ID: 950679377

View in Genome Browser
Species Human (GRCh38)
Location 3:14574453-14574475
Sequence CAGCCACCTGATGCTGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950679377_950679383 16 Left 950679377 3:14574453-14574475 CCAAAGGCAGCATCAGGTGGCTG 0: 1
1: 0
2: 2
3: 18
4: 175
Right 950679383 3:14574492-14574514 GGTCCAGGGCCCTGCCAGTGAGG 0: 1
1: 1
2: 5
3: 26
4: 309
950679377_950679381 1 Left 950679377 3:14574453-14574475 CCAAAGGCAGCATCAGGTGGCTG 0: 1
1: 0
2: 2
3: 18
4: 175
Right 950679381 3:14574477-14574499 GCTCAAGCTCACTGCGGTCCAGG 0: 1
1: 1
2: 1
3: 6
4: 79
950679377_950679382 2 Left 950679377 3:14574453-14574475 CCAAAGGCAGCATCAGGTGGCTG 0: 1
1: 0
2: 2
3: 18
4: 175
Right 950679382 3:14574478-14574500 CTCAAGCTCACTGCGGTCCAGGG 0: 1
1: 1
2: 0
3: 8
4: 80
950679377_950679380 -5 Left 950679377 3:14574453-14574475 CCAAAGGCAGCATCAGGTGGCTG 0: 1
1: 0
2: 2
3: 18
4: 175
Right 950679380 3:14574471-14574493 GGCTGGGCTCAAGCTCACTGCGG 0: 1
1: 0
2: 1
3: 29
4: 249
950679377_950679388 30 Left 950679377 3:14574453-14574475 CCAAAGGCAGCATCAGGTGGCTG 0: 1
1: 0
2: 2
3: 18
4: 175
Right 950679388 3:14574506-14574528 CCAGTGAGGTACTCCTGCTCCGG 0: 1
1: 0
2: 1
3: 12
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950679377 Original CRISPR CAGCCACCTGATGCTGCCTT TGG (reversed) Intergenic
900519081 1:3097005-3097027 GAGCCACCTGCTGCAGCCATGGG + Intronic
900621452 1:3589398-3589420 CAGCCACAAGATCCTGCCTCAGG + Intronic
901180025 1:7335406-7335428 CAGCCACCTGTCAGTGCCTTGGG + Intronic
902648324 1:17819557-17819579 CAGCCCCAGAATGCTGCCTTCGG + Intronic
903315218 1:22498403-22498425 CAGCCCCCTAAAGCTGCCTAGGG - Intronic
904976201 1:34458683-34458705 CAGCCACCAGAAGATGCTTTTGG + Intergenic
905039304 1:34941026-34941048 CAGCCAACTTAAGCTACCTTTGG - Intergenic
911092729 1:94030629-94030651 GAGGCACCGAATGCTGCCTTGGG + Intronic
913377814 1:118173746-118173768 CAGCTACTTGAGGCTGACTTGGG + Intronic
915088437 1:153404869-153404891 CAGCCACGTGGTACTGCCTCCGG + Intergenic
915640431 1:157220118-157220140 CAGCCTCCTGAGGCTCCCTAGGG - Intergenic
915923925 1:160001861-160001883 CATCTATCTGCTGCTGCCTTTGG + Intergenic
916886151 1:169070409-169070431 CAGCCTCATGTTACTGCCTTGGG + Intergenic
917556587 1:176096491-176096513 CAGGCCCCTGAGGCCGCCTTGGG - Intronic
918961141 1:191279725-191279747 ATGCCACCTGAAGCTTCCTTTGG + Intergenic
920403096 1:205689462-205689484 CACCCAGCTGATGCGGCCTCAGG - Intergenic
921244381 1:213221381-213221403 CATCCCCCTTATGCTGACTTAGG + Intronic
924571567 1:245241708-245241730 CAGCCAGCTGGGGCTGCCATGGG - Intronic
1063009957 10:2012151-2012173 CAGGCACCCGTTGCTGCCTCTGG - Intergenic
1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG + Intronic
1071741413 10:88362690-88362712 CAGCCTCCAGTTGCTGCCTTTGG + Exonic
1072625047 10:97105894-97105916 CATCCACCTGATGGTGCCCTTGG - Intronic
1073524982 10:104172106-104172128 CAGCCACCTCATGCCAACTTTGG - Intronic
1074363059 10:112838215-112838237 CAGCCACCTGGGGCTGTCTTGGG - Intergenic
