ID: 950679196

View in Genome Browser
Species Human (GRCh38)
Location 3:14573418-14573440
Sequence GGATCCTGGTGTGCAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950679188_950679196 22 Left 950679188 3:14573373-14573395 CCCGCGGGATGGTCATCTGGAAG 0: 1
1: 0
2: 1
3: 6
4: 87
Right 950679196 3:14573418-14573440 GGATCCTGGTGTGCAGGAAGAGG 0: 1
1: 0
2: 1
3: 30
4: 268
950679189_950679196 21 Left 950679189 3:14573374-14573396 CCGCGGGATGGTCATCTGGAAGC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 950679196 3:14573418-14573440 GGATCCTGGTGTGCAGGAAGAGG 0: 1
1: 0
2: 1
3: 30
4: 268
950679186_950679196 28 Left 950679186 3:14573367-14573389 CCAGGTCCCGCGGGATGGTCATC 0: 1
1: 0
2: 0
3: 3
4: 30
Right 950679196 3:14573418-14573440 GGATCCTGGTGTGCAGGAAGAGG 0: 1
1: 0
2: 1
3: 30
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950679196 Original CRISPR GGATCCTGGTGTGCAGGAAG AGG Intergenic
900161716 1:1227196-1227218 GGGTCCTGGGGTGCAGGAGCAGG - Intronic
900420922 1:2555601-2555623 GGTTCCTGGTGTGCAGCAGGCGG + Intergenic
901125088 1:6923606-6923628 GGCTTCTGGTATGCAGGAAGAGG + Intronic
901156249 1:7141496-7141518 GGATGCTGGTGCCCAGGAAATGG + Intronic
901510713 1:9716893-9716915 GAATCCTGGTGTCCAGGGAGTGG + Intronic
901848372 1:11999160-11999182 AGATCCAGGGGTGCAGGAAGTGG - Intronic
902706753 1:18210718-18210740 GGCATCTGGTGTGCAGGAACCGG - Intronic
903516390 1:23913759-23913781 GGATCCTGGTGTGGGGCAATAGG + Intergenic
904253704 1:29241289-29241311 GGATCAGGGTGTGCAGACAGAGG + Intronic
905999994 1:42416413-42416435 TGATCTTGGTGGGCAGGAGGAGG - Exonic
906757057 1:48328147-48328169 CCATCCTAGTGTGCATGAAGTGG - Intronic
907300634 1:53484481-53484503 GGACCCTGATCTGCTGGAAGAGG + Intergenic
907899314 1:58722841-58722863 AGATCCTGGTGTGGAGGAAGAGG + Intergenic
908258242 1:62319462-62319484 GGACTTTGGTGTGTAGGAAGGGG + Intergenic
908848138 1:68345851-68345873 GCAACCTGCTGTGCATGAAGTGG + Intergenic
909102476 1:71367016-71367038 GGCTCCTGGTGTCCACGGAGTGG + Intergenic
910862594 1:91757078-91757100 GGATCCTGTTGGGTAGGGAGTGG - Intronic
911084716 1:93966710-93966732 GGATGATGGTGTCCAGGCAGAGG + Intergenic
913001083 1:114581498-114581520 AGCCCCTGGTGTGCGGGAAGCGG - Exonic
916080195 1:161227396-161227418 GGACCCAGGTCTGGAGGAAGAGG + Intronic
917798650 1:178551010-178551032 GGACCCTGATGTGCTGGATGAGG + Intergenic
919856986 1:201712744-201712766 GGATCCTGGGGGTCAGGAAGTGG - Intronic
919860525 1:201736923-201736945 GTAGCCTGGGGTGCAGGGAGTGG - Intronic
923287715 1:232512947-232512969 GGATCCCTGGGAGCAGGAAGAGG + Intronic
924726963 1:246680011-246680033 GGATCCTGGTAAGAAGGCAGAGG + Intergenic
1063005304 10:1964738-1964760 GGAACCTGGCGAGCAGGACGTGG + Intergenic
