ID: 950675988

View in Genome Browser
Species Human (GRCh38)
Location 3:14554719-14554741
Sequence TCAGTTACAAGCTCACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950675978_950675988 30 Left 950675978 3:14554666-14554688 CCACCTCCCTAAGGAAGACTCCC No data
Right 950675988 3:14554719-14554741 TCAGTTACAAGCTCACTGGCTGG No data
950675984_950675988 9 Left 950675984 3:14554687-14554709 CCTGTGTAGGCACCTCAGAGTCT No data
Right 950675988 3:14554719-14554741 TCAGTTACAAGCTCACTGGCTGG No data
950675980_950675988 24 Left 950675980 3:14554672-14554694 CCCTAAGGAAGACTCCCTGTGTA No data
Right 950675988 3:14554719-14554741 TCAGTTACAAGCTCACTGGCTGG No data
950675979_950675988 27 Left 950675979 3:14554669-14554691 CCTCCCTAAGGAAGACTCCCTGT No data
Right 950675988 3:14554719-14554741 TCAGTTACAAGCTCACTGGCTGG No data
950675983_950675988 10 Left 950675983 3:14554686-14554708 CCCTGTGTAGGCACCTCAGAGTC No data
Right 950675988 3:14554719-14554741 TCAGTTACAAGCTCACTGGCTGG No data
950675986_950675988 -3 Left 950675986 3:14554699-14554721 CCTCAGAGTCTGGAAAATGCTCA No data
Right 950675988 3:14554719-14554741 TCAGTTACAAGCTCACTGGCTGG No data
950675981_950675988 23 Left 950675981 3:14554673-14554695 CCTAAGGAAGACTCCCTGTGTAG No data
Right 950675988 3:14554719-14554741 TCAGTTACAAGCTCACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950675988 Original CRISPR TCAGTTACAAGCTCACTGGC TGG Intergenic
No off target data available for this crispr