAGGTGGGGGGAGGG + Intergenic
1134996983 16:18747002-18747024 GGGAGGCCAAGGAGGGGAGGGGG + Intergenic
1135117045 16:19732700-19732722 GGGAGGCCAAGGAGGGCAGATGG - Intronic
1135277781 16:21128307-21128329 TGGAGGCTAAGGAGAGAGGATGG + Intronic
1135282829 16:21167428-21167450 TGGAGCCTAAGGAGGAGAGGGGG + Intronic
1135623236 16:23974146-23974168 TGGTGGTGAGGGAGGAGAGAAGG + Intronic
1135681790 16:24463476-24463498 TGGGGGGAAAGGAGGGGAGATGG + Intergenic
1135873431 16:26173794-26173816 GGGAGGCTAAGGAGGGCAGATGG + Intergenic
1136007112 16:27338456-27338478 GGGAGGCTAAGGAGGGAGGATGG - Intronic
1136068730 16:27775657-27775679 TGGTGGAGAGGAAGGGGAGAGGG + Intronic
1136847925 16:33591478-33591500 GGGAGGCTAAGGTGGGAAGATGG - Intergenic
1137607820 16:49798266-49798288 TGGAGGCTGAGGTGGGCAGATGG + Intronic
1137722138 16:50633535-50633557 GGGGGGCTAGGGAGGGGAGGAGG - Exonic
1139121606 16:64025604-64025626 TGATGGCTGCTGAGGGGAGACGG - Intergenic
1139226348 16:65236045-65236067 TGCTGGCTCAGGAGGGGTGTTGG + Intergenic
1140003643 16:71052743-71052765 TGGTGGCTGAGGTGGGAGGATGG + Intronic
1140732876 16:77872231-77872253 AGGTGGGTACGCAGGGGAGAGGG - Intronic
1140941166 16:79722976-79722998 TGGTGGCGATGGTGGGGAGGGGG + Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141834510 16:86529842-86529864 TGGAGGCTGAGGAGGGAGGATGG + Intergenic
1142223457 16:88866240-88866262 AGCTGACTTAGGAGGGGAGAGGG - Intronic
1142400950 16:89858554-89858576 TGGGGGCCAAGGAAGTGAGAAGG + Intronic
1203109633 16_KI270728v1_random:1440127-1440149 GGGAGGCTAAGGTGGGAAGATGG - Intergenic
1142557664 17:790683-790705 TGGTGGCACAGGAGGTGAGCTGG - Intronic
1142557719 17:790892-790914 TGGTGGCACAGGAGGTGAGCTGG - Intronic
1142561311 17:811134-811156 AGGTGGCACAGGAGGGAAGAAGG + Intronic
1142595394 17:1027295-1027317 TGGTACCTAGGGAGGGTAGAAGG - Intronic
1142886139 17:2913071-2913093 TGGAGGCCAAGGTGGGAAGATGG + Intronic
1143550318 17:7626741-7626763 AGGTGGCTGAGGTGAGGAGATGG - Exonic
1144582295 17:16465830-16465852 TTGTTGCTTAGGAGGGGAAAAGG + Intronic
1144782046 17:17813359-17813381 CGGTGGCAAAGGAGGTGAGGGGG - Exonic
1145123040 17:20277931-20277953 TGGGGACTATGGAGAGGAGAAGG - Intronic
1145742274 17:27285325-27285347 TTGGGGGTAAGGAGAGGAGAGGG + Intergenic
1146002772 17:29141106-29141128 TGGCGTCTGTGGAGGGGAGAGGG - Intronic
1146725119 17:35150031-35150053 CGATGGCTATCGAGGGGAGACGG - Exonic
1147617408 17:41837699-41837721 GGGGTGGTAAGGAGGGGAGAAGG + Intronic
1147662605 17:42125081-42125103 GGGTGGGTAAGGGGGGGAGTGGG - Intronic
1147846363 17:43406850-43406872 TGGTGGCGGAGGTGGGCAGATGG + Intergenic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148904795 17:50905216-50905238 TGGGGACAGAGGAGGGGAGAGGG + Intergenic
1149261285 17:54882549-54882571 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
1149737903 17:59013765-59013787 TGGAGGCTGAGGTGGGAAGATGG - Intronic
1150451320 17:65271232-65271254 TGGTGGGAAAAGAGGGGAGAGGG + Intergenic
1150559548 17:66282789-66282811 TGGAGGCTAAAGAGGGTGGAGGG - Intergenic
1150734716 17:67727083-67727105 TGGTGGGTAAGGAGGCAAGGTGG - Intronic
1151447326 17:74175839-74175861 GCGTGGCCAAGGACGGGAGATGG - Intergenic
1151505144 17:74522540-74522562 TGGTGGCTCAGGAGAGGACCTGG + Exonic
1152627620 17:81395173-81395195 TGGTGGCGCAGGGCGGGAGAGGG - Intergenic
1154996126 18:21641906-21641928 GGGAGGCTAAGGTGGGAAGATGG + Intergenic
1156324952 18:36066911-36066933 TGGAGGATAAGGGAGGGAGAAGG - Intronic
1156500414 18:37554061-37554083 TTGTGGCTGAGGAGGGGAGAGGG + Intronic
1156886575 18:42141856-42141878 TGGTGGCAGGGGAGGGGAGATGG + Intergenic
1157472085 18:47997359-47997381 TGGTGGCTAGGGAGGGAGGCAGG + Intergenic
1157566019 18:48679858-48679880 GGGTGGCCTGGGAGGGGAGAGGG + Intronic
1157625309 18:49045787-49045809 TGGAGGCTAAGGAGGGGGTGGGG + Intronic
1157639679 18:49202035-49202057 TGTTGGGTAAGAAGGGAAGATGG - Intronic
1157972726 18:52288707-52288729 TGGTGGAGAAGGGTGGGAGAAGG + Intergenic
1158424525 18:57327153-57327175 GGGTGCCTCAGGGGGGGAGATGG - Intergenic
1158591750 18:58784416-58784438 TGGACGCTAAGCAGGAGAGATGG + Intergenic
1158597092 18:58826082-58826104 TGGAGGCTGAGGCGGGAAGATGG - Intergenic
1160621820 18:80176569-80176591 TGTTGGCCAGGGTGGGGAGAAGG + Intronic