1063220178 10:3960001-3960023 GGAGCCTGGTGCCCAGGGAGGGG - Intergenic
1063385069 10:5611294-5611316 GGGTGCTGGGGTGCAGAAAGAGG - Intergenic
1063592931 10:7409923-7409945 GGATCCTGGAGGGTGGGAAGTGG - Intronic
1066094614 10:32060182-32060204 AGAATCTGTTGTGCAGGAAGAGG - Intergenic
1068549889 10:58394675-58394697 AGATCTTGAGGTGCAGGAAGGGG - Intronic
1069533449 10:69235583-69235605 GGATCCTGTAGTGCAGGTGGTGG + Intronic
1069995768 10:72341201-72341223 GGATCCTGGGGTGCGGGGGGAGG + Intronic
1070759183 10:79012831-79012853 GGTTCCTGGTGTGCATGCACTGG - Intergenic
1070777089 10:79116113-79116135 GAATCCGGGGGTGCAGTAAGGGG - Intronic
1071390543 10:85170997-85171019 GGATCCTGGAGAGCAGCAGGAGG + Intergenic
1076919601 10:133444822-133444844 GGACCTTGGTGTCCAGGGAGAGG - Intergenic
1078063230 11:8061563-8061585 GGATCCTGGGGTGCAAGAGTAGG + Intronic
1078066142 11:8080836-8080858 GAATCCAGTCGTGCAGGAAGAGG - Intronic
1082839588 11:57678028-57678050 GGATCCCCATGGGCAGGAAGTGG + Intronic
1083899459 11:65636604-65636626 GGAGCCTGGGGGGCCGGAAGGGG + Exonic
1084362391 11:68677493-68677515 GGATGTGGGTGTGCAGGAGGAGG - Intergenic
1084490016 11:69473112-69473134 GGGTCCTGGTGCCCAGGCAGAGG - Intergenic
1084564663 11:69922116-69922138 GGATCATGGGGTGCGGAAAGTGG + Intergenic
1088604127 11:111512554-111512576 GAAGCCTGGCGTGAAGGAAGTGG + Intergenic
1090302236 11:125652970-125652992 GGATACTAGAGTCCAGGAAGGGG - Intronic
1090374504 11:126279498-126279520 GGATCGTGGAGTGCGAGAAGAGG + Intergenic
1091002992 11:131926390-131926412 GTAACCTGGTGTGCAGGGAGGGG + Intronic
1091445005 12:539969-539991 AGTTCCTGGTGTGTAGGAACCGG + Intronic
1091680189 12:2521523-2521545 GGACCCTGGCGGGCAGGCAGAGG - Intronic
1092155825 12:6280960-6280982 GGAGGCTGGGGTGGAGGAAGTGG - Intergenic
1092280350 12:7093162-7093184 GGATGCGGGTGTGGAGCAAGAGG + Intronic
1094031475 12:26016489-26016511 GGAACCTGGGGTACAGGAAGGGG + Intronic
1095983914 12:47987361-47987383 GGATCCTGGAGGGCTGGAGGTGG - Intronic
1097068733 12:56339408-56339430 AGATCCTGGAATGAAGGAAGAGG - Exonic
1099241194 12:80141442-80141464 GGTGCCTGGTGTCCAGGAGGAGG + Intergenic
1100167796 12:91937988-91938010 GGAAGCTGCTGTACAGGAAGTGG - Intergenic
1101739005 12:107485331-107485353 GGGTCCTGAGGTGCAGGCAGGGG - Intronic
1102579937 12:113879875-113879897 GACTCCTGGTGGGCAGGCAGAGG + Intronic
1102895069 12:116592326-116592348 CGTTCCTGGGGTGCAGGGAGGGG + Intergenic
1103091707 12:118102794-118102816 GGAGGCTGGGGTGCAGGGAGAGG - Intronic
1103360427 12:120350453-120350475 GAAACCTGGAGTGAAGGAAGGGG - Intronic
1105394960 13:20022379-20022401 GCTTCCTGATGTGCACGAAGAGG - Intronic
1105421203 13:20253863-20253885 GAATCCTGTTGGGGAGGAAGGGG + Intergenic
1105780416 13:23701293-23701315 GGATCGTGGTGGGCAGGACCTGG + Intergenic
