ID: 950675983

View in Genome Browser
Species Human (GRCh38)
Location 3:14554686-14554708
Sequence GACTCTGAGGTGCCTACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950675983_950675987 6 Left 950675983 3:14554686-14554708 CCCTGTGTAGGCACCTCAGAGTC No data
Right 950675987 3:14554715-14554737 ATGCTCAGTTACAAGCTCACTGG No data
950675983_950675988 10 Left 950675983 3:14554686-14554708 CCCTGTGTAGGCACCTCAGAGTC No data
Right 950675988 3:14554719-14554741 TCAGTTACAAGCTCACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950675983 Original CRISPR GACTCTGAGGTGCCTACACA GGG (reversed) Intergenic
No off target data available for this crispr