1161011599 19:1961846-1961868 TGGCCGCTAAGCAGGGGTGAGGG + Intronic
1161503094 19:4628287-4628309 TGGTTGCTAAGGAAGAGAGTCGG + Intergenic
1161851792 19:6740974-6740996 TGGTGGGGGAGGAGGGGAGAGGG - Intronic
1162461462 19:10816501-10816523 AGGTGCCTGAGGCGGGGAGAAGG - Intronic
1162465805 19:10839237-10839259 TGGTAGCAAAAAAGGGGAGATGG + Intronic
1163102781 19:15107896-15107918 TGGAGGCGCAGGATGGGAGATGG + Intronic
1164745388 19:30608838-30608860 TGGTGCCTAAGGAGTGGGCATGG + Intronic
1164758683 19:30710433-30710455 TGGAGGCTAAGGCGGGAGGATGG + Intronic
1164768069 19:30787003-30787025 TGGGGGCCAAGGAGGGGGGTGGG + Intergenic
1165331979 19:35145103-35145125 AGGTGCAAAAGGAGGGGAGAGGG + Intronic
1166345948 19:42165855-42165877 TGGTGGGTAGGTAAGGGAGAAGG + Intronic
1166626606 19:44363072-44363094 TGGAGGCTGAGGTGGGAAGATGG - Intronic
1166749019 19:45155975-45155997 TGGGGGCCATGGAGGGCAGATGG - Intronic
1167685779 19:50955072-50955094 AGATGGCTCAGGAGTGGAGAGGG - Intergenic
1168671356 19:58243687-58243709 TCGTGACTAAGGAAGGGAGGTGG - Intronic
1202631919 1_KI270706v1_random:7986-8008 TGGTGTGGAAGGAGGGGGGAGGG - Intergenic
1202711836 1_KI270714v1_random:23251-23273 TGGTGGCGAGGGAGGGGAGCAGG - Intergenic
925303230 2:2831788-2831810 CGGTGGCTAATGAGAGGAGTGGG + Intergenic
925345101 2:3166495-3166517 CGGTGGCTAAGGGGGAGGGAGGG + Intergenic
925974489 2:9132163-9132185 TGGAGGCCAAGGAGGGAAGATGG + Intergenic
926876213 2:17482374-17482396 TGGTGGCAACGGAGGTGACAAGG + Intergenic
927394182 2:22630671-22630693 TGGTGAACAAGGAGAGGAGAGGG - Intergenic
927682145 2:25146725-25146747 TGGTGGCAAAGCAGGGGTGCAGG + Intronic
927881205 2:26691569-26691591 TGGTGGCTATGGTGGTGAGGTGG - Intergenic
927931378 2:27047340-27047362 GGGTGGCTGAGGTGGGAAGATGG - Intronic
929077491 2:38090462-38090484 TGGAGGCTGAGGTGGGAAGATGG - Intronic
929086792 2:38175980-38176002 TGGTTGCTAAAGAGGGGAGATGG + Intergenic
929571274 2:43024606-43024628 TGGAGCTGAAGGAGGGGAGATGG - Intergenic
929955102 2:46451817-46451839 TGGGGGCTTAGGTGGAGAGAAGG + Intronic
930181548 2:48364330-48364352 GGGAGGCTAAGGTGGGAAGATGG - Intronic
930369625 2:50486663-50486685 TGGGGCATGAGGAGGGGAGAGGG + Intronic
930928700 2:56853557-56853579 TGGTGCCTGGGGAAGGGAGAGGG - Intergenic
931123359 2:59245688-59245710 TGATGGCGGAGGAGGAGAGAAGG - Intergenic
931460544 2:62446795-62446817 TGGAGGGTAAGGTGGGGAGAGGG + Intergenic
932297798 2:70641571-70641593 TTATGGCAATGGAGGGGAGAAGG - Intronic
932399170 2:71467641-71467663 GGGTGTCTCAGGAGGGGAAAGGG + Intronic
932435173 2:71699196-71699218 TGGAGGAGAAGGAGGGGTGAGGG - Intergenic
932769539 2:74492823-74492845 AGGTGGCTAAGGAGGGGGCGGGG + Intronic
933701126 2:85256085-85256107 TCATGGCTCAGGAGGGGAGGAGG + Intronic
934588644 2:95527123-95527145 AGGTGGCCAAGGAGGAGAAACGG + Intergenic
934744361 2:96749257-96749279 GGGAGGCTGAGGAGGGAAGATGG + Intergenic
934897664 2:98132692-98132714 TGTAGGGCAAGGAGGGGAGATGG - Intronic
936168345 2:110143997-110144019 GGGTGGCTGAGGAGTGGAAATGG + Intronic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
936863938 2:117055951-117055973 TGGTGGCTGGGGAGGCCAGAAGG + Intergenic
937197682 2:120174214-120174236 GGGAGGCTGAGGAGGGCAGATGG + Intronic
937212813 2:120287655-120287677 TGGTGACTGAGGAGAGGACAAGG - Intronic
937469040 2:122159455-122159477 TGGGGATTAAGGAGTGGAGATGG + Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938292469 2:130157399-130157421 GGGTGGAGAAGGAGGGGTGAGGG + Intronic
938464085 2:131515577-131515599 GGGTGGAGAAGGAGGGGTGAGGG - Intergenic
938739844 2:134220701-134220723 AGGAGGGTGAGGAGGGGAGAAGG - Intronic
939080138 2:137649995-137650017 GGGGGGCTAAGGTGGGAAGATGG + Intronic
939674570 2:145056083-145056105 TTGAGGCTAAGGTGGGCAGATGG + Intergenic
939720627 2:145645988-145646010 TGGTGACCAGGGAGGGCAGAAGG + Intergenic
940310015 2:152268635-152268657 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
940585353 2:155641494-155641516 TGGTGTTTAAGCAGGGGATACGG - Intergenic
940800724 2:158129868-158129890 TGGAGGCTGAGGTGGGAAGATGG - Intronic
940877658 2:158914200-158914222 TTGTGGCTGAGAAGGGGAGAAGG + Intergenic
940888405 2:159011638-159011660 AGGAGGCTAAGGAGGGAAGATGG - Intronic