1108934783 13:55870699-55870721 TGAGCCAGGTGTGCAGCAAGTGG + Intergenic
1110302028 13:73939906-73939928 TGATCCTGGTGAGGAGCAAGGGG - Intronic
1111723911 13:91980748-91980770 GGATCCTGGTGTGCTGGTAATGG - Intronic
1114658398 14:24329706-24329728 AGATCCTAGGGTGCAGGGAGGGG - Intronic
1116485018 14:45437234-45437256 GGATCCTGGAGTGCAGTCACTGG + Intergenic
1116490243 14:45496384-45496406 TGAGCCTGATGTGCAGGAAAGGG + Intergenic
1117665597 14:58052942-58052964 TGATGCAGGTGTGCAGGTAGGGG - Intronic
1119427750 14:74546837-74546859 GGAACCAGGAGTGCAGCAAGTGG + Intronic
1119840811 14:77791473-77791495 GGATCCTGAGGCCCAGGAAGGGG + Intergenic
1119876435 14:78063640-78063662 TGATCCAAGGGTGCAGGAAGAGG - Intergenic
1120998501 14:90434804-90434826 GAATGCTGGGGTGCAGCAAGTGG - Intergenic
1122557131 14:102587000-102587022 CTATCCTGGTGGGCAAGAAGTGG + Intergenic
1124235176 15:27983883-27983905 GGGCCTTGGTGTCCAGGAAGGGG - Intronic
1124721802 15:32117103-32117125 GGATCCTGGGAAGCAGGATGAGG + Intronic
1126049302 15:44672211-44672233 GGAGTGTGGTGAGCAGGAAGTGG + Intronic
1126602173 15:50439991-50440013 GGATCCCTGAGTCCAGGAAGTGG + Intronic
1127186909 15:56489890-56489912 GTATTCTGTTGAGCAGGAAGCGG - Intergenic
1127655188 15:61048908-61048930 GGAAGATGGTGTGGAGGAAGAGG - Intronic
1129232813 15:74206123-74206145 GGTTACTGGTGTGCAGGGACGGG - Intronic
1129235324 15:74220325-74220347 AGAGCTGGGTGTGCAGGAAGTGG - Intergenic
1129693523 15:77727643-77727665 GGAATCTGGTGTACAGTAAGGGG + Intronic
1130984064 15:88833358-88833380 GGAGCTTGGGGAGCAGGAAGGGG - Intronic
1131407221 15:92175347-92175369 GGAGCATGGGATGCAGGAAGTGG - Intergenic
1133109256 16:3536010-3536032 GCATCCCTGTGTGAAGGAAGAGG - Intronic
1133294830 16:4746588-4746610 GGATCCTGATGGGGAGGAACAGG + Intronic
1135915600 16:26602925-26602947 GGCTCCTGATGTGGAAGAAGAGG + Intergenic
1136118492 16:28112087-28112109 GGTTCCAGGTGTGCAGCCAGCGG - Intronic
1136229188 16:28877039-28877061 GGTACCAGGGGTGCAGGAAGGGG - Intergenic
1136512041 16:30744033-30744055 GGATCCTGGTTGGAAGGATGGGG + Intronic
1137003306 16:35250631-35250653 GCCTCATGGAGTGCAGGAAGAGG - Intergenic
1138924730 16:61576906-61576928 GGACCCTGGGCTGAAGGAAGAGG - Intergenic
1139473027 16:67188399-67188421 GGATCCTGGAGGGAAGGCAGGGG + Intronic
1139828968 16:69781236-69781258 GGATACTGGGGAGCAGGAAGTGG + Intronic
1140908640 16:79431097-79431119 GTACCCTGGTGTGGAGGCAGTGG - Intergenic
1141168604 16:81677094-81677116 GGATCCTGGTGTCCCGCCAGGGG + Intronic
1142124600 16:88403891-88403913 GGTTCCTGGTGGGCAAGGAGGGG + Intergenic
1142354807 16:89597334-89597356 GGATCCTGGTGTGCTGGGCCTGG - Intergenic
1142592217 17:1011302-1011324 GGAGCCTGGAGTGGAGGACGGGG - Intronic
1142805250 17:2367985-2368007 GCAGCATGGTGTCCAGGAAGGGG + Intronic
