ID: 950690721

View in Genome Browser
Species Human (GRCh38)
Location 3:14654513-14654535
Sequence TTTACCTTGTTAGTTGTTTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 517}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950690721_950690723 15 Left 950690721 3:14654513-14654535 CCAAAAACAACTAACAAGGTAAA 0: 1
1: 0
2: 2
3: 57
4: 517
Right 950690723 3:14654551-14654573 ATCTCCATTGGTTCCAAACATGG 0: 1
1: 0
2: 0
3: 12
4: 117
950690721_950690724 16 Left 950690721 3:14654513-14654535 CCAAAAACAACTAACAAGGTAAA 0: 1
1: 0
2: 2
3: 57
4: 517
Right 950690724 3:14654552-14654574 TCTCCATTGGTTCCAAACATGGG 0: 1
1: 0
2: 2
3: 12
4: 135
950690721_950690722 3 Left 950690721 3:14654513-14654535 CCAAAAACAACTAACAAGGTAAA 0: 1
1: 0
2: 2
3: 57
4: 517
Right 950690722 3:14654539-14654561 TAAGATCTAATTATCTCCATTGG 0: 1
1: 0
2: 1
3: 10
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950690721 Original CRISPR TTTACCTTGTTAGTTGTTTT TGG (reversed) Exonic
902332480 1:15737239-15737261 TTTAATTTTTTATTTGTTTTGGG - Intronic
903510722 1:23873160-23873182 TTTCTCTTGTTGGCTGTTTTAGG + Exonic
903966732 1:27095312-27095334 TTCACCGTGTTAGCTGTGTTAGG - Intergenic
905964193 1:42077029-42077051 TTAATCTTGTTACTTGTTATCGG + Intergenic
907306532 1:53516286-53516308 TTTACCTTCTCAGTTGGTTGGGG + Intronic
908718710 1:67099203-67099225 TTTAACTTTTTGGTAGTTTTAGG - Intronic
909150189 1:71992851-71992873 TTTACTTTGGTCATTGTTTTTGG - Intronic
909616104 1:77610290-77610312 TTGATCTTGTTACTTGTTATTGG - Intronic
909920229 1:81372547-81372569 TTTACCTCATCAGATGTTTTTGG + Intronic
909932762 1:81517150-81517172 TGAACCTTGTTAGTGGTTATTGG + Intronic
910041947 1:82863048-82863070 ATTGCCTTTTTTGTTGTTTTAGG - Intergenic
911665986 1:100552552-100552574 TCTATCTTGTTACTTGTTATTGG + Intergenic
911740470 1:101381519-101381541 TTTAGGTTGTTTCTTGTTTTGGG + Intergenic
911961255 1:104305677-104305699 TTGATCTTGTTAGTTGTTATTGG - Intergenic
911991933 1:104709476-104709498 TTTATCTTGTTACTTTGTTTGGG + Intergenic
913707272 1:121438503-121438525 TTGACCTTGTTATTTGTTATTGG - Intergenic
914046516 1:144097968-144097990 TTTGCTTTGTTTTTTGTTTTTGG - Intergenic
914131594 1:144862718-144862740 TTTGCTTTGTTTTTTGTTTTTGG + Intergenic
914973829 1:152338644-152338666 TTTACTTTGTCATTTGTTTTAGG - Intergenic
915804534 1:158830441-158830463 TTTCCCCTATTAGCTGTTTTGGG + Intergenic
915844172 1:159246470-159246492 TTTAATTTGTTAGTTTATTTGGG + Intergenic
916092839 1:161321907-161321929 TTTACCTTCTTAAATGCTTTTGG + Intronic
917113438 1:171576661-171576683 GTTTCTTGGTTAGTTGTTTTTGG + Intronic
917246004 1:173001362-173001384 TTGATCTTGTTACTTGTTATTGG + Intergenic
917277523 1:173346603-173346625 TCTCCCTTGGTAGCTGTTTTTGG - Intergenic
917353011 1:174097553-174097575 TTTACCTTTTTATGGGTTTTAGG + Intergenic
917696641 1:177532510-177532532 TTTATCCTCTTAGATGTTTTAGG - Intergenic
917771490 1:178284438-178284460 TTGACCTTGTTACATGTTTCAGG - Intronic
917816713 1:178717813-178717835 TTTCCATTGTTTGTTGTTGTTGG - Intergenic
918576885 1:186072079-186072101 TTTACACTGCTAGGTGTTTTAGG + Intronic
918634241 1:186755794-186755816 ATTACCTTATCAGTTGTCTTGGG - Intergenic
919492074 1:198216957-198216979 TTTTTCTTGGCAGTTGTTTTTGG - Intronic
920549968 1:206851357-206851379 TTAATCTTGTTACTTGTTATTGG - Intergenic
920999589 1:211029629-211029651 TTTGCCTTGTTCCTTGTTGTAGG - Intronic
921225959 1:213019277-213019299 TTTACCTTTTTTTTTTTTTTTGG + Intergenic
921873623 1:220169297-220169319 CTTACATTTTTAGTTGTCTTTGG - Intronic
921942626 1:220858471-220858493 TTGATCTTGTTACTTGTTATTGG + Intergenic
923183106 1:231542155-231542177 TTTTTCTTTTTAGTTGTTTAAGG + Intronic
923579798 1:235198380-235198402 TTTTCCTTGTTTGATGTGTTTGG - Intronic