940890618 2:159032096-159032118 TGGTGACTTAGGAGGAGATAGGG + Intronic
941222829 2:162806070-162806092 TGGAGACTAAGGAGGGGGCACGG + Intronic
941536505 2:166728712-166728734 TGATGGCTAGAGAGGGAAGATGG + Intergenic
942413211 2:175733218-175733240 TGGTGACTTAGGAGTGAAGAGGG - Intergenic
942931839 2:181502966-181502988 AGCAGGCTAAGGAGGGGAGGGGG + Intronic
944509116 2:200446743-200446765 TGGTGGCTTAGGAGGGCAACTGG - Intronic
944665544 2:201956095-201956117 TGGTGGCCAAGCAGGAGGGAGGG + Intergenic
945043372 2:205761104-205761126 TGTTGGCTTGGGAGGGTAGAGGG + Intronic
945934341 2:215887581-215887603 TGGCGGCTGAAGAGAGGAGAGGG + Intergenic
946202090 2:218076401-218076423 TGGGGTGGAAGGAGGGGAGAAGG - Intronic
946411580 2:219517757-219517779 TGGGGTCTATGGTGGGGAGATGG + Intronic
946978578 2:225180904-225180926 TGGTGCCTAAGGAGAGGTGATGG - Intergenic
947217504 2:227762926-227762948 GGGAGGCCAAGGAGGGTAGATGG - Intergenic
947637926 2:231689406-231689428 TGGGGGCCATGGAAGGGAGAGGG - Intergenic
947740250 2:232481672-232481694 TGGTGGGTGGGGAGGGGAGGGGG - Intronic
948386323 2:237583231-237583253 TGGAGGCTAAGGTGGGAGGATGG + Intronic
948851672 2:240711349-240711371 TGGTTGGTAGGGAGAGGAGAAGG + Intergenic
1169706657 20:8513920-8513942 AGGAGGCTAAGGTGGGAAGATGG + Intronic
1170691402 20:18619082-18619104 GGGAGGCTAAGGTGGGAAGACGG - Intronic
1170848509 20:19982458-19982480 TGGTGGCTGAGGAGGGTGGAAGG - Intronic
1171215168 20:23347128-23347150 TGGTGGCTGAGCTGGGAAGAGGG + Intergenic
1171425247 20:25044780-25044802 TGCTGGCTCACCAGGGGAGAAGG + Intronic
1171875746 20:30574050-30574072 TGGAGGCTGAGGTGGGAAGATGG + Intergenic
1172113970 20:32563015-32563037 TGGAGGGGAAGGAGGGTAGAGGG + Intronic
1172586098 20:36085985-36086007 TGGTGGGTGGGGAGGGGAGGTGG + Intergenic
1172768723 20:37364617-37364639 TGGAGGCTCAGAAAGGGAGAGGG - Intronic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1172994315 20:39058811-39058833 TGGTGGAAAAGGGAGGGAGAGGG - Intergenic
1173005575 20:39137367-39137389 TCATGACTAAGGAGAGGAGATGG + Intergenic
1173424476 20:42931011-42931033 TGGTGGCTAAGATGGGGAGGGGG - Intronic
1173522888 20:43712306-43712328 TGTTAGGTAAGGAGGGGAGGTGG + Intronic
1173604156 20:44318173-44318195 GGAAGGCTAAGGTGGGGAGATGG + Intergenic
1174442650 20:50568241-50568263 TGGTGGCTGAGGCTGGGACAGGG - Intronic
1175229028 20:57461838-57461860 TGCTGTCTAGGGAGGGGAGGAGG - Intergenic
1175237620 20:57525316-57525338 GGGTGGATGAGGAGGGGAGGAGG + Intronic
1175237770 20:57525728-57525750 TAATGGATAAGGAGGGGAGGGGG + Intergenic
1175237828 20:57525895-57525917 TAATGGATAAGGAGGGGAGGAGG + Intergenic
1175238098 20:57526640-57526662 GAATGGATAAGGAGGGGAGAAGG + Intergenic
1175416615 20:58805395-58805417 GGGTGCCTGAGGAGGGGCGAGGG - Intergenic
1175860275 20:62146863-62146885 GGGAGGCTAAGGGGGGGAGGGGG - Intronic
1175910815 20:62404739-62404761 TGGGGGCCAAGGAGGAGGGAAGG + Intronic
1177125474 21:17188151-17188173 TGGGGACTCAGGAAGGGAGAGGG + Intergenic
1178512353 21:33216078-33216100 GGGTGGCTAAGGAGGGCAGCTGG + Intergenic
1178621343 21:34179390-34179412 TGGTTGCTAAGCAGGGATGAGGG + Intergenic
1178948991 21:36970470-36970492 GGGAGGCTAAGGTGGGCAGATGG - Intronic
1179025355 21:37674952-37674974 GGGTGGCTAAGGAGAGGTAAGGG + Intronic
1179324955 21:40333467-40333489 AGGTGGCTGAGGAGGGAGGATGG - Intronic
1179364484 21:40744106-40744128 TGGTTTCTAAGGTGGGAAGATGG + Intronic
1179583230 21:42358307-42358329 TGGTGGAGAAGGTGGAGAGACGG - Intergenic
1180203254 21:46240025-46240047 TGGTGGCTAAAGAGGGAAGTGGG + Intronic
1180319596 22:11308132-11308154 TGGTGTGCAAGGAGGGGAGCCGG + Intergenic
1180988803 22:19921308-19921330 GGGAGGCTAAGGTGGGGGGATGG + Intronic
1181054407 22:20253353-20253375 TGGTGGGTGAGCAGGGGAGGGGG - Intronic
1181265151 22:21626767-21626789 TGCTGGCTAAGGCTGGGAGAGGG - Intergenic
1181270635 22:21656751-21656773 TGGAGGACAAGGAGGGGACAAGG + Intronic
1181387714 22:22557900-22557922 GGGTGGGGAAGGAGGGGAGATGG + Intronic
1181636035 22:24175336-24175358 TGCTGACCAAGGAGGGGAGCTGG + Intronic
1181776000 22:25160667-25160689 TGGTGGCTGAGGCAGGGGGATGG - Intronic
1182307729 22:29382605-29382627 AGGAGGATAGGGAGGGGAGAGGG + Intronic
1182488607 22:30654728-30654750 TGGTGGCTAAGCAGGCCGGAAGG - Intronic