1144777443 17:17791881-17791903 GGATTCTGCTCTGCAGGCAGGGG + Intronic
1144971221 17:19111064-19111086 GGGTCCTGGAGCGCAGGAGGCGG + Intergenic
1144991523 17:19237227-19237249 GGGTCCTGGAGCGCAGGAGGCGG + Intronic
1146274964 17:31510658-31510680 GGACCCTGGTGGGGAGAAAGAGG + Intronic
1146909104 17:36636797-36636819 GGGTCCTTGTGGTCAGGAAGTGG + Intergenic
1146979527 17:37146851-37146873 AGGTGCTGGTTTGCAGGAAGGGG - Intronic
1147984131 17:44294836-44294858 GGAACCTGGTGAACAGAAAGTGG - Intergenic
1148756104 17:49973754-49973776 GAATTCTGGGGGGCAGGAAGGGG + Exonic
1149623083 17:58060622-58060644 GGCTCCTGGTGAGGAGGAAAAGG - Intergenic
1150491501 17:65577397-65577419 GGGGCCTGGCGTGCAGGAAGTGG - Intronic
1151575193 17:74949649-74949671 GGATCGTGGTGGGAAGGCAGGGG - Exonic
1152094980 17:78267591-78267613 AGATCCGAGTGTGCAGGCAGTGG + Intergenic
1152209176 17:78994049-78994071 GAATCCTGGAGAGCAGGGAGGGG - Intronic
1152230634 17:79112506-79112528 GGATCCTGGGGTGGAGGAGACGG + Intronic
1152297372 17:79475904-79475926 GGATCCTGGCCTCCAGGAATTGG + Intronic
1153614726 18:6923865-6923887 GGACCCTGCTGTGCAGCAATGGG - Intergenic
1156283315 18:35663443-35663465 GGACACTGGTGTGGAGGTAGAGG + Intronic
1156391292 18:36652776-36652798 GGAGCCTGGTGTGGCGGAGGAGG - Exonic
1157716144 18:49888716-49888738 AGATCCTGGAGGGCGGGAAGAGG - Intronic
1158478169 18:57798705-57798727 GGCTTCTACTGTGCAGGAAGAGG + Intronic
1159040213 18:63318099-63318121 GGATCCAGGTGTGCAGGTGCCGG + Exonic
1159100098 18:63949191-63949213 ATCTCCTGATGTGCAGGAAGTGG - Intergenic
1160741024 19:685887-685909 GGCCCCTGGTGTGCAGGAACCGG - Exonic
1161021812 19:2014553-2014575 GGGACCTGGGGTGCAGGGAGGGG + Intronic
1161356408 19:3821540-3821562 GGATCTTGGGGTGCAGGGAGAGG + Intronic
1161563270 19:4985545-4985567 GGATCCTGCTGTGCAGGCTGGGG + Intronic
1161964299 19:7539900-7539922 GGATCCTGGTGGGAGGGGAGGGG - Exonic
1163399394 19:17082852-17082874 GTGTCCTGGAGTGCAGAAAGTGG + Intronic
1163406820 19:17128029-17128051 GGATCCTGGTGGCCAGGGGGAGG - Intronic
1164670108 19:30067588-30067610 GGATCCTGGAGGGCAGTCAGGGG + Intergenic
1164752320 19:30665984-30666006 GGATCCTGGGGTCCAGGCTGGGG + Intronic
1166539957 19:43598758-43598780 TGATTCTGGGGTTCAGGAAGAGG + Intronic
1166555955 19:43699993-43700015 GGACCCTGGTGTGAGGAAAGAGG - Intergenic
1168281811 19:55309953-55309975 GGGTCCAGGGGTCCAGGAAGGGG - Intronic
1168316709 19:55487779-55487801 GCTGCCTGGTGTGCAGGCAGTGG + Intergenic
1168343991 19:55641609-55641631 GGAGCCTGGTGTGCATAACGGGG + Intronic
926434436 2:12824069-12824091 GGATCATGATGTGAAGGAAAAGG + Intergenic
926702252 2:15811339-15811361 GGAGCCTGGTGGGGGGGAAGGGG + Intergenic
927792029 2:26017880-26017902 GAATCCTGCTCTGCAGGAATAGG + Intergenic