923867772 1:237958666-237958688 TCTTTCTTTTTAGTTGTTTTTGG - Intergenic
924695974 1:246400062-246400084 TTTACCTTTTTTTTTCTTTTGGG - Intronic
1063449881 10:6144413-6144435 TTTTTTTTGTTTGTTGTTTTGGG - Intergenic
1063555325 10:7073891-7073913 TTTACCTTGCTTTTTTTTTTTGG - Intergenic
1063754352 10:8989670-8989692 TTTACCTGGTTTGTTGTTATGGG - Intergenic
1064168699 10:13009457-13009479 TTTATTTTCTAAGTTGTTTTTGG - Intronic
1064406678 10:15070340-15070362 TGTACCTTGTTTGATCTTTTTGG + Intronic
1065511928 10:26488157-26488179 AATACCATATTAGTTGTTTTGGG + Intronic
1065906961 10:30263797-30263819 TTTGTCTTGTTACTTGTTATTGG - Intergenic
1066295662 10:34052038-34052060 TTTTGCTTGTTCTTTGTTTTTGG - Intergenic
1067266179 10:44747527-44747549 TGTCCCTTGTTGGTTGCTTTTGG - Intergenic
1067336403 10:45368906-45368928 TTGATCTTGTTACTTGTTTTTGG - Intergenic
1068058911 10:52041639-52041661 TTAATCTTGTTAGTAGTTATTGG + Intronic
1068243999 10:54341211-54341233 TTGACATTGTAATTTGTTTTGGG - Intronic
1068250367 10:54431084-54431106 TTAATCTTGTTACTTGTTATTGG - Intronic
1068744761 10:60517537-60517559 TTTATTTCGTTAGCTGTTTTGGG - Intronic
1069046352 10:63747608-63747630 TTTACCTTTTTAAATGTTTGGGG - Intergenic
1069148081 10:64920768-64920790 TCGACCTTGTTACTTGTTATTGG - Intergenic
1069221078 10:65884563-65884585 TTTATTTTGTTAATTGTTGTGGG + Intergenic
1070464690 10:76709267-76709289 TTGATCTTGTTACTTGTTATTGG - Intergenic
1071696721 10:87882973-87882995 TTTACTTTATAAGTTGTTTAAGG + Intronic
1071947452 10:90661796-90661818 TTGATCTTGTTACTTGTTATTGG - Intergenic
1072863068 10:99027435-99027457 TTGATCTTGTTATTTGTTGTTGG - Intronic
1073872869 10:107886224-107886246 TTTTCCTATTGAGTTGTTTTGGG - Intergenic
1073963525 10:108961602-108961624 TCTACTTAGTTAATTGTTTTGGG - Intergenic
1074295586 10:112184574-112184596 TTTTTGTTTTTAGTTGTTTTAGG - Intronic
1074677812 10:115871949-115871971 TTTCTCTTGCTACTTGTTTTGGG + Intronic
1076094925 10:127724747-127724769 TTGATCTTGTTACTTGTTATTGG - Intergenic
1076352728 10:129829430-129829452 CATACCTTGTAAGTTATTTTTGG + Intergenic
1076940986 10:133608376-133608398 TTTAACTTACTAGTTGTTTTTGG - Intergenic
1077058187 11:606110-606132 TTTACCTGTTTTGTTGGTTTTGG - Intronic
1077814195 11:5669382-5669404 TTTACATTCTTAATGGTTTTAGG + Intronic
1078304596 11:10171811-10171833 TTGATCTTGTTACTTGTTATTGG + Intronic
1078827729 11:14946641-14946663 TTTAAATTTTTAGTTGTTTTTGG - Intronic
1078856847 11:15212889-15212911 TTTACCTTGTTACTGATTTCAGG + Intronic
1079684546 11:23341516-23341538 TTTCCCTTGTTAGGTGATTTTGG + Intergenic
1079707984 11:23645885-23645907 TTTATTTTGTTGGTTCTTTTGGG - Intergenic
1079754107 11:24234615-24234637 TTGTCCTTGTTAGGTCTTTTGGG + Intergenic
1080843958 11:36009933-36009955 TTTATCTTGCTTGTTGTCTTTGG + Intronic
1080921697 11:36715468-36715490 TTTACTTTCTTGGTTGTTTTGGG + Intergenic
1080933305 11:36836836-36836858 TTTTCTTTGTTAGGTGTTCTGGG + Intergenic
1082720703 11:56671915-56671937 TATACCTAGTTAGGTGTTTTAGG - Intergenic
1084987272 11:72886510-72886532 TTTACCATCTTAGTGATTTTTGG + Intronic
1084998054 11:73002815-73002837 TATTCTTTGTTAGTTGTTCTTGG + Intronic
1085680164 11:78565922-78565944 TTTACCTTGTTGGGTGTTGTGGG - Intronic
1085864618 11:80275535-80275557 TTTACTTTGTTGGAAGTTTTTGG - Intergenic
1085931171 11:81085691-81085713 TTTTCTTTGTTAGGTGTTTTGGG + Intergenic
1086523295 11:87696981-87697003 TTTATTTTGTTAGGTGCTTTAGG + Intergenic
1086774124 11:90808615-90808637 TTTTCTTTTTTTGTTGTTTTTGG + Intergenic
1087358860 11:97131734-97131756 TTGATCTTGTTACTTGTTATTGG + Intergenic
1088471182 11:110188626-110188648 GTTAGCCTGTTAGTTGTGTTTGG - Intronic
1089985874 11:122813163-122813185 ATTTCCTTGTTAGTGGTATTTGG + Exonic
