ID: 950681072

View in Genome Browser
Species Human (GRCh38)
Location 3:14585488-14585510
Sequence CCCATTAGGCCCCCACTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950681066_950681072 17 Left 950681066 3:14585448-14585470 CCCATTTCACACGTAAAGGGCAG No data
Right 950681072 3:14585488-14585510 CCCATTAGGCCCCCACTTCTGGG No data
950681067_950681072 16 Left 950681067 3:14585449-14585471 CCATTTCACACGTAAAGGGCAGT No data
Right 950681072 3:14585488-14585510 CCCATTAGGCCCCCACTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950681072 Original CRISPR CCCATTAGGCCCCCACTTCT GGG Intergenic
No off target data available for this crispr