1182561508 22:31163430-31163452 GGGTGGCTGAGGTGGGAAGATGG - Intronic
1183061307 22:35337952-35337974 AGCTGGCTAAGGAGGAGAGGCGG - Intronic
1183571418 22:38656258-38656280 TGGGGGATGAGGAGGGGAGTTGG + Exonic
1183581342 22:38728347-38728369 TGGTGACCATGGAGAGGAGAAGG + Intronic
1183875242 22:40774939-40774961 TGGTGGCACTGGAGAGGAGAGGG - Intronic
1184094258 22:42308159-42308181 TGGTAGCTGGGGTGGGGAGAGGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184198520 22:42948204-42948226 TGGCTGTGAAGGAGGGGAGAGGG + Intronic
1184313765 22:43666220-43666242 TTCTGGCTGGGGAGGGGAGAGGG + Intronic
1185319609 22:50194427-50194449 TGGTGGCTGAGGACGGGAGCAGG + Exonic
950056932 3:10032469-10032491 TGGGGGTGAAGGGGGGGAGATGG + Intronic
950154344 3:10710347-10710369 TGGTGGCTAAGCAGGGATGTGGG + Intergenic
950227350 3:11246804-11246826 GGGAGGCTTAGGAGGGCAGATGG + Intronic
950464287 3:13144188-13144210 TGTCGGCTAAAGAGGGGACAGGG - Intergenic
950634902 3:14307794-14307816 TGCTGGAGAAGGAGGAGAGAGGG - Intergenic
950670131 3:14521019-14521041 TGGTGGCTAAGGAGGGGAGAAGG - Intronic
952528275 3:34236641-34236663 TGGTGAATAAGTAGGGGAGGGGG + Intergenic
953288491 3:41637209-41637231 TGGTGGTTACTGAGGGGTGAGGG - Intronic
953342808 3:42149816-42149838 TGTTTGCTTAGAAGGGGAGATGG + Intronic
953357567 3:42267448-42267470 TGGGGACTATGGAGTGGAGATGG + Intergenic
954609636 3:51937536-51937558 TGGTGGCAAAAGAGGTGAGTGGG - Exonic
954788486 3:53113118-53113140 TGGAGGCTGAGGGGGGAAGATGG - Intronic
954991975 3:54849380-54849402 TGGTGGTTAAGGAAGGAGGAGGG - Intronic
955401722 3:58596436-58596458 GGGAGGCTAAGGTGGGCAGATGG + Intronic
955692546 3:61604795-61604817 TTGTGGCAAAGTAGGAGAGAAGG + Intronic
955981101 3:64528643-64528665 AGGTGACTAAGGAAGGGAGCTGG - Intronic
956746998 3:72318216-72318238 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
956915176 3:73863167-73863189 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
956933088 3:74068321-74068343 TGGAGGCTAAGGTGGGAGGATGG + Intergenic
957609262 3:82446674-82446696 GGGAGGCTGAGGAGGGGAAATGG + Intergenic
958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG + Intronic
959148548 3:102579909-102579931 AGGTGGCTAGGAAGGGTAGAGGG - Intergenic
959337406 3:105083273-105083295 TGATGGCTAAAGAGGAAAGATGG - Intergenic
959462071 3:106639520-106639542 TAGAGGCTAAGAAGGGTAGAGGG - Intergenic
959594988 3:108119986-108120008 AGGTGGCTGAGGTGGGCAGATGG + Intergenic
959621143 3:108399612-108399634 TGGTGGCTAAGGATGAAGGAAGG + Intronic
960230165 3:115216663-115216685 TGGAGGCTAAGGTGGGAGGATGG - Intergenic
960591364 3:119368944-119368966 GGGTGGGTAGAGAGGGGAGAGGG + Intronic
960607520 3:119522388-119522410 TGGAGGCTGAGGAGGGGACAGGG + Intronic
960964413 3:123094860-123094882 TGGTGGCTAGGATGGGGACAGGG + Intronic
961118199 3:124349878-124349900 AGGGGGCAAAGGATGGGAGAGGG + Intronic
961498652 3:127314984-127315006 TGGTGGAAGAGGAGGGGAGCTGG + Intergenic
962448247 3:135488237-135488259 TGGAGGGCAAGGAGGGGAGGTGG + Intergenic
962949308 3:140203421-140203443 TGTTGGCTGATGAGGGAAGAGGG + Intronic
963730378 3:148965628-148965650 TGGTGGCAAAGGAAGGAAGGTGG + Intergenic
963768214 3:149361054-149361076 TGGTGGTTAAGGAGGGCCCAGGG + Intergenic
963929827 3:150991965-150991987 TGGTTGGGAAGGAGGGTAGATGG + Intergenic
964328610 3:155575348-155575370 TGAAGGGTAAGGAAGGGAGAGGG + Intronic
965147989 3:164931040-164931062 TGGTTGCTAAGGACAGGGGATGG + Intergenic
965181879 3:165414819-165414841 TGGTAGCTCAGGGTGGGAGATGG - Intergenic
965461871 3:168975797-168975819 GTTTGGATAAGGAGGGGAGAGGG + Intergenic
965826946 3:172741139-172741161 AGATGGATATGGAGGGGAGAGGG + Intergenic
966923298 3:184628589-184628611 AGGTGGCTATGGAAGGGAAATGG - Intronic
967129501 3:186457625-186457647 TGCTGGCTAAAGAGAGAAGAAGG + Intergenic
967832247 3:193929729-193929751 TGATGTCTAAGGGCGGGAGAAGG + Intergenic
968445615 4:650693-650715 TGGAGGCTGCGGAGGCGAGAAGG + Intronic
969212986 4:5701945-5701967 AGGGGGCTATGGAGGGGAGCTGG - Intronic
970922289 4:21409209-21409231 AGGAGGCTGAGGTGGGGAGATGG - Intronic
971582314 4:28357464-28357486 GGGAGGCCAAGGAGGGTAGATGG + Intergenic
972165584 4:36280472-36280494 TGGTGGCTGCAGAGTGGAGAGGG - Intergenic
