ID: 950675998

View in Genome Browser
Species Human (GRCh38)
Location 3:14554814-14554836
Sequence CTGCACAATCAGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950675992_950675998 21 Left 950675992 3:14554770-14554792 CCTTAGGCAAGTTACTTAACCGC No data
Right 950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG No data
950675994_950675998 -8 Left 950675994 3:14554799-14554821 CCTCACTTTCCTCCTCTGCACAA No data
Right 950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG No data
950675993_950675998 2 Left 950675993 3:14554789-14554811 CCGCTCTGTGCCTCACTTTCCTC 0: 13
1: 357
2: 1687
3: 4672
4: 9444
Right 950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950675998 Original CRISPR CTGCACAATCAGAATGAGGA TGG Intergenic
No off target data available for this crispr