1090145251 11:124314404-124314426 TTTACCTCTTTAAATGTTTTGGG + Intergenic
1090781885 11:130014354-130014376 TTTTTTTTCTTAGTTGTTTTAGG - Intergenic
1091418801 12:316412-316434 TTTACCTTGATATTTGAGTTTGG - Intronic
1092158674 12:6302738-6302760 ATTAGCCTGTTAGTAGTTTTGGG - Intergenic
1093252434 12:16823791-16823813 TTTCCCTTGTGATTTGTTGTTGG + Intergenic
1093618920 12:21264114-21264136 TTTACATAGATAATTGTTTTTGG + Intergenic
1093726319 12:22514278-22514300 TTTACATTTTTAGCTGTTCTTGG + Intronic
1094529770 12:31263159-31263181 TTGACCATGTTAGTTGTTAAAGG + Intergenic
1095498811 12:42814299-42814321 TTTCCTTTGGTAATTGTTTTTGG + Intergenic
1096048718 12:48587008-48587030 TTTATTTTGTTAGGTGTTTTGGG - Intergenic
1097512311 12:60558970-60558992 GTTACTGTGTTAGTTTTTTTAGG + Intergenic
1097758988 12:63438585-63438607 TTTATCTTGTTATATTTTTTAGG - Intergenic
1099084974 12:78234761-78234783 TTTAACATGTTATCTGTTTTAGG + Intergenic
1099736858 12:86578534-86578556 TTGACCTTGTTACTTGTTATTGG + Intronic
1100227605 12:92574602-92574624 TTTACCTTGTAAGTCTTTTTGGG - Intergenic
1100407214 12:94282115-94282137 TTTACTTTGTTTGTTTGTTTAGG - Intronic
1100460406 12:94793807-94793829 TTATGCTTGTTTGTTGTTTTGGG - Intergenic
1100804800 12:98271588-98271610 TTGACTTTGTAAATTGTTTTGGG - Intergenic
1101025843 12:100605254-100605276 TTGATCTTGTTACTTGTTATTGG + Intronic
1101075911 12:101129736-101129758 TTTATCTTAATAGTTTTTTTGGG - Intergenic
1101309799 12:103565842-103565864 TTTACCTGGTTTATTGGTTTTGG - Intergenic
1104558146 12:129820751-129820773 TTTATTTTATTATTTGTTTTTGG + Intronic
1104611319 12:130230465-130230487 TTCTCATTGTTAGTTGTTTGGGG - Intergenic
1106740329 13:32634441-32634463 TTTGGATTGTTTGTTGTTTTTGG + Intronic
1107045594 13:35988903-35988925 GATACCCTGTGAGTTGTTTTGGG - Intronic
1107091293 13:36483439-36483461 TCAACCTTGTTACTTGTTATTGG + Intergenic
1107500286 13:40966823-40966845 TTTAACTTGCTTTTTGTTTTGGG - Intronic
1107523746 13:41209449-41209471 TTGATCTTGTTACTTGTTATTGG + Intergenic
1107529520 13:41269177-41269199 TTTACCTTGTTTTTTTTTTTTGG + Intergenic
1108423016 13:50270033-50270055 TTTACTGTCTTAGTTCTTTTGGG + Intronic
1108443716 13:50484551-50484573 CTTGCCTTTTTAGTTGTTGTGGG + Intronic
1109590474 13:64474313-64474335 TGTTCCTTGTTATTTGTGTTAGG - Intergenic
1109910278 13:68901862-68901884 TTTACATTTTTAGTTATTATGGG + Intergenic
1110714594 13:78686810-78686832 CTTACCTTGTTTTTTTTTTTTGG + Intergenic
1111267637 13:85838573-85838595 TTTACCTTCTTTTTTTTTTTTGG - Intergenic
1111427664 13:88109402-88109424 TTTTCCTTGTTAGTTCTAATAGG + Intergenic
1114396069 14:22362933-22362955 TTTCCTTTGTTAGGTGTTCTGGG + Intergenic
1114686101 14:24533300-24533322 TTTGTCTTTTTTGTTGTTTTGGG + Intergenic
1114984861 14:28213714-28213736 TTCATCTTGTTACTTGTTATTGG + Intergenic
1115116830 14:29890479-29890501 TTTATCTAGTTATTTATTTTTGG - Intronic
1115276072 14:31610391-31610413 TTGATCTTGTTACTTGTTGTTGG - Intronic
1115311602 14:31984432-31984454 TTAACTTTGTTAGATGTTCTGGG + Intergenic
1115943292 14:38632333-38632355 TATATCCTGTTGGTTGTTTTGGG - Intergenic
1116080072 14:40161011-40161033 GTTATCTTGTTATTTGTTATTGG - Intergenic
1116269468 14:42742595-42742617 TTGATCTTGTTACTTGTTATTGG - Intergenic
1116422284 14:44746157-44746179 TTGATCTTGTTACTTGTTATTGG - Intergenic
1116799769 14:49430193-49430215 TTTATCTTGTTTGATGTTCTTGG - Intergenic
1117425316 14:55589088-55589110 TTTACCTTGTCTGAGGTTTTGGG + Intronic
1118855185 14:69615506-69615528 CTTCCCTTTTTAGTTTTTTTTGG + Intronic
1120080184 14:80207392-80207414 CTAACCTTGTTTCTTGTTTTGGG + Intronic
1120100528 14:80439682-80439704 TTTTCCTTGTTTGTTTGTTTAGG + Intergenic
1120147934 14:81000245-81000267 TTTACAATGTCAGTTGTCTTAGG - Intronic
