ID: 950680223

View in Genome Browser
Species Human (GRCh38)
Location 3:14580109-14580131
Sequence GGTCCCTGTGGGGCAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950680212_950680223 30 Left 950680212 3:14580056-14580078 CCGCATGCCAGGGCACTCAGAGA No data
Right 950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG No data
950680216_950680223 -3 Left 950680216 3:14580089-14580111 CCAACACAGGACTTCATGTTGGT No data
Right 950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG No data
950680213_950680223 23 Left 950680213 3:14580063-14580085 CCAGGGCACTCAGAGAACTACTG No data
Right 950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950680223 Original CRISPR GGTCCCTGTGGGGCAGGGGC TGG Intergenic
No off target data available for this crispr