1076028683 10:127139688-127139710 CTTCCACCTGATGCTGGTTTGGG + Intronic
1076653130 10:132003731-132003753 CAGCCAGCTGAGGGTGCCTGGGG - Intergenic
1077327597 11:1970463-1970485 CAGCCCCCTGCAGCTGCCCTCGG + Intronic
1081993490 11:47349863-47349885 CAGCCTCCTGAAGCCGCCTGTGG - Exonic
1082114379 11:48312363-48312385 CAGCTACCACCTGCTGCCTTTGG - Intergenic
1083780927 11:64916896-64916918 CAGCGACCTGAGGCTCCCTGCGG - Intronic
1085457788 11:76675020-76675042 CAGCCACCTCATCCTGGCCTTGG - Intergenic
1086915251 11:92522688-92522710 AAGCCAGCTGATACTGGCTTAGG - Intronic
1088873035 11:113909139-113909161 CAGCCAGCTGGTGGGGCCTTTGG - Intronic
1089650677 11:119910824-119910846 CTTCCACCTGTTGCTGCCATGGG + Intergenic
1091179923 11:133595346-133595368 CATCCTTCTGATGATGCCTTTGG - Intergenic
1202810579 11_KI270721v1_random:25643-25665 CAGCCCCCTGCAGCTGCCCTCGG + Intergenic
1092771407 12:11900469-11900491 GAGCCACCTGATGCTGGCAGGGG - Intergenic
1094268533 12:28585856-28585878 TAGCCACCTGAAGATGCTTTGGG + Intergenic
1096557972 12:52415409-52415431 CACCTACCTGATGCTGAGTTTGG - Intergenic
1102948286 12:117009826-117009848 TAGCCACTGGATGCTTCCTTCGG - Intronic
1103049976 12:117770611-117770633 CAGCCACCAGATTCTGTGTTAGG + Intronic
1103854838 12:123959587-123959609 GAGCCACCGCATGCGGCCTTAGG + Intronic
1103870619 12:124088686-124088708 CAGCCTGCTGATGCTGGCTTTGG - Intronic
1106568681 13:30907539-30907561 CAGCCATCTGAAGCAGGCTTTGG + Intronic
1108827010 13:54424510-54424532 CAGTCACATGATGCTTCATTGGG + Intergenic
1110473094 13:75882632-75882654 CAGCAACCTCATCCTGTCTTTGG - Intronic
1111168469 13:84493639-84493661 AAGCCAGCTGATGCTGCACTAGG - Intergenic
1112206147 13:97325189-97325211 CAGGCACCAGATGCTTCATTTGG - Intronic
1112948775 13:104963360-104963382 CAGTCACACGAGGCTGCCTTGGG + Intergenic
1113802906 13:113095736-113095758 CAGCCTCCTGGTGCTGCGTGTGG - Intronic
1119434479 14:74589018-74589040 CAGCCACCAAATGCACCCTTGGG + Intronic
1127363193 15:58262906-58262928 CACAGACCTGGTGCTGCCTTAGG - Intronic
1127605282 15:60581036-60581058 CAGCCATCTGAAGATGCCTCAGG - Intronic
1128496476 15:68201244-68201266 CTGCCACCTGGTCCTGACTTTGG - Intronic
1129539383 15:76338363-76338385 CAGCCGCCAGCTGCTGCCTGGGG + Exonic
1129825127 15:78629873-78629895 CAGCCACAGGACGCTGCCGTTGG + Exonic
1130627792 15:85533822-85533844 CAGGCACCTGAAGCTGCCCACGG + Exonic
1130666016 15:85870654-85870676 CAGCCACCTGCTGCGCCCTTTGG - Intergenic
1135551123 16:23399085-23399107 CAGCCACCTGATGTTGGATCCGG + Intronic
1135957543 16:26968468-26968490 GAGCCACCACATCCTGCCTTGGG - Intergenic
1136099064 16:27980048-27980070 CAGCCTCCTGCTTCTGGCTTGGG - Intronic
1136631930 16:31493882-31493904 CAGCCTCCTGATGCTCCCTCTGG - Exonic
1136737117 16:32475349-32475371 CAGCCGCCTGCTGCTGCCGCCGG + Intergenic
1138558352 16:57785862-57785884 CATCCCCCAGATGCTGCCTGGGG - Intronic
1138599071 16:58044600-58044622 AAGGAACCTGGTGCTGCCTTGGG - Intronic
1141432516 16:83977758-83977780 CAGCCATCTCATGCTGCCTCAGG + Intronic
1203015954 16_KI270728v1_random:354228-354250 CAGCCGCCTGCTGCTGCCGCCGG - Intergenic