927934532 2:27068904-27068926 GGATGGTGGAGGGCAGGAAGGGG - Intronic
928120521 2:28580741-28580763 GGACCCTGGTGTGTGGGAAAGGG + Intronic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
931029398 2:58155490-58155512 GTCTCCTGGTGGGAAGGAAGGGG + Intronic
932105553 2:68937983-68938005 GGAAGTTGGGGTGCAGGAAGGGG - Intergenic
932584542 2:73018848-73018870 GGATCCTGGGTTGCAGCAGGTGG - Intronic
932621378 2:73266411-73266433 GGGGCCAGGTGTGCAGGTAGAGG + Intronic
935492137 2:103734095-103734117 AGATCCTGGGCTGAAGGAAGAGG - Intergenic
935601000 2:104921245-104921267 GGATGCTCATGTGCATGAAGGGG + Intergenic
936059226 2:109283551-109283573 AGATCCTGGTGAGCAGGATGGGG + Intronic
936252202 2:110875614-110875636 GGATCGAGGTGAGCAGCAAGGGG - Intronic
937147944 2:119663443-119663465 GGCTCATGGTGAGGAGGAAGGGG - Intergenic
938239194 2:129729896-129729918 AGTTCCTGGTGTGCAGGTGGTGG - Intergenic
941013013 2:160322715-160322737 GGAGCCTCTTGTGCTGGAAGTGG - Intronic
946386306 2:219386518-219386540 GGCTCAAGGTGTGAAGGAAGGGG + Intronic
946773949 2:223118037-223118059 GGAGCCTGGGGTGCAGGGAGGGG + Intronic
946860990 2:224000268-224000290 GGGTGCTGGTGGCCAGGAAGAGG + Intronic
948237806 2:236403455-236403477 GGAGCCTGGTGTGAAGGGAATGG + Intronic
948339397 2:237237465-237237487 GGTTACTGGCTTGCAGGAAGGGG - Intergenic
948412600 2:237775461-237775483 GGATCCTCCTGTGCATAAAGTGG + Intronic
948795945 2:240402165-240402187 GAATCCTGGGGTGCAGGGACAGG - Intergenic
1169093960 20:2879454-2879476 TGACCATGGTGAGCAGGAAGGGG + Intronic
1171005287 20:21458907-21458929 TGATCATGGTGTGCCTGAAGTGG + Intergenic
1172056679 20:32159023-32159045 GGAGCCTGGTGTGTGGAAAGGGG + Intronic
1172501943 20:35433844-35433866 GATTCCAGGAGTGCAGGAAGGGG + Exonic
1174342211 20:49905088-49905110 GGATCCTTGTGTTTAGGAAGGGG + Exonic
1174372134 20:50098057-50098079 AGATCCTGGTGTTCCGGAGGAGG + Intronic
1175983276 20:62752144-62752166 GGGTCCTTCTGTCCAGGAAGGGG + Intronic
1178351054 21:31873393-31873415 GGATCCTGGTGTCCTGAAAGGGG + Exonic
1178952001 21:36992866-36992888 GGCTGCTGGTCTGCAGGAAGGGG - Intergenic
1180650154 22:17370121-17370143 GGATCCTGGGGTGGAGGAGCAGG + Intronic
1181344460 22:22208130-22208152 GGCTCCTGAGGTGCAGGAAGTGG - Intergenic
1181620146 22:24085423-24085445 GGACCCTGGTGTGCAGGGCAAGG + Intronic
1181646196 22:24232854-24232876 GGATGCTGTTGTGCAGGAAACGG + Exonic
1182004588 22:26949329-26949351 GCTTCCTGGTGTGCAGTAAATGG - Intergenic
1183271755 22:36866642-36866664 GGCTCCTGGTGTCCAGGAGATGG - Intronic
1183811995 22:40265497-40265519 GGATCTTGGGGTGCAGCTAGGGG + Exonic
1183986812 22:41574715-41574737 CGATGCTGGCGGGCAGGAAGAGG - Exonic
1184727768 22:46356481-46356503 GGAACCTGGGGTGAGGGAAGCGG + Intronic
1184773879 22:46613634-46613656 GCATCCTGGAGGCCAGGAAGGGG + Intronic
