ID: 950677655

View in Genome Browser
Species Human (GRCh38)
Location 3:14564377-14564399
Sequence AAGCCAGGCCACGGCAGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950677644_950677655 20 Left 950677644 3:14564334-14564356 CCTCGTGTGCCACGGGGCAGCAG No data
Right 950677655 3:14564377-14564399 AAGCCAGGCCACGGCAGTGCCGG No data
950677649_950677655 -5 Left 950677649 3:14564359-14564381 CCACCGGGGCTCCTCCTCAAGCC No data
Right 950677655 3:14564377-14564399 AAGCCAGGCCACGGCAGTGCCGG No data
950677640_950677655 30 Left 950677640 3:14564324-14564346 CCACTACGGTCCTCGTGTGCCAC No data
Right 950677655 3:14564377-14564399 AAGCCAGGCCACGGCAGTGCCGG No data
950677650_950677655 -8 Left 950677650 3:14564362-14564384 CCGGGGCTCCTCCTCAAGCCAGG No data
Right 950677655 3:14564377-14564399 AAGCCAGGCCACGGCAGTGCCGG No data
950677645_950677655 11 Left 950677645 3:14564343-14564365 CCACGGGGCAGCAGCTCCACCGG No data
Right 950677655 3:14564377-14564399 AAGCCAGGCCACGGCAGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950677655 Original CRISPR AAGCCAGGCCACGGCAGTGC CGG Intergenic