1203034289 16_KI270728v1_random:627386-627408 CAGCCGCCTGCTGCTGCCGCCGG - Intergenic
1143108127 17:4539561-4539583 GAGCCTTCTGATGCTGCTTTTGG + Exonic
1143296289 17:5874406-5874428 CAGCCACTTGCTGCTGCAGTGGG + Intronic
1144249878 17:13405649-13405671 CATTCACAGGATGCTGCCTTGGG - Intergenic
1144455615 17:15415954-15415976 CAGCAACCTAATGCTTCCTGAGG - Intergenic
1146399193 17:32490054-32490076 CAGCCACCAGGTTCTGCCTCAGG - Exonic
1146595799 17:34167421-34167443 CAGCTACCAGAGGCTGGCTTTGG + Intronic
1148161793 17:45454327-45454349 CAGGCAGCAGAGGCTGCCTTGGG - Intronic
1149044224 17:52225632-52225654 CTGCCACCTGATGATTCCTTTGG + Intergenic
1150393027 17:64800972-64800994 CAGGCAGCAGAGGCTGCCTTGGG - Intergenic
1150859413 17:68786117-68786139 CAGCCACCTGATGGTTTCATTGG - Intergenic
1153684656 18:7533713-7533735 CAGCCACCCCATGGTTCCTTTGG + Intergenic
1153768458 18:8396690-8396712 CCTCCACCTGCTGCTGACTTTGG - Intronic
1157469691 18:47979662-47979684 CTGACATCTGATGCTGCCTGAGG + Intergenic
1161552617 19:4922715-4922737 CAGCCTCCTGATGCCGCTTCTGG - Intronic
1164819992 19:31242485-31242507 CACCCATCTTCTGCTGCCTTTGG - Intergenic
1164820000 19:31242545-31242567 CACCCATCTGCTGCTGCCTTTGG - Intergenic
1164820010 19:31242665-31242687 CATACATCTGCTGCTGCCTTTGG - Intergenic
1164820022 19:31242785-31242807 CACCCATCTGCTGCTGCCTGTGG - Intergenic
1165950513 19:39471700-39471722 CCGCCACCTGGTGCTGGCTGGGG + Exonic
926087056 2:10027213-10027235 CACCTACCTGATGCTGCCTTTGG + Intergenic
928869615 2:35961240-35961262 CAACCCCCAGATGCTGCCATGGG - Intergenic
930363254 2:50408429-50408451 CAGCTACATCATGCAGCCTTGGG - Intronic
931628649 2:64279920-64279942 CTGCCTCCTGACTCTGCCTTTGG - Intergenic
932399216 2:71468166-71468188 TGTCCACCTGATGCTGCCTAAGG + Intronic
937801201 2:126082173-126082195 CACCCAACTGATTTTGCCTTCGG + Intergenic
938927482 2:136057524-136057546 CATCTACCTGATGCTGACTTGGG + Intergenic
940962990 2:159805965-159805987 CAGCCAACTTGTTCTGCCTTAGG + Intronic
941163972 2:162065593-162065615 CAGCCCCCTGATGCTGTATGAGG - Intronic
944201005 2:197107390-197107412 CAGACACCAGATGCTGTCTTTGG + Intronic
945204576 2:207318583-207318605 TAGCCATCTGATGTTTCCTTAGG - Intergenic
947308618 2:228775865-228775887 CAGACATCTGATGCTGTCTGAGG + Intergenic
948694754 2:239727547-239727569 CACCCACCTGATGCTGCACCCGG - Intergenic
1170745960 20:19099159-19099181 CAGCCACAGCCTGCTGCCTTCGG + Intergenic
1171348205 20:24482469-24482491 AAGGCACCTGAGGCAGCCTTTGG + Intronic
1172597968 20:36163516-36163538 CCACCACCTGATGCTCACTTAGG - Intronic
1172639554 20:36432538-36432560 CAGCCACCTGCCCCAGCCTTGGG + Exonic
1172900451 20:38330887-38330909 CAGCCCCCCGATGTTGCCTTTGG - Intronic
1173904675 20:46617690-46617712 CAGCCAGCTTATGCTGGCTTGGG - Intronic
1175119834 20:56709168-56709190 GAGCCACCGGATGCTACATTCGG - Intergenic
1178496108 21:33087666-33087688 CAGGCACTTGAGGCTGCCTTTGG - Intergenic
1178662656 21:34520571-34520593 CAGCAATCTGATGTTCCCTTGGG - Intronic
