ID: 950678504

View in Genome Browser
Species Human (GRCh38)
Location 3:14569060-14569082
Sequence GGCCATCAGGATTACGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950678497_950678504 -2 Left 950678497 3:14569039-14569061 CCAGCTGACAGGCAGAAGCTGGG No data
Right 950678504 3:14569060-14569082 GGCCATCAGGATTACGGGGAGGG No data
950678494_950678504 23 Left 950678494 3:14569014-14569036 CCAGGCAGCTAGCAGAGTAATCA No data
Right 950678504 3:14569060-14569082 GGCCATCAGGATTACGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950678504 Original CRISPR GGCCATCAGGATTACGGGGA GGG Intergenic
No off target data available for this crispr