1120480638 14:85045250-85045272 TTTCCCTTGTAAGTTCTTCTAGG + Intergenic
1120561196 14:85995082-85995104 TTTACCTTATTAATGGCTTTAGG + Intergenic
1120740856 14:88107043-88107065 TATACGTTGTTTATTGTTTTTGG - Intergenic
1120809103 14:88784611-88784633 TTGATCTTGTTATTTGTTATTGG - Intronic
1121130744 14:91444431-91444453 TTGATCTTGTTACTTGTTATTGG - Intergenic
1121757986 14:96419259-96419281 TTTAACATGTTATTTATTTTGGG + Intronic
1122277471 14:100602127-100602149 TTTACTTTGTTAGGTGTTGGAGG + Intergenic
1124195924 15:27629439-27629461 TTTCCCTTGTGAATTCTTTTTGG - Intergenic
1124643029 15:31409594-31409616 TTTTCTTTGTTTTTTGTTTTTGG - Intronic
1124809263 15:32918232-32918254 TTTTCCTTGTTAGTCAGTTTTGG - Intronic
1125171017 15:36766774-36766796 TTTTTCTTGTTATTTGATTTTGG + Intronic
1125458757 15:39888233-39888255 TTTCTCTTGTTGGTTTTTTTGGG + Intronic
1125923422 15:43540924-43540946 TTTAGCTTGTTAATGGTGTTTGG - Intronic
1126258274 15:46654171-46654193 TTTACCTTTTTTTTTTTTTTTGG - Intergenic
1128960243 15:71995332-71995354 ATTACATTGGTAGTTGTCTTCGG + Intronic
1129584075 15:76844689-76844711 TTGATCTTGTTACTTGTTATTGG - Intronic
1130213895 15:81950842-81950864 TTTTCCTTCCTAGTTTTTTTTGG + Intergenic
1130812926 15:87401237-87401259 TTTATCTTTATAATTGTTTTTGG - Intergenic
1131089090 15:89606298-89606320 TTTCCATTCTTAGATGTTTTTGG + Intronic
1131732761 15:95299468-95299490 TTTACCACTTTAGTTGTTTGAGG + Intergenic
1131746466 15:95453856-95453878 CTTACCTTGTGACTTGTTTTTGG - Intergenic
1134337036 16:13309806-13309828 TTTTGTTTGTTTGTTGTTTTAGG - Intergenic
1134435397 16:14252006-14252028 GTTACCTTGTTGGGTGTGTTAGG - Exonic
1134609610 16:15597976-15597998 TTTACCATCTTGGTTGTTCTTGG - Intronic
1134843703 16:17422506-17422528 TTTACTTTATTATTTTTTTTTGG + Intronic
1135812178 16:25598097-25598119 GTTTGCTTGTTTGTTGTTTTTGG + Intergenic
1137646152 16:50076526-50076548 TTTACCGTCTTAATCGTTTTGGG + Intronic
1139821290 16:69723474-69723496 TTTTTCTTTTGAGTTGTTTTGGG - Intronic
1140583269 16:76255720-76255742 TTGCCCTTGGTAGTTGTATTAGG - Intergenic
1141456874 16:84148409-84148431 TTTACGTTGTTAACAGTTTTTGG + Intronic
1142972695 17:3623504-3623526 TATACCGTGTTGGTTGTTTTTGG - Intronic
1143245589 17:5482718-5482740 TTCATCCTGTTACTTGTTTTTGG - Intronic
1143752571 17:9039899-9039921 TTTAGCTTGTTTCTAGTTTTTGG + Intronic
1144574595 17:16421133-16421155 TTTAGGTTGTTCGTAGTTTTTGG + Intronic
1149078814 17:52629862-52629884 TTTGCTTTGTTAGCTGTTCTGGG - Intergenic
1149669983 17:58398964-58398986 TTTTCCTTTTTATTGGTTTTGGG - Intronic
1149843598 17:59988322-59988344 TTTACCTTTTTTTTTTTTTTTGG + Intergenic
1150028619 17:61706943-61706965 TTTTCCTTCCTGGTTGTTTTAGG + Intronic
1150871263 17:68913708-68913730 TTAATCTTGTTGGTTGTTATTGG - Intronic
1152970562 18:157735-157757 ATTACTATTTTAGTTGTTTTGGG - Intergenic
1152977860 18:241147-241169 TTTATCTCATTAGTTGTTCTCGG - Intronic
1153031352 18:716098-716120 TTTAGGTTGTTACTAGTTTTAGG - Intergenic
1155372674 18:25119585-25119607 TTTCCCTTGTGATTTCTTTTTGG - Intronic
1155690759 18:28619855-28619877 TTTAGCTTTTTACTTGTTTTGGG - Intergenic
1156243356 18:35274198-35274220 TTTTGCTTGTTTTTTGTTTTGGG + Intronic
1156263351 18:35464865-35464887 TATTCTTTGTTAGATGTTTTAGG + Intronic
1156819526 18:41355863-41355885 TTTACCTTGTAAATTCTTTGAGG + Intergenic
1156831495 18:41497469-41497491 TTAACTTTTTTAGATGTTTTAGG + Intergenic
1157524447 18:48369755-48369777 TTTCTCTTTTTAGTTCTTTTGGG - Intronic
1157585354 18:48797560-48797582 TTTACCTTGTGAGTTGACTGGGG + Intronic
1159755956 18:72366058-72366080 TTTAGCTTGCTGGTTGTTCTGGG + Intergenic
1159789090 18:72754162-72754184 TTTACTTTCTTAGTTGCTTTAGG - Intronic
1160109733 18:76015044-76015066 TTTTCCATGTTATTTGTTTTAGG + Intergenic