950614598 3:14148680-14148702 GCATCATGCTGGGCAGGAAGAGG + Exonic
950679196 3:14573418-14573440 GGATCCTGGTGTGCAGGAAGAGG + Intergenic
950881415 3:16325753-16325775 GGATCCTGGTGAGCCAGAGGAGG + Intronic
953474602 3:43194849-43194871 GGCTCCTGGCCTGCAGGAGGAGG - Intergenic
954663409 3:52237880-52237902 GGATCCTAGTGTGGTGGGAGGGG + Intronic
956431800 3:69193852-69193874 GGATCCTGCTTTGCAAGAACTGG - Exonic
957549267 3:81682570-81682592 CCATCCTAGTGTGCATGAAGTGG - Intronic
957952807 3:87146864-87146886 GGCTCCTGATGTGGAGGAAGAGG - Intergenic
959002712 3:100982963-100982985 GGATTCTGGTGTTCAAGGAGGGG - Intronic
960005516 3:112777269-112777291 GGGATCTGGTGTGCAGGCAGTGG + Intronic
961468971 3:127099539-127099561 GGAGGCTGGGGTGAAGGAAGGGG + Intergenic
961531895 3:127545026-127545048 GGGTCTGGGTGAGCAGGAAGAGG + Intergenic
961722942 3:128908241-128908263 GGATCCTGGTAGTCAGGATGCGG - Exonic
964030046 3:152127475-152127497 ATATCCTGGTGTGCTGGTAGGGG - Intergenic
966942540 3:184756132-184756154 GGAAACTGAAGTGCAGGAAGTGG - Intergenic
967887171 3:194341277-194341299 GGATCTGGCTGTGCAGGAAAGGG - Exonic
968488602 4:877389-877411 GGATCCTGGTCAGCAGCAGGAGG - Intronic
968488613 4:877448-877470 GGATCCTGGTCAGCAGCAGGAGG - Intronic
969100590 4:4765348-4765370 GGAACCTGGGGTGCAGGACAAGG - Intergenic
969199316 4:5590040-5590062 GGATCCAGGCATTCAGGAAGAGG + Intronic
970067498 4:12115868-12115890 AGATCCTGGTGTACAAGAAGTGG - Intergenic
970662127 4:18297137-18297159 AGATCCTGGAGTGGAGAAAGAGG + Intergenic
973267171 4:48222160-48222182 GGATCCTGGCAGGCAGGCAGAGG + Intronic
975477728 4:74842682-74842704 TGTTCCTGGTGTCCAGGATGTGG + Intergenic
976812377 4:89111183-89111205 GGATCCTCGCGTGCCGGGAGCGG - Intronic
979440035 4:120740681-120740703 GGAGCCAGGTGAGCAGGAATAGG - Intronic
984607038 4:181797242-181797264 TGATCATGGTGAGCAGTAAGAGG - Intergenic
985341064 4:188955251-188955273 GAATCATGGTGGACAGGAAGGGG + Intergenic
986065225 5:4228491-4228513 TGATCATGGTGTCCAGCAAGTGG + Intergenic
986225102 5:5804940-5804962 GGGTCCTGCTGAGAAGGAAGAGG + Intergenic
986256762 5:6107353-6107375 GGCTCTTGGTGAGCAGGAAGAGG - Intergenic
986985345 5:13494370-13494392 AGATCCTGGACTGAAGGAAGTGG - Intergenic
987148149 5:15012559-15012581 AGGTACTGGTGTGCAGGAGGGGG + Intergenic
987230826 5:15892017-15892039 GGAGGCTGGTGAGCAGGAGGAGG - Intronic
988898288 5:35702143-35702165 GGATCCTGCTGGTCTGGAAGGGG - Intronic
997377288 5:133406236-133406258 GGAACCTGGCATGCAGGGAGAGG + Intronic
998160240 5:139809067-139809089 AGATCCAGGTGGGGAGGAAGTGG - Intronic
998480772 5:142460801-142460823 GGTTCCAGGTGTGCAGGCATGGG + Intergenic
999534127 5:152498959-152498981 ATATCCTGGTGTGTAGGCAGGGG - Intergenic