973096775 4:46212253-46212275 AGGAGGCTAAGAAGGGAAGATGG + Intergenic
973823138 4:54680713-54680735 TGCAGGCTCAGGAGGGGAAATGG - Intronic
973938649 4:55879537-55879559 TGCAGGGTAGGGAGGGGAGATGG + Intronic
974602311 4:64099291-64099313 AAGTGGCTAAGGGAGGGAGATGG + Intergenic
975147054 4:70980006-70980028 TGGAGGTTGAGAAGGGGAGATGG + Intronic
975363893 4:73505365-73505387 TTCTTGCTAAGCAGGGGAGAGGG + Intergenic
975822893 4:78289821-78289843 TGGTGGGGAAGGTGGGGAGGGGG - Intronic
976729170 4:88244988-88245010 TGGTGCCCATGGAGGGCAGAAGG - Intergenic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
977369870 4:96122001-96122023 TGGTGACTACTAAGGGGAGAGGG + Intergenic
977443734 4:97101982-97102004 TGGTGAGTAAGAAGGGGAGCAGG - Intergenic
977526415 4:98151615-98151637 TGGTGGATGTGGAGGGGAGGGGG + Intergenic
977828522 4:101562404-101562426 GGGTGGGTAAAGAGTGGAGAGGG - Intronic
977861644 4:101968125-101968147 AGGAGGCTACAGAGGGGAGAGGG + Intronic
977872751 4:102112639-102112661 TGGAGGCTACACAGGGGAGAAGG + Intergenic
979565458 4:122149809-122149831 TGGTGGCTATGGGAGGGTGAAGG + Intergenic
980044726 4:127974746-127974768 GGGAGGCTGAGGAGGGTAGAGGG + Intronic
980228852 4:130021897-130021919 TCGTGGATAAGGAGGGCTGATGG + Intergenic
981002324 4:139839819-139839841 TAGTGGATATGAAGGGGAGATGG + Intronic
981418536 4:144521568-144521590 TGGTGGAAAAGGAGGAGAGGTGG - Intergenic
981904424 4:149904473-149904495 TGATGGCTATGGAGGTGGGATGG - Intergenic
982308616 4:153960348-153960370 GGGTGGCAGAGGTGGGGAGATGG + Intergenic
982865861 4:160511093-160511115 TGGTGACTAAGGATGGGTGCTGG - Intergenic
983387193 4:167080261-167080283 TAGTGGCTGAGGAAGTGAGAAGG + Intronic
983954033 4:173676201-173676223 TGGTAGCAGAGGAGGGGATAAGG + Intergenic
986527879 5:8700374-8700396 TGGTGGCAAAGGTCGGAAGACGG + Intergenic
986585517 5:9312968-9312990 TGGTGGGAGAGGAGTGGAGAGGG + Intronic
987346996 5:16987841-16987863 TTATGGCTAAGGAGGGGGGAAGG - Intergenic
988217174 5:28289900-28289922 TGATGGCTAAGCAAGGAAGAGGG - Intergenic
989240670 5:39200147-39200169 GGGTTGCAAAGGAGAGGAGAAGG + Intronic
990111463 5:52330708-52330730 TGGTTGCTAGGGAGAGGGGAAGG - Intergenic
990185670 5:53206627-53206649 TGGTGGCTAAGCAGGCTAGAAGG + Intergenic
990343890 5:54852326-54852348 TGGTGGCCAAGTAGGTGACAGGG - Intergenic
991054846 5:62308763-62308785 TGGTGGGGAAGGAGAGGAAATGG + Intronic
991971247 5:72143789-72143811 GGGAGGCTAAGGAGGGAGGATGG - Intronic
991978598 5:72208561-72208583 TGGTGTTTAAAGAGGGGAGGAGG - Exonic
992431821 5:76716996-76717018 TGGTGGCGGGGGAGGGGACATGG + Intronic
995505107 5:112851899-112851921 GGGAGGCTGAGGAGGAGAGATGG + Intronic
995524292 5:113038397-113038419 TGAGGGTTAAGGAGGGGAGTTGG + Intronic
996299811 5:121967728-121967750 GGGAGGCTAAGGTGGGAAGATGG + Intronic
996982726 5:129519374-129519396 TTGTGCTTGAGGAGGGGAGAGGG - Intronic
997177098 5:131790372-131790394 GGGAGGCTGAGGTGGGGAGATGG + Intronic
997348492 5:133211450-133211472 AGGTGGCTGAGGTGGGGAGGAGG - Intronic
997417854 5:133742722-133742744 TGGAGGCTGAGGAGGTGTGAGGG + Intergenic
998039587 5:138943950-138943972 TGGTAGGACAGGAGGGGAGAGGG - Intergenic
998305259 5:141069804-141069826 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
998305278 5:141069939-141069961 TGGAGGCTAAGGTGGGAGGATGG + Intergenic
998328895 5:141305947-141305969 TGGGGGGCAAGGAGGGGAGTAGG + Intergenic
998377317 5:141699785-141699807 AGCTGGCTGATGAGGGGAGAAGG + Intergenic
1000054124 5:157589078-157589100 TGGTGGCTTATAAGAGGAGAAGG - Intergenic
1000536125 5:162480170-162480192 GGGAGGCTAAGGTGGGAAGATGG - Intergenic
1000641698 5:163710667-163710689 TGGGAGCTAAGGAGGGCAGCAGG + Intergenic
1000684502 5:164230374-164230396 GGGTGGCCAAGGTGGGCAGATGG + Intergenic
1000771719 5:165362962-165362984 GGGAGGCTGAGGTGGGGAGATGG - Intergenic
1001447650 5:171798228-171798250 TGGTGGAGAAGCAGGGGTGAGGG - Intergenic
1001566961 5:172706082-172706104 TGGTGGCTGTGGTGGGGAGAAGG + Intergenic
1001684344 5:173582271-173582293 TGGTGAGAAAGGAAGGGAGAAGG + Intergenic
1001894244 5:175364743-175364765 TGGTTGCCAGGGAGGGAAGAGGG - Intergenic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1002414480 5:179112539-179112561 TGGGGGCTTAGGGTGGGAGATGG - Exonic