1160260062 18:77284817-77284839 TTTACCTTTTGATTTCTTTTGGG - Intergenic
1160429452 18:78801441-78801463 TTAAATTTGTTGGTTGTTTTGGG - Intergenic
1168227280 19:55004829-55004851 GTTACCATGGAAGTTGTTTTGGG - Intergenic
1168304473 19:55428009-55428031 TTTACCTTTTTTGTTTTTTGAGG + Intergenic
1202686070 1_KI270712v1_random:51383-51405 TTTGCTTTGTTTTTTGTTTTTGG - Intergenic
926033458 2:9613793-9613815 TTTACGTGGTTAATTGTTTGGGG - Intronic
927002157 2:18808480-18808502 TTTGCCTTGTTCTTTATTTTAGG - Intergenic
927205473 2:20606968-20606990 TTTATCTTTTTATTTTTTTTTGG + Intronic
927677861 2:25120012-25120034 CTAACCTTTTTAGTTGTTTGGGG + Intronic
928459749 2:31459832-31459854 TCTATCTTGTTACTTGTTATTGG - Intergenic
928484451 2:31716074-31716096 TTGATCTTGTTACTTGTTATTGG - Intergenic
928494951 2:31822166-31822188 TTAATCTTGTTACTTGTTATTGG + Intergenic
928955520 2:36863027-36863049 TTTAGCTTGTTAATTTGTTTAGG + Intronic
928961476 2:36930671-36930693 TTTGCTTTGTTTTTTGTTTTTGG - Intronic
929392422 2:41485533-41485555 TTTAACTTGCAAGTTGTTTTGGG + Intergenic
930428118 2:51237195-51237217 TTTGCCTTTCTAGTAGTTTTTGG + Intergenic
931145757 2:59515649-59515671 TTTGCCTTGTTCTTTGTTTTTGG - Intergenic
931406451 2:61983511-61983533 TTCATCTTGTTACTTGTTATTGG + Intronic
931562539 2:63578295-63578317 TTTACTTTTTGAGTTATTTTCGG - Intronic
931600448 2:63997366-63997388 TTTATCTTATTACTTGTTATTGG + Intronic
932339645 2:70954615-70954637 TTTTGTTTGTTTGTTGTTTTGGG + Intronic
932648184 2:73527437-73527459 TTTACCTTGTTGCTTGTTATTGG + Intronic
933317321 2:80731264-80731286 TTAATCTTGTTACTTGTTATTGG - Intergenic
934245651 2:90303433-90303455 TTTGCTTTGTTTTTTGTTTTTGG + Intergenic
934263095 2:91493603-91493625 TTTGCTTTGTTTTTTGTTTTTGG - Intergenic
934792599 2:97074623-97074645 TTTTCCTTGTAAATTGGTTTAGG + Intergenic
934814020 2:97309059-97309081 TTTTCCTTGTAAATTGGTTTAGG - Intergenic
934823675 2:97399423-97399445 TTTTCCTTGTAAATTGGTTTAGG + Intergenic
935018480 2:99206937-99206959 TTGATCTTGTTACTTGTTATTGG + Intronic
935221760 2:101021333-101021355 ATTACCTTAATAGTTATTTTAGG - Intronic
936349131 2:111699607-111699629 TTTAGATTGTTATGTGTTTTGGG - Intergenic
936740372 2:115498764-115498786 TTTACCTCGTTAGTAATTTCAGG + Intronic
937448562 2:121980031-121980053 TTTACCTTGTTGCCAGTTTTAGG + Intergenic
937616493 2:123929028-123929050 TTTATCTTTTTAGTTTTTTGTGG + Intergenic
937805710 2:126141511-126141533 TTAATCTTGTTACTTGTTATTGG + Intergenic
939570669 2:143836720-143836742 TTTTCTTTGTTATTTGATTTTGG - Intergenic
940065286 2:149620740-149620762 TTACCCTTGTTAGTTCTTTACGG - Intergenic
940206495 2:151208142-151208164 TTGACCTTTTTGATTGTTTTAGG - Intergenic
940710402 2:157155669-157155691 TTTCCCATGATTGTTGTTTTAGG - Intergenic
940716373 2:157229608-157229630 TCAATCTTGTTACTTGTTTTTGG + Intergenic
941211026 2:162639652-162639674 TTTACCTTGTTCCTAGTCTTAGG - Intronic
941293522 2:163706344-163706366 TTTACCTTTTTGGATGTCTTGGG - Intronic
941390801 2:164912288-164912310 TTTCTCTTATTATTTGTTTTTGG + Intronic
941662053 2:168204942-168204964 TTTGCCTTCTTAATTGTTTTTGG - Intronic
941672183 2:168306294-168306316 TTGATCTTGTTACTTGTTATTGG + Intergenic
942231548 2:173865301-173865323 TTTACCATTTTATTTGTTTTGGG - Intergenic
942379615 2:175375050-175375072 TTTACCTTCTTTTTGGTTTTTGG + Intergenic
942971160 2:181959840-181959862 TTTAGCTTTTTAAGTGTTTTAGG + Intronic
943035032 2:182733086-182733108 TTAATCATGTTATTTGTTTTTGG + Intronic
943627253 2:190214772-190214794 TCTACCTTGTGAGATGTTTGGGG - Intronic
944150299 2:196551093-196551115 TTTAACTTCTTAGTTGCCTTTGG - Intronic
945801912 2:214443553-214443575 TTTGCCTTGTTAGTCATTTGAGG + Intronic
945919257 2:215738676-215738698 TTTAAGTTATTAGTTGCTTTGGG - Intergenic