1001238546 5:170050201-170050223 GGACCCAGGTGTGAAGAAAGGGG - Intronic
1002627711 5:180542923-180542945 GGATCCTAATTTTCAGGAAGAGG - Intronic
1003106199 6:3218123-3218145 GGATCTTGGTTTGCAGGAAAGGG - Intergenic
1003139000 6:3456244-3456266 GGATCCAGGTGAGCAGCACGAGG + Exonic
1003891569 6:10568341-10568363 GGATCCTGGGGTACCAGAAGTGG - Intronic
1004882757 6:20024779-20024801 GGATGCTGGTGTGAAGGATCAGG - Intergenic
1006192333 6:32217262-32217284 GAATCCTGGTGGGGCGGAAGTGG + Exonic
1006218970 6:32471749-32471771 GGATCCTGGAAAGCAAGAAGGGG + Intergenic
1006224828 6:32528473-32528495 GGATCCTGGAAAGCAAGAAGGGG + Intronic
1006231150 6:32587979-32588001 GGATCCTGGAAAGCAAGAAGGGG + Intronic
1007174861 6:39888768-39888790 GGACCCTCGTGGGAAGGAAGGGG + Intronic
1007308119 6:40923097-40923119 GGAGAGTGGTGTGCAGGCAGAGG + Intergenic
1007324474 6:41049559-41049581 GTATCCTCCTGTGCAGGAGGGGG + Intronic
1007419780 6:41712610-41712632 GGCCCCTGGTGAGGAGGAAGAGG - Intronic
1007703967 6:43780174-43780196 GAATCCCGGTGTGGGGGAAGCGG - Intronic
1008413908 6:51217137-51217159 AGAACCTGGAGGGCAGGAAGTGG - Intergenic
1008434182 6:51455938-51455960 GGAACCTGGAGTTCAGGAAGGGG + Intergenic
1008511035 6:52276082-52276104 GGATTCTGCTGTGCAGGAATGGG + Intronic
1008533726 6:52490155-52490177 GGATCCAGGCGTGCAGGAATTGG + Exonic
1012269013 6:97184424-97184446 TGATCCTAGAGTTCAGGAAGAGG - Intronic
1013225268 6:108116083-108116105 AGATACTGGTATGCAGAAAGGGG + Intronic
1013911257 6:115278701-115278723 GGTTGCTGGTGTGTGGGAAGGGG + Intergenic
1018379927 6:163249533-163249555 GGATCCTGATGGGCCGGAAGTGG + Intronic
1018996529 6:168714583-168714605 GGATGATGGTGAGGAGGAAGAGG + Intergenic
1018996713 6:168715779-168715801 GGATGATGGTGAGGAGGAAGAGG + Intergenic
1018996723 6:168715860-168715882 GGATAATGGTGAGGAGGAAGAGG + Intergenic
1022337771 7:29438097-29438119 GGATACTGGTGGGCAGAAAAAGG + Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1024033859 7:45489636-45489658 GGGGCCTGGTGTGGAGGATGTGG - Intergenic
1026325679 7:69307183-69307205 GGAAGATGCTGTGCAGGAAGGGG - Intergenic
1026840406 7:73667701-73667723 CGATCCTGGGGTGCTGGAGGCGG + Intergenic
1026874063 7:73869739-73869761 GGATCCTGGCGCCCAGGATGGGG + Intergenic
1029129494 7:98319161-98319183 GGGTCTGGGTGAGCAGGAAGGGG + Intronic
1029307326 7:99629845-99629867 GGTGCCAGGTGTGCGGGAAGCGG + Exonic
1032054623 7:128674506-128674528 TGATGGTGATGTGCAGGAAGGGG - Intronic
1032253179 7:130275408-130275430 GGAGCCTGGGGTGCTGGATGGGG - Intronic
1032456243 7:132075473-132075495 GGATCCTAATGTGCAGTAAACGG + Intergenic
1033756665 7:144402221-144402243 AGATCCTGCTTTGCAGGGAGGGG - Intronic
1033886704 7:145957354-145957376 AGATGCAGGTGTTCAGGAAGTGG + Intergenic
1034165640 7:149023068-149023090 AGTTCCTGGTGTGGAGGGAGGGG - Intronic
