ID: 950679302

View in Genome Browser
Species Human (GRCh38)
Location 3:14573988-14574010
Sequence GCGAAAACTTGGCACCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950679294_950679302 23 Left 950679294 3:14573942-14573964 CCTGCGCGAATGAAGCTGTGCAC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 950679302 3:14573988-14574010 GCGAAAACTTGGCACCCAGGTGG 0: 1
1: 1
2: 0
3: 5
4: 81
950679299_950679302 -8 Left 950679299 3:14573973-14573995 CCTGGCATATGCAAGGCGAAAAC 0: 1
1: 0
2: 0
3: 2
4: 65
Right 950679302 3:14573988-14574010 GCGAAAACTTGGCACCCAGGTGG 0: 1
1: 1
2: 0
3: 5
4: 81
950679297_950679302 1 Left 950679297 3:14573964-14573986 CCTGCGGATCCTGGCATATGCAA 0: 1
1: 0
2: 1
3: 11
4: 125
Right 950679302 3:14573988-14574010 GCGAAAACTTGGCACCCAGGTGG 0: 1
1: 1
2: 0
3: 5
4: 81
950679293_950679302 24 Left 950679293 3:14573941-14573963 CCCTGCGCGAATGAAGCTGTGCA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 950679302 3:14573988-14574010 GCGAAAACTTGGCACCCAGGTGG 0: 1
1: 1
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950679302 Original CRISPR GCGAAAACTTGGCACCCAGG TGG Intergenic