945977856 2:216284463-216284485 TTTTGTTTGTTTGTTGTTTTTGG + Intronic
946312112 2:218888057-218888079 TTTTGTTTGTTGGTTGTTTTTGG + Intronic
947554024 2:231073198-231073220 GTTACCATTGTAGTTGTTTTGGG - Intronic
947555421 2:231088571-231088593 GTTACCATCGTAGTTGTTTTGGG + Intronic
948398544 2:237665576-237665598 TTTATTTTTGTAGTTGTTTTTGG - Intronic
1169544470 20:6636619-6636641 AATACCTTCTTAGATGTTTTGGG - Intergenic
1170682814 20:18541692-18541714 GTTACCATTTTAATTGTTTTGGG - Intronic
1171071302 20:22070915-22070937 TTTCCCGTGTTTGTTGATTTTGG + Intergenic
1171324838 20:24282316-24282338 TTTTCCTTGTTTGTTATTTTGGG - Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1173938971 20:46894298-46894320 TTTACTTGGTTATTTGTTTATGG + Intergenic
1176525614 21:7865532-7865554 TTTATCTTGCTACTTGTTATTGG + Intergenic
1177284407 21:19030272-19030294 TTTTCCATGTCAGATGTTTTAGG + Intergenic
1177330381 21:19652527-19652549 TTTACCTTGTACTTTGTTCTGGG + Intergenic
1177335592 21:19721880-19721902 TTTACTCTGCTATTTGTTTTGGG + Intergenic
1177971389 21:27794365-27794387 CTTACCTTGTGAGATGTTTTTGG - Intergenic
1178659634 21:34495545-34495567 TTTATCTTGCTACTTGTTATTGG + Intergenic
1178678456 21:34651326-34651348 TTATCCTTGTAAGTGGTTTTAGG - Intergenic
1178832157 21:36064972-36064994 TATACATTGTGAGTTGTTTTTGG + Intronic
1181917659 22:26293315-26293337 TTTCATTTGTTTGTTGTTTTGGG + Intronic
1183128575 22:35810004-35810026 TTTCTCTTGTTGTTTGTTTTAGG - Exonic
950690721 3:14654513-14654535 TTTACCTTGTTAGTTGTTTTTGG - Exonic
951088290 3:18540618-18540640 TTTACATTTTTTTTTGTTTTGGG + Intergenic
951171801 3:19550756-19550778 TTGATCTTGTTACTTGTTATTGG + Intergenic
951279347 3:20728830-20728852 TTGATCTTGTTACTTGTTATTGG + Intergenic
951930528 3:27961975-27961997 TTTACGTTGTTAGTTTTTAAGGG + Intergenic
951973105 3:28471079-28471101 TTTATCTTGTTACTTGTTATTGG - Intronic
952202398 3:31144349-31144371 TTTATCTTGTTACTTGCTATTGG + Intergenic
952474203 3:33689321-33689343 TTTACATTTTAGGTTGTTTTTGG - Intronic
953051479 3:39348286-39348308 TATACCTTGTTATTTTTTGTTGG - Intergenic
953184748 3:40627591-40627613 CTTACTTTGCTACTTGTTTTTGG + Intergenic
953294589 3:41701461-41701483 TTCAGTTTGGTAGTTGTTTTTGG - Intronic
953817454 3:46171075-46171097 CTTCCCATGTTACTTGTTTTAGG + Intronic
953864017 3:46568018-46568040 TTGATCTTGTTACTTGTTATTGG - Intronic
954470475 3:50690130-50690152 TTTACCTTTTTTTTTTTTTTTGG + Intronic
954494297 3:50939287-50939309 TTTGCCTGGATAGTTCTTTTTGG - Intronic
955217214 3:56994246-56994268 TTTTGCTTGTTAGTTGTTTTGGG - Intronic
955999666 3:64715690-64715712 TTTTGTTTGTTTGTTGTTTTTGG + Intergenic
957205143 3:77187487-77187509 TTTATCTCTATAGTTGTTTTTGG + Intronic
957254972 3:77825333-77825355 TTTTTGTTGTTAGGTGTTTTAGG + Intergenic
957666724 3:83240908-83240930 TTTATGATGGTAGTTGTTTTTGG - Intergenic
958561268 3:95749921-95749943 TTTACTTTATTACTTCTTTTGGG + Intergenic
958874046 3:99595275-99595297 TTTACTTTGTTTCTTGTTTTCGG + Intergenic
959027985 3:101264057-101264079 TTAATCTTGTTATTTGTTGTTGG - Intronic
959272569 3:104231916-104231938 TCTACCTTCTTATTTGTTTTAGG - Intergenic
959391495 3:105780428-105780450 TTTATTTAGTTAGTTGTTTGGGG - Intronic
959818731 3:110706207-110706229 TTGAACTTGTTACTTGTTTTTGG + Intergenic
960025167 3:113000526-113000548 ATTACCTTGTTAGACTTTTTAGG - Intronic
960068353 3:113399729-113399751 TTTACCATGATTGTTGTTATGGG - Intronic
960218558 3:115074589-115074611 TTTAGATTTTTAGTTGTTTAAGG - Intronic
960258391 3:115535635-115535657 TTTACCATGATTTTTGTTTTAGG + Intergenic
960491088 3:118317334-118317356 TCAATCTTGTTAATTGTTTTTGG - Intergenic
960568006 3:119156100-119156122 TTTCCTTTGTTAGGTGTTCTGGG + Intronic