1002700746 5:181122753-181122775 GGGAGGCTAAGGAGGGAGGACGG - Intergenic
1003241748 6:4351212-4351234 TGCTGGGGAAGGAGGGGAAATGG - Intergenic
1003911919 6:10750863-10750885 TTCTGTCTAAGGAGGGAAGATGG + Intronic
1005947108 6:30602738-30602760 TGGTGGTTTAGGTTGGGAGATGG - Intronic
1006412852 6:33885388-33885410 TGGTGGAGTAGGAGGGAAGAGGG - Intergenic
1006510697 6:34519545-34519567 TATTAGCTGAGGAGGGGAGAAGG + Intronic
1006960226 6:37921957-37921979 TGGAGGCTAAGGTGGGAGGATGG + Intronic
1007216986 6:40248034-40248056 TGGTGGCTGAGGAGGAGTCAAGG + Intergenic
1007307459 6:40918212-40918234 TGGGGGCCAAGGTGGGGAGGAGG - Intergenic
1007532134 6:42552616-42552638 TGGAGGCTAAGGTGGGAAGATGG - Intergenic
1007619536 6:43203598-43203620 TGGGGCCTGAGGAGGGAAGATGG + Intronic
1007714561 6:43848226-43848248 GGGTGGCTAGGGAGGTGAGAGGG + Intergenic
1008052028 6:46909893-46909915 AGGGGGCTGAGGTGGGGAGATGG + Intronic
1009268835 6:61592084-61592106 TGGAGGCTGAGGTGGGAAGATGG + Intergenic
1009352616 6:62701203-62701225 TGAGGGTTGAGGAGGGGAGAAGG + Intergenic
1009630414 6:66191816-66191838 AGGTGGTTCAGGATGGGAGAGGG - Intergenic
1009734478 6:67659227-67659249 TGGGGTCTACGGAGGGTAGAGGG - Intergenic
1010009126 6:71029430-71029452 TGGGGGCAAAGGAGGGAAAATGG - Intergenic
1010577366 6:77549165-77549187 TGGTAGCTGAGGTGGGAAGATGG - Intergenic
1014021734 6:116598814-116598836 TGGGGGCTAAGGTGGGAGGATGG - Intergenic
1014418152 6:121209487-121209509 TGGTGGCTAGGGATGGGAAAGGG - Intronic
1014509415 6:122302670-122302692 TGGTGGGTAAGAAGGAGGGAGGG - Intergenic
1014518091 6:122403500-122403522 AGGAGGCTGAAGAGGGGAGATGG + Intronic
1015171384 6:130258657-130258679 TGGGTGATAAGGAGGTGAGAAGG - Intronic
1016006106 6:139090802-139090824 TGGAGGCTGAGGTGGGGGGATGG + Intergenic
1016637363 6:146309157-146309179 GGGAGGCTAAGGTGGGCAGATGG + Intronic
1016752843 6:147650335-147650357 GGGTGGCAAAGGAGGGGGCAAGG + Intronic
1016993806 6:149947153-149947175 TCCTGGCTTAGGAAGGGAGACGG - Intronic
1017004529 6:150020384-150020406 TCCTGGCTTAGGAAGGGAGACGG + Intronic
1018345539 6:162895163-162895185 TGGAGGCTGAGAAGGGAAGATGG + Intronic
1018732156 6:166659379-166659401 GGGTGGCCGGGGAGGGGAGAGGG + Intronic
1018924894 6:168199071-168199093 TGGCGGCTAAGGAGGGCACGTGG - Intergenic
1019271201 7:150078-150100 TGGTGGCGGTGGAGGGGAGATGG + Intergenic
1019375508 7:689627-689649 GGGAGGATAAGGAGGGGAGGGGG + Intronic
1019597905 7:1866832-1866854 TGAGGGCCAAGGAGGAGAGATGG + Intronic
1019664009 7:2242291-2242313 TGGTGACCAGGGAGGGGAGCCGG + Exonic
1019997218 7:4732395-4732417 GGGAGGCTGAGGAGGGAAGATGG - Intronic
1020137994 7:5597104-5597126 GGGAGGCCAAGGAGGGAAGATGG + Intronic
1020441910 7:8226245-8226267 TGGTGGATGAGGAGTGGGGAAGG - Intronic
1021179087 7:17485114-17485136 TGGGGGCTAAGGAGGAGTGATGG + Intergenic
1021522384 7:21550792-21550814 TGGTGGCTATGGAAGGGGAAAGG + Intronic
1021591789 7:22271699-22271721 TGTTGGGTAACTAGGGGAGAGGG - Intronic
1022532714 7:31076853-31076875 TGGTGGCTGAGGAGGGGCTAGGG + Intronic
1022947085 7:35297264-35297286 TGGGGACTAAGGAGCAGAGAGGG - Intergenic
1022973261 7:35536183-35536205 TGGGGGCCCAGCAGGGGAGATGG - Intergenic
1023062661 7:36343413-36343435 TGGGGGGAGAGGAGGGGAGATGG + Intronic
1025144768 7:56493600-56493622 TGGTGACTCAGGAGGGGACCTGG + Intergenic
1025286454 7:57666249-57666271 TGGTTGCTGAGGACTGGAGAGGG - Intergenic
1026324964 7:69301070-69301092 TGGTGGCTGAGGTGGGAAGATGG + Intergenic
1026866095 7:73825016-73825038 TGGTGGCAAGGATGGGGAGAGGG - Intronic
1026886297 7:73949379-73949401 TGGAGGAGAAGGAGAGGAGAAGG - Intergenic
1026926852 7:74200203-74200225 GGGAGGCCAAGGTGGGGAGATGG + Intronic
1026928439 7:74209893-74209915 TGGGGGGAAGGGAGGGGAGACGG - Exonic
1027231221 7:76273846-76273868 AGGTGAAGAAGGAGGGGAGATGG - Intronic
1027277016 7:76567505-76567527 GGGTGGCTGAGGTGGGAAGATGG + Intergenic
1027377452 7:77566480-77566502 GGGAGGCTAAGGTGGGCAGATGG + Intronic
1028095507 7:86755465-86755487 TGGGGGTTAAGGATGGGAGAGGG + Intronic
1028163783 7:87515009-87515031 TGCTTGCAAAGGAGGGTAGAGGG + Intronic
1029581185 7:101437480-101437502 TGGTGGCCAAGGAGAGGAGGAGG + Intronic
1030211467 7:107000427-107000449 TGGTCGTTAAGGAGAGGGGAAGG + Intergenic
