ID: 950675239

View in Genome Browser
Species Human (GRCh38)
Location 3:14550582-14550604
Sequence TGGATGACCTTGGGCAAAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950675230_950675239 18 Left 950675230 3:14550541-14550563 CCTGAGTTCAACTCCTAGATCTA No data
Right 950675239 3:14550582-14550604 TGGATGACCTTGGGCAAAACCGG No data
950675231_950675239 5 Left 950675231 3:14550554-14550576 CCTAGATCTACCTCCACCTCTGA No data
Right 950675239 3:14550582-14550604 TGGATGACCTTGGGCAAAACCGG No data
950675234_950675239 -5 Left 950675234 3:14550564-14550586 CCTCCACCTCTGACTGGCTGGAT No data
Right 950675239 3:14550582-14550604 TGGATGACCTTGGGCAAAACCGG No data
950675228_950675239 30 Left 950675228 3:14550529-14550551 CCTCAGAGGGGCCCTGAGTTCAA No data
Right 950675239 3:14550582-14550604 TGGATGACCTTGGGCAAAACCGG No data
950675229_950675239 19 Left 950675229 3:14550540-14550562 CCCTGAGTTCAACTCCTAGATCT No data
Right 950675239 3:14550582-14550604 TGGATGACCTTGGGCAAAACCGG No data
950675235_950675239 -8 Left 950675235 3:14550567-14550589 CCACCTCTGACTGGCTGGATGAC No data
Right 950675239 3:14550582-14550604 TGGATGACCTTGGGCAAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950675239 Original CRISPR TGGATGACCTTGGGCAAAAC CGG Intergenic
No off target data available for this crispr