960691866 3:120354477-120354499 TTTTCCTTATTGATTGTTTTGGG + Intergenic
961225326 3:125239663-125239685 TTCACATTTTTAGTTGTCTTGGG - Intronic
961253937 3:125530580-125530602 TTTATCTTTTTATTTGTTTCAGG - Exonic
961610891 3:128137514-128137536 TTGATCTTGTTACTTGTTATTGG - Intronic
962012081 3:131401503-131401525 TTTACCTGGATAATTGCTTTAGG - Intergenic
962190201 3:133302355-133302377 TTTACATTTTTAAGTGTTTTTGG - Intronic
962468357 3:135681650-135681672 TTGATCTTGTTACTTGTTATTGG - Intergenic
962499693 3:135978282-135978304 TTTACCTTACTATTTGTATTTGG - Intronic
962584331 3:136826434-136826456 TTGATCTTGTTACTTGTTATTGG + Intronic
963170618 3:142247301-142247323 TTGATCTTGTTACTTGTTATTGG - Intergenic
963443911 3:145376873-145376895 TTTTGCTTGTTAGTTTGTTTAGG + Intergenic
963459390 3:145589064-145589086 TTTATCTTGTTATTTGTTATTGG - Intergenic
963553349 3:146753588-146753610 TTTTCCTAGACAGTTGTTTTAGG + Intergenic
965509688 3:169554811-169554833 TTCACCTTGTTTGTTGTTCCTGG - Intronic
965688647 3:171332293-171332315 TTTAACTTGTTTACTGTTTTTGG + Intronic
966593645 3:181707220-181707242 TATTTCTTGTTAATTGTTTTTGG + Intergenic
967791078 3:193549824-193549846 TTTTTCATGTTAGTTTTTTTTGG - Intronic
967894383 3:194384534-194384556 TTTTCCCAGTTAGTTGTCTTTGG - Intergenic
968253574 3:197245673-197245695 TTTACCTTCTGAGTTTTCTTTGG + Intronic
968777408 4:2551795-2551817 TTTGCCTTATTATTTGCTTTGGG + Intronic
969305472 4:6323941-6323963 TTTCATTTGTTTGTTGTTTTGGG - Intronic
970042816 4:11815542-11815564 ATTACCATGACAGTTGTTTTAGG + Intergenic
970121329 4:12756152-12756174 TGTACCTTGTTAGTCTTATTAGG + Intergenic
971139391 4:23907218-23907240 TCTTCCTTGTTTGTTTTTTTAGG - Intergenic
971168081 4:24204720-24204742 TGTACCATATTAGTTGTTTATGG + Intergenic
971659153 4:29389687-29389709 TTTATCTTCTTAGTTTTTATTGG - Intergenic
971985433 4:33816390-33816412 TTTACATTGTAACTTGCTTTAGG - Intergenic
972158406 4:36194025-36194047 TTTCCCTTGATTTTTGTTTTAGG + Intronic
972241576 4:37198924-37198946 TTTACCATGTTAGTTTGCTTAGG + Intergenic
972414281 4:38823695-38823717 TTTTCTTTGTTTTTTGTTTTAGG + Exonic
972900762 4:43680296-43680318 TTTTCATTGTTATTTGTCTTAGG - Intergenic
972962069 4:44465349-44465371 TTGATCTTGTTACTTGTTATTGG - Intergenic
974004474 4:56542449-56542471 TTTACCTTTTTTTTTTTTTTAGG + Intronic
974486522 4:62512810-62512832 TTTATGTTGTTGTTTGTTTTGGG - Intergenic
975110961 4:70626072-70626094 TTTACCTTCATAGTTGTACTTGG + Intergenic
975708953 4:77139879-77139901 CTTACCTTGTTTGTGGTGTTAGG - Intergenic
976415778 4:84772975-84772997 TGTACTTTGTTGTTTGTTTTGGG - Intronic
976476429 4:85488953-85488975 TGTAACTTGTAACTTGTTTTTGG + Intronic
976693961 4:87898750-87898772 TATAACTTGTTACTTGTCTTCGG - Intergenic
977610849 4:99028845-99028867 TTTTCCTTTTTTGTTCTTTTAGG + Exonic
978661651 4:111134352-111134374 TTGATCTTGTTACTTGTTATAGG + Intergenic
978936939 4:114389181-114389203 TTTACCTTTTTTTTTTTTTTTGG - Intergenic
979360169 4:119753399-119753421 CATACCTTTTTATTTGTTTTTGG + Intergenic
979380593 4:120001851-120001873 TATATTTTGTTATTTGTTTTAGG - Intergenic
979433620 4:120662654-120662676 TTTCCTTTGTTGGTTGCTTTTGG + Intergenic
979542053 4:121895661-121895683 TTAATCTTGTTACCTGTTTTTGG - Intronic
979687349 4:123525508-123525530 TTTAGCTTGTAAGTTGCTTTGGG - Intergenic
980287435 4:130798655-130798677 TTTACCGTGTGAGTTGTAATAGG + Intergenic
980413278 4:132451034-132451056 TTAATCTTGTTACTTGTTATTGG - Intergenic
980562188 4:134491829-134491851 TTTCCATTGTTATTTGTTTCAGG - Intergenic
980621819 4:135317007-135317029 TTGATCTTGTTTTTTGTTTTTGG + Intergenic
980850572 4:138375943-138375965 TTGATCTTGTTACTTGTTTTTGG - Intergenic
981121849 4:141060439-141060461 TTTTTCTTTTTAGTTTTTTTAGG - Intronic
