ID: 950679638

View in Genome Browser
Species Human (GRCh38)
Location 3:14576005-14576027
Sequence TGGCCAGTGCTGGAAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950679630_950679638 22 Left 950679630 3:14575960-14575982 CCTAAGGTGATGATTTATTAATC No data
Right 950679638 3:14576005-14576027 TGGCCAGTGCTGGAAATGGGAGG No data
950679632_950679638 -2 Left 950679632 3:14575984-14576006 CCTGCTAAGTGCAGGCAGCCATG No data
Right 950679638 3:14576005-14576027 TGGCCAGTGCTGGAAATGGGAGG No data
950679629_950679638 25 Left 950679629 3:14575957-14575979 CCACCTAAGGTGATGATTTATTA No data
Right 950679638 3:14576005-14576027 TGGCCAGTGCTGGAAATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950679638 Original CRISPR TGGCCAGTGCTGGAAATGGG AGG Intergenic
No off target data available for this crispr