ID: 950687281

View in Genome Browser
Species Human (GRCh38)
Location 3:14627616-14627638
Sequence GGAGGTTAGCACTTCATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950687281_950687288 19 Left 950687281 3:14627616-14627638 CCTTTCATGAAGTGCTAACCTCC No data
Right 950687288 3:14627658-14627680 ACTTGTACAGACCTTACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950687281 Original CRISPR GGAGGTTAGCACTTCATGAA AGG (reversed) Intergenic
No off target data available for this crispr