1181444261 22:22956708-22956730 CAGCAGCCTGTTGCTGCCATAGG - Intergenic
1182092481 22:27605358-27605380 TAGCCACCTACTCCTGCCTTAGG + Intergenic
1183512279 22:38243281-38243303 CAGCCATCTGCTGCCGCCTCTGG + Intronic
1183513811 22:38251523-38251545 CAGCCTCCGTCTGCTGCCTTGGG - Intronic
1184789834 22:46693259-46693281 CAGTGACCTGACGCTGCCTGGGG + Intronic
949639674 3:6021841-6021863 GAGACACATGTTGCTGCCTTTGG + Intergenic
950179788 3:10903193-10903215 CGGTCAGCTGATGCTGGCTTTGG + Intronic
950679377 3:14574453-14574475 CAGCCACCTGATGCTGCCTTTGG - Intergenic
953035569 3:39207549-39207571 CAGACACCTCAGGCTGCCTCTGG + Intergenic
953690512 3:45113941-45113963 GAGCCAACTGATGTTGCCCTGGG - Intronic
956793954 3:72701580-72701602 CAGCCTCCTTCTGCAGCCTTGGG + Intergenic
961368243 3:126414770-126414792 CAGCCCACTCTTGCTGCCTTGGG + Intronic
961466806 3:127086892-127086914 CCGGGACCGGATGCTGCCTTGGG + Intergenic
962186975 3:133270539-133270561 CTACCACCTGCTGCTGCTTTTGG + Intronic
964400175 3:156290485-156290507 CAGCCAACTGATGCTTAGTTTGG + Intronic
964551314 3:157887845-157887867 GAGCCAGCTGCTGCTGCCATTGG - Intergenic
964851085 3:161096945-161096967 CTGCCACCTGGTGCTCGCTTTGG - Intronic
965232547 3:166072108-166072130 CAGCTACCTTGTGCAGCCTTGGG + Intergenic
965545162 3:169908427-169908449 GAGTCTCCTGATGCTGCCTCAGG - Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
965823490 3:172708224-172708246 TAGGCAGCTGATGCTGTCTTAGG + Intronic
966336808 3:178877344-178877366 CAGCTTCCTGATGCTGGATTTGG + Intergenic
966735771 3:183185951-183185973 CAGCCAGCTCAGACTGCCTTAGG - Intronic
967267454 3:187702958-187702980 CAGCCACCTTAGCCTGGCTTGGG - Intronic
967920987 3:194614269-194614291 CAGCTACATGATCCAGCCTTTGG - Intronic
969673138 4:8600800-8600822 CAGCCAGCTGATGCTGCATTAGG - Intronic
970187885 4:13482858-13482880 CAGATACCTGCTTCTGCCTTTGG - Intronic
970504068 4:16708929-16708951 AAGCCACCTCATCCTGCCCTGGG + Intronic
971252333 4:24983855-24983877 CAGGCAATTGATGCTGGCTTGGG - Intergenic
975045580 4:69799376-69799398 CAGCCAACTACAGCTGCCTTGGG + Intergenic
985060843 4:186076730-186076752 CAGCCACCTGAAGTTGACTCAGG + Exonic
988715391 5:33822232-33822254 AAGCCACATGATGCTCCATTTGG + Intronic
988852422 5:35192882-35192904 CAGCCAGATGCTGCTGCATTAGG + Intronic
989422668 5:41257778-41257800 CAGCCCCCTCATGCTGAATTAGG + Intronic
991932167 5:71764684-71764706 CAGCCAGCTCAAGCTGGCTTTGG - Intergenic
991973868 5:72166732-72166754 CAGCCAGCTACTGCTGCCTGGGG - Intronic
993511167 5:88773061-88773083 CAGCCGCCTGTGGCTGCCTGGGG + Intronic
996342890 5:122457630-122457652 CTGCCTCCTCATGCTTCCTTAGG + Intronic
998252503 5:140562357-140562379 CAGCCTCCAGATGGTGCCTGGGG - Exonic
999245213 5:150150588-150150610 CATCCACCAGATGCTTCCTGGGG - Intronic
1000381001 5:160629240-160629262 CAGCCACCTGGGGCTGCCACAGG + Intronic
1001373297 5:171229274-171229296 AAGCCACCTGATCCTGATTTTGG - Intronic
1001969535 5:175943515-175943537 TCCCCACTTGATGCTGCCTTGGG - Intronic
1002247900 5:177900238-177900260 TCCCCACTTGATGCTGCCTTGGG + Intergenic