1035043019 7:155944693-155944715 GGATGCTGGTGTCCAGGGAGAGG - Intergenic
1035228259 7:157445421-157445443 GGCTCCCGGTGTGAAGGCAGAGG - Intergenic
1035616152 8:1003255-1003277 GGATGCAGGAGTGAAGGAAGAGG - Intergenic
1037907149 8:22722221-22722243 GAATCCTTGAGTGAAGGAAGAGG - Intronic
1039371291 8:36986607-36986629 GGATCCTGGGAGGAAGGAAGGGG - Intergenic
1040572677 8:48624416-48624438 AGAGCTTGGTGTGCAGGGAGAGG - Intergenic
1040579922 8:48689417-48689439 GGATCCTCTGCTGCAGGAAGAGG - Intergenic
1045054550 8:98357972-98357994 TGATGCTGGAGTTCAGGAAGAGG - Intergenic
1045062839 8:98423918-98423940 GGGTACAGGTGTGCAGGGAGAGG - Intronic
1045429746 8:102102696-102102718 AGAGCCTGGTGTGCAGAAGGAGG - Intronic
1045557793 8:103231500-103231522 GCTTCCTGGTGTGCAGAATGAGG + Intergenic
1045962354 8:107982995-107983017 GGCTCCTGGGGTGCAGAGAGGGG + Intronic
1047218118 8:122895594-122895616 GCATCCTGGTGTCATGGAAGTGG + Intronic
1049499881 8:142956081-142956103 GGACCCTGGCCTGCAGGCAGGGG + Intergenic
1049504378 8:142987874-142987896 GGATCCCTGCGTGGAGGAAGAGG + Intergenic
1049538080 8:143191776-143191798 GGGTCAGGGAGTGCAGGAAGGGG + Intergenic
1052245765 9:26332158-26332180 TGATCCTGGTGGGCAGTAAGTGG - Intergenic
1056876568 9:90338958-90338980 TGATCCTGGTGTGATTGAAGGGG - Intergenic
1057187507 9:93065092-93065114 GGACCCTGGTGGGTGGGAAGGGG + Intronic
1057516305 9:95724753-95724775 TGATCCTCCTGTCCAGGAAGTGG - Intergenic
1059356729 9:113705519-113705541 GGAGAGTTGTGTGCAGGAAGTGG - Intergenic
1060951717 9:127608274-127608296 GGCTCCAGTTGTGCAGGGAGGGG + Intergenic
1061268617 9:129523279-129523301 GGGGCCTGGAGTGCAGGGAGGGG + Intergenic
1062513506 9:136920888-136920910 GGGTTCTTGTGTGCAGGGAGTGG + Intronic
1203770143 EBV:45742-45764 GAATCCTGGAGGGCATGAAGAGG + Intergenic
1187083499 X:16016737-16016759 AGACCCAGGTGGGCAGGAAGTGG - Intergenic
1187125419 X:16449860-16449882 GGATCCTGGGGATAAGGAAGAGG - Intergenic
1190282505 X:48940293-48940315 GGAAGCTGGTGTACAGGAAATGG + Intronic
1190328361 X:49220503-49220525 GGTGCCTGGTGTGGAGAAAGAGG - Exonic
1195280454 X:103328181-103328203 GCAGCCTGGGGTTCAGGAAGGGG - Intergenic
1196138268 X:112233088-112233110 GCATCCTGGTGGGCATAAAGGGG + Intergenic
1196627419 X:117892117-117892139 GGAAGCTGGTCTGCAGGAGGAGG + Intergenic
1197129042 X:122982719-122982741 TGATCCTCTTGGGCAGGAAGAGG - Intergenic
1198274448 X:135087968-135087990 GGATTCTGGCGGCCAGGAAGAGG + Intergenic
1198421442 X:136473387-136473409 GAAGCCTGGTGAGCAGGACGTGG - Intergenic
1199013018 X:142779042-142779064 TGATCCTGGCGTTCAGGAGGAGG + Intergenic
1199786538 X:151111646-151111668 GGACCCTGCTGTGCTTGAAGGGG + Intergenic
1201712432 Y:17007455-17007477 TGATGCTGATGTGCAGGATGTGG - Intergenic