1030679443 7:112419359-112419381 TGGTGGCTAGGAAGGGTAGTGGG + Intergenic
1030841763 7:114362066-114362088 TGGTGGCCAGGGAGGGGGTAAGG + Intronic
1031234916 7:119162763-119162785 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
1032443669 7:131961865-131961887 GGGAGGCTGAGGAGGGGACAAGG - Intergenic
1032503470 7:132417706-132417728 AGGTGGGGGAGGAGGGGAGAGGG + Intronic
1032508419 7:132453100-132453122 TGGAGGAAAAGGAGGAGAGAAGG + Intronic
1032646278 7:133828105-133828127 TGGTGGATAAGCAGGAGAGAAGG + Intronic
1033367448 7:140682479-140682501 AGGAGGCTGAGGAGGTGAGAGGG + Intronic
1033801814 7:144910659-144910681 TGGTGGATACAGAGGGGAGTGGG - Intergenic
1034056374 7:148039261-148039283 TGATGGCCAAGGACAGGAGAAGG + Intronic
1034738816 7:153454337-153454359 TGGGGGCTAAGAAGAGGAGATGG - Intergenic
1034816361 7:154175385-154175407 TGGTGGCTTAAGGGAGGAGAAGG + Intronic
1035312422 7:157977873-157977895 TCGTGGCTGAGGAGGAGGGAAGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035530511 8:347032-347054 TGGAGGCTCAGAAGGGGAGGAGG + Intergenic
1035987540 8:4451224-4451246 GGGAGGCTAAGGAGGGAAGATGG + Intronic
1036656655 8:10681457-10681479 GGGAGGCTCAGGAGAGGAGAGGG + Intronic
1037164521 8:15810636-15810658 TTGTGGCCAAGGAGGGGGGGCGG + Intergenic
1037502408 8:19498490-19498512 TGCAGGCTTAGGAGGGGAGATGG - Intronic
1037502426 8:19498593-19498615 TGCAGGCTTAGGAGGGGAGATGG - Intronic
1037805675 8:22056926-22056948 AGCTGGCGAAGGAGGGGAGCTGG - Intronic
1038211356 8:25521807-25521829 TGGAGGCTGAGGTGGGAAGATGG + Intergenic
1038376740 8:27047572-27047594 TGGGGGCAAATGAGGGGAGTAGG - Intergenic
1038711090 8:29946444-29946466 TGGGGGTTAGGGAGAGGAGAAGG - Intergenic
1040030479 8:42819374-42819396 TGGTGGGTAAGCGGGGGAGGGGG - Intergenic
1040041695 8:42922444-42922466 TGGAGGCTGAGGTGGGAAGATGG + Intronic
1040493036 8:47942348-47942370 GGGAGACTAAGGAGGCGAGAGGG + Intronic
1040879380 8:52189116-52189138 TTGGGGGCAAGGAGGGGAGATGG - Intronic
1041908913 8:63066968-63066990 GGGTGGCTGAGGTGGGGGGAGGG + Intronic
1042454638 8:68986594-68986616 GGGAGGCTAAGGTGGGCAGATGG + Intergenic
1042523020 8:69734248-69734270 TAGTGGCAAAGGAGGGTGGAGGG - Intronic
1042617027 8:70660880-70660902 GGGAGGCTAAGGTGGGCAGATGG - Exonic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043141967 8:76602013-76602035 TAGTGACTAAGGAGGAGAGATGG + Intergenic
1043355620 8:79408857-79408879 TGGAGACTCAGAAGGGGAGAGGG - Intergenic
1043376387 8:79654344-79654366 TGGGGGATAGGGAGGGGGGAAGG + Intronic
1043667436 8:82833709-82833731 GGGAGGCTAAGGAGGGAGGATGG + Intergenic
1043785992 8:84400570-84400592 TGGTGGCTAAGGAAGGGAACTGG + Intronic
1044494594 8:92862061-92862083 TGGTGGCTTAAGAGGAGATATGG - Intergenic
1044757805 8:95483914-95483936 TGGTTTCTAGGGAAGGGAGATGG - Intergenic
1044772671 8:95653675-95653697 TGGTGACAAAGGCAGGGAGAAGG - Intergenic
1047873912 8:129114300-129114322 TGGTTGGTAAGGAGAGGTGAGGG + Intergenic
1048042416 8:130744143-130744165 TGGAGGCTGAGGTGGGCAGATGG + Intergenic
1048384794 8:133902049-133902071 TGGCGGCTTAGGTGGGGAGAGGG - Intergenic
1048887868 8:138923101-138923123 ACCTGGTTAAGGAGGGGAGAGGG + Intergenic
1049032961 8:140050708-140050730 TGGGGGCTGGGGAGGGAAGAAGG + Intronic
1049241858 8:141541856-141541878 TGGTGGGACAGGAGGGCAGAGGG - Intergenic
1049466337 8:142752741-142752763 TGGTGGCGGAGGCGGGGAGCTGG - Intergenic
1049613210 8:143565381-143565403 TGGGGGCTGAGGCGGGGAGCTGG - Intergenic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1050009820 9:1173809-1173831 GGGTAGCTCAGGTGGGGAGAAGG - Intergenic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050554179 9:6774836-6774858 TGGTTGCCAAGGAGAGAAGATGG - Intronic
1051559599 9:18425613-18425635 AGGAGGCTGAGGAGGGAAGATGG + Intergenic
1052228647 9:26120359-26120381 TGGTGAACAAGGAGGAGAGAAGG + Intergenic
1052305656 9:27006498-27006520 GGGTGGCTGAGGTGGGGGGATGG + Intronic
1052534063 9:29726001-29726023 AGTTGGCTAGGTAGGGGAGAGGG + Intergenic
1053322734 9:37114802-37114824 TGGTGGCTGATTAGGGGACATGG - Intergenic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1055709951 9:79049878-79049900 GGGTGCCTAGGGATGGGAGAAGG + Intergenic
1055827010 9:80339233-80339255 TGGTGGCTATGGTGGGGAGGGGG + Intergenic