1002641244 5:180631614-180631636 CAGCCACCACCTCCTGCCTTGGG + Intronic
1004378839 6:15114866-15114888 CAGCACCCTGATGTTCCCTTGGG - Intergenic
1005363337 6:25053421-25053443 CAGGCGCCAGATGCTGCCTCGGG - Intergenic
1008717151 6:54302752-54302774 CAGCCTCCTGATTTTACCTTGGG - Intergenic
1010974071 6:82293338-82293360 AATCCACCAGATGCTGACTTTGG + Intergenic
1011396199 6:86911444-86911466 CAGACACCAGAGTCTGCCTTAGG + Intergenic
1014647688 6:123994641-123994663 AAGCCACCTGGAGCTGACTTGGG - Intronic
1015519202 6:134114520-134114542 CAGCCACCTGAGGCCGCCTGGGG - Intergenic
1018306253 6:162459194-162459216 CAGTAATATGATGCTGCCTTTGG - Intronic
1018988740 6:168657562-168657584 CTGCCACCCGATACTGCTTTTGG + Intronic
1019051148 6:169185022-169185044 TAGCAACCTCATGATGCCTTAGG + Intergenic
1019623716 7:2004705-2004727 CAGAAACCTGATGAAGCCTTCGG - Intronic
1020391415 7:7662177-7662199 CAGCAACCTGAAGCTGACCTGGG - Intronic
1020744383 7:12063770-12063792 CCAACACCTGATGCAGCCTTTGG + Intergenic
1021589054 7:22241090-22241112 CAGCTACTTGATGCTGCCATGGG + Intronic
1023765722 7:43508806-43508828 CAGCAAATTGATGCTGCCATTGG + Intronic
1025849371 7:65233486-65233508 CATCCCCCAGATGCTGCCATGGG + Intergenic
1026369566 7:69685144-69685166 TAGCCACATGGAGCTGCCTTAGG - Intronic
1028501288 7:91521286-91521308 CACCCACTAGATGCTGCCATGGG + Intergenic
1029110942 7:98212768-98212790 CAGCCACCTGCTGCTGCTGCTGG - Exonic
1029592952 7:101519448-101519470 CAGCCTCCTAATGCTCACTTTGG - Intronic
1033579069 7:142715371-142715393 CACCTGCCTGATGCTGCCATGGG + Intergenic
1039769029 8:40664202-40664224 CTTCCTCCAGATGCTGCCTTGGG + Intronic
1040487169 8:47884361-47884383 CAGCGAGGTGATGCAGCCTTCGG - Intronic
1040834502 8:51718212-51718234 CAGACCCCTGAGGCTGCCTGTGG - Intronic
1041375140 8:57204801-57204823 CAGTCCCCTGATGCTTCCCTTGG + Intergenic
1041472499 8:58226022-58226044 CAGCCGCCTGACAGTGCCTTGGG - Intergenic
1045632394 8:104140703-104140725 CAGCCCCCACTTGCTGCCTTGGG + Intronic
1056186717 9:84142199-84142221 CAGCACCTTGATGCTGCCGTGGG + Intergenic
1057656457 9:96957039-96957061 GAGCCACCGCATGCAGCCTTGGG + Intronic
1058869671 9:109191092-109191114 CAGCCATCTGCTTCTCCCTTTGG - Intronic
1058936650 9:109775668-109775690 CAGCAACCTGAAGCTTCCCTTGG - Intronic
1059152488 9:111962014-111962036 GAGCCACATAATTCTGCCTTAGG + Intergenic
1059503749 9:114779136-114779158 TAGTCCCATGATGCTGCCTTAGG - Intergenic
1059716108 9:116914960-116914982 CAACCTCCAGATGCTGCCTTAGG + Intronic
1060345297 9:122810718-122810740 CAGCCTACTCATGTTGCCTTGGG + Intronic
1060406830 9:123376981-123377003 CAGCCACCTCCTGCTGGCTTGGG - Exonic
1060412476 9:123408950-123408972 GAGCTACCTGCTGCTGACTTTGG + Intronic
1062119863 9:134828343-134828365 CAGCCAGCTCACGCTGCCATGGG - Intronic
1188147654 X:26633377-26633399 GAGCCCTCTGATGATGCCTTGGG + Intergenic
1193344530 X:80389304-80389326 CTGCCACCTTGTTCTGCCTTGGG + Intronic
1193710033 X:84868709-84868731 CCGCCCCCAGATGCTGCCATGGG - Intergenic
1195014883 X:100768714-100768736 CAGCCACCTATTGCAGTCTTTGG + Intergenic