ID: 950675987

View in Genome Browser
Species Human (GRCh38)
Location 3:14554715-14554737
Sequence ATGCTCAGTTACAAGCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950675979_950675987 23 Left 950675979 3:14554669-14554691 CCTCCCTAAGGAAGACTCCCTGT No data
Right 950675987 3:14554715-14554737 ATGCTCAGTTACAAGCTCACTGG No data
950675986_950675987 -7 Left 950675986 3:14554699-14554721 CCTCAGAGTCTGGAAAATGCTCA No data
Right 950675987 3:14554715-14554737 ATGCTCAGTTACAAGCTCACTGG No data
950675976_950675987 30 Left 950675976 3:14554662-14554684 CCCGCCACCTCCCTAAGGAAGAC No data
Right 950675987 3:14554715-14554737 ATGCTCAGTTACAAGCTCACTGG No data
950675981_950675987 19 Left 950675981 3:14554673-14554695 CCTAAGGAAGACTCCCTGTGTAG No data
Right 950675987 3:14554715-14554737 ATGCTCAGTTACAAGCTCACTGG No data
950675978_950675987 26 Left 950675978 3:14554666-14554688 CCACCTCCCTAAGGAAGACTCCC No data
Right 950675987 3:14554715-14554737 ATGCTCAGTTACAAGCTCACTGG No data
950675984_950675987 5 Left 950675984 3:14554687-14554709 CCTGTGTAGGCACCTCAGAGTCT No data
Right 950675987 3:14554715-14554737 ATGCTCAGTTACAAGCTCACTGG No data
950675977_950675987 29 Left 950675977 3:14554663-14554685 CCGCCACCTCCCTAAGGAAGACT No data
Right 950675987 3:14554715-14554737 ATGCTCAGTTACAAGCTCACTGG No data
950675983_950675987 6 Left 950675983 3:14554686-14554708 CCCTGTGTAGGCACCTCAGAGTC No data
Right 950675987 3:14554715-14554737 ATGCTCAGTTACAAGCTCACTGG No data
950675980_950675987 20 Left 950675980 3:14554672-14554694 CCCTAAGGAAGACTCCCTGTGTA No data
Right 950675987 3:14554715-14554737 ATGCTCAGTTACAAGCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950675987 Original CRISPR ATGCTCAGTTACAAGCTCAC TGG Intergenic
No off target data available for this crispr