1056201157 9:84278025-84278047 TGGTGGGGAGGGAGGGGAGGAGG + Exonic
1056204742 9:84309164-84309186 TGTTGGGTAGGGAGGGTAGATGG + Intronic
1057319153 9:93996321-93996343 TGGTGGTTATGAAGGGGAAATGG - Intergenic
1057458132 9:95233117-95233139 AGGCGGGAAAGGAGGGGAGATGG + Intronic
1057759368 9:97860239-97860261 TAGGGGCTAAGGAGTGGGGATGG + Intergenic
1059859760 9:118446902-118446924 AGGTGGATAGGGAGGGGAGGAGG - Intergenic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060197900 9:121635097-121635119 GGGTGGCTATGGAGTGGAGGGGG + Intronic
1060209329 9:121700213-121700235 TGGTGGGGCAGAAGGGGAGAGGG + Intronic
1060488164 9:124062634-124062656 TGGGGGCTGAGGAGGGAACAGGG + Intergenic
1060882142 9:127124675-127124697 TTGTGGCTGAGGAGAGAAGATGG + Intronic
1061306445 9:129735792-129735814 TGGTGGGTATGGAAGGGAGGTGG - Intergenic
1061457118 9:130706865-130706887 GGGAGGCTAAGGTGGGAAGATGG - Intergenic
1061860262 9:133464329-133464351 TGGTGGATAGGGAAGGGGGATGG + Intronic
1062315045 9:135962997-135963019 TGGTGACTGTGGAGGGGACAGGG + Intergenic
1062691145 9:137842399-137842421 TGGAGGATACGGAGGGGGGACGG - Intronic
1062713363 9:137988802-137988824 AGGAGGCTGAGGAGGGGTGAAGG + Intronic
1185789024 X:2914477-2914499 GGGAGGCTAAGGCAGGGAGATGG - Intronic
1185808008 X:3078419-3078441 TGGAGGCCAAAGAGGGAAGATGG - Intronic
1186423125 X:9442773-9442795 TCTTGTCTAAGAAGGGGAGAAGG - Intergenic
1187566180 X:20451721-20451743 GTGTGGCTGAGGCGGGGAGAAGG - Intergenic
1188366562 X:29322926-29322948 TATTGGCTAAGGAGAGGGGAAGG - Intronic
1188482417 X:30649223-30649245 TGGAGGCTGAGGAGGGTGGATGG + Intergenic
1189214863 X:39314281-39314303 GGGAGGCTAAGGAGGGGAAAGGG + Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1190010786 X:46782965-46782987 TGGAGGCTGAGGCGGGCAGATGG - Intergenic
1190081590 X:47360854-47360876 AGGAGGCTGAGGAGGGGAGATGG - Intergenic
1190279605 X:48920908-48920930 TGGTGGCTCAGGACAGGGGAGGG + Intergenic
1190862765 X:54359272-54359294 TTGAGGCTCAGGAGGGGAAATGG + Intergenic
1191008002 X:55731195-55731217 TTGTGGCTCAAGAGGTGAGAAGG + Intronic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1191716656 X:64198355-64198377 GGGTGGCTGAGGAGGGCAAATGG - Intronic
1191841499 X:65516473-65516495 TGGTGGCTATGGAGGGGTAGTGG - Intronic
1192806104 X:74510810-74510832 GGGAGGCTAAGGAGGGAGGACGG + Intronic
1192848051 X:74925725-74925747 TGGTGGGGAAGAAGGGTAGAGGG - Intergenic
1193018817 X:76767701-76767723 GGGAGGGTAAGGTGGGGAGATGG - Intergenic
1194673483 X:96765300-96765322 TGGAGGCTAAGGTGGGAGGATGG - Intronic
1195310548 X:103628663-103628685 TGGTGGCTAAGGAAGGGAGGAGG + Intronic
1195567842 X:106363344-106363366 TGGTGGCCGGGGAGGGGAGTGGG + Intergenic
1195669122 X:107454298-107454320 TGGTTGGTAAAGAGGTGAGAAGG - Intergenic
1196689045 X:118539428-118539450 TGGGGGCAAAGTGGGGGAGATGG + Intronic
1196866617 X:120076781-120076803 TTTTGGTTCAGGAGGGGAGAGGG + Intronic
1196876482 X:120159500-120159522 TTTTGGTTCAGGAGGGGAGAGGG - Intronic
1197033886 X:121851962-121851984 GGGAGGCCAAGGAGGGCAGATGG - Intergenic
1197234302 X:124041903-124041925 TGGTGGGTATGGAGTGGAGGTGG + Intronic
1197735450 X:129847528-129847550 GGATGGCTAAGGGAGGGAGATGG - Intergenic
1197775984 X:130119066-130119088 AGGTGGCCAGGGACGGGAGAGGG + Intergenic
1197907585 X:131442842-131442864 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1197911838 X:131491388-131491410 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1198108424 X:133482416-133482438 TGGTGCCTATGGATTGGAGAAGG + Intergenic
1198202752 X:134438045-134438067 TGGTGGCTGAGGCTGAGAGAAGG - Intergenic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1198858167 X:141040955-141040977 TGCTACCTAAGGAGGGGAGAAGG + Intergenic
1198904528 X:141546415-141546437 TGCTACCTAAGGAGGGGAGAAGG - Intergenic
1199303829 X:146244338-146244360 TGCTGCCTCAGGACGGGAGAAGG - Intergenic
1199610430 X:149607756-149607778 TGGGGTCTGAGGTGGGGAGATGG + Intronic
1199750460 X:150811920-150811942 GGGAGGCTAAGGTGGGTAGATGG + Intronic
1200353994 X:155528488-155528510 TGGAGACTCAGAAGGGGAGAGGG - Intronic
1201745614 Y:17369621-17369643 TGGTGGTTAATGAGGGCAGTGGG - Intergenic
1202134316 Y:21646138-21646160 TGGAGGCTAAGGAGGGAGAATGG - Intergenic