981280214 4:142948518-142948540 TTTACCTTTTTTGTTGTTGTTGG - Intergenic
982622943 4:157729213-157729235 GTTTCCTTGTTGTTTGTTTTAGG - Intergenic
982633104 4:157857279-157857301 TTTACCTGTTAAGTTGTTATGGG - Intergenic
983041840 4:162937982-162938004 TTTACCTCTTTATTTGATTTAGG - Intergenic
983894286 4:173065126-173065148 TTAACCTTGTTACTTGTTTTTGG + Intergenic
984076670 4:175190074-175190096 TTTATCTTTTTAATTTTTTTGGG - Intergenic
984678905 4:182584376-182584398 TTTACATTTTTACATGTTTTTGG + Intronic
984690901 4:182725036-182725058 TTTGGTTTGTTTGTTGTTTTGGG + Intronic
984730994 4:183068182-183068204 TTAGCATTTTTAGTTGTTTTCGG - Intergenic
985725593 5:1514288-1514310 TGGACCCTGTTTGTTGTTTTTGG - Intronic
986156324 5:5179959-5179981 TTTTCCTTGAGAGTTGTGTTTGG + Intronic
986392104 5:7296750-7296772 TTGAACTTGTTAGGTGTTTGGGG + Intergenic
986821917 5:11476730-11476752 TTTACATTTTTAAGTGTTTTGGG - Intronic
987555616 5:19443576-19443598 TATACCTGGCTAGTAGTTTTTGG + Intergenic
988161940 5:27529720-27529742 TTTTCCTTCTTAATTGTTGTTGG + Intergenic
988299862 5:29408561-29408583 TTTACATTCTTATTTGTTTCAGG - Intergenic
988353769 5:30145494-30145516 TTAATCTTGTTACTTGTTATTGG + Intergenic
988470482 5:31532618-31532640 TCTTCCTAGTTAGCTGTTTTGGG - Intronic
988607987 5:32697657-32697679 TCAACCTTGTTACTTGTTATTGG + Intronic
989204666 5:38798707-38798729 TTTATCTTAGTAGCTGTTTTAGG + Intergenic
989562597 5:42869216-42869238 AGTACCTTGTTTTTTGTTTTTGG + Intronic
989565035 5:42893741-42893763 TTTACCTTGCTAATTGCTTCAGG - Intergenic
989570125 5:42938261-42938283 TTCACCATGTTAGCTGTTGTGGG - Intergenic
989743398 5:44798627-44798649 TGTATCTTTTTACTTGTTTTTGG - Intergenic
990493450 5:56323411-56323433 TTTACCTTTTTAATGGTTTTCGG - Intergenic
990756804 5:59080881-59080903 TTTACCTAGTTAGTCATATTTGG - Intronic
991153845 5:63406212-63406234 TTTAAGTTGTTAGTTTTTATTGG - Intergenic
991156418 5:63441560-63441582 TTTAATTTGTTAGCTGTATTTGG + Intergenic
991310188 5:65230996-65231018 TATATCTTGTCAATTGTTTTTGG - Intronic
991348150 5:65692024-65692046 GTTACCTTAATAGTTATTTTTGG - Intronic
991372380 5:65932734-65932756 GTTATTTTGTTACTTGTTTTTGG + Intronic
991457445 5:66819691-66819713 TTTACATTTTTTGTTTTTTTGGG + Intronic
992280153 5:75166686-75166708 TTTACCTTGTTAGTAGGTAAAGG - Intronic
992579130 5:78152345-78152367 TCAATCTTGTTACTTGTTTTTGG + Intronic
993331552 5:86606486-86606508 TTTTCCTTTTTTGTTTTTTTTGG + Intergenic
994100839 5:95890834-95890856 TTTTCCTATTTAGTTGTGTTTGG + Intronic
994344410 5:98668255-98668277 TTGATCTTGTTACTTGTTATTGG - Intergenic
994654291 5:102570529-102570551 TTTACATTTTTATTTGTTTCAGG - Intergenic
995020345 5:107360277-107360299 ATTATCTTTTTAGTTGTTTATGG + Intergenic
995432176 5:112092516-112092538 TTGATCTTGTTACTTGTTATTGG - Intergenic
995736104 5:115300964-115300986 GTTACCATTTTAATTGTTTTGGG + Intergenic
996141512 5:119914753-119914775 TTTTCCTTGCTAGTGGTGTTTGG + Intergenic
996756184 5:126937728-126937750 GTGACCTTGGTTGTTGTTTTTGG + Intronic
996821430 5:127633304-127633326 TTTGCCTTCTTAGTCATTTTGGG + Intergenic
996927854 5:128849881-128849903 TTGATCTTGTTACTTGTTATTGG - Intronic
997175895 5:131777454-131777476 ATTACCTTAGTAGTTTTTTTCGG - Intronic
998083914 5:139300562-139300584 TTTACCTTCTTAGTTTTATGAGG + Intronic
998235366 5:140394019-140394041 TTTAGCTTTGTTGTTGTTTTGGG + Intergenic
999025485 5:148226438-148226460 TCTAGTTTATTAGTTGTTTTAGG - Intergenic
999588821 5:153121071-153121093 GTTGCATTGTTTGTTGTTTTAGG - Intergenic
999919333 5:156301908-156301930 TTTATTTTGTTTGCTGTTTTTGG + Intronic
1000132400 5:158312831-158312853 TTTACTTTGTGATTTGCTTTGGG - Intergenic
1000394062 5:160754661-160754683 ATTGCCTTGTTAGTTCTTTGTGG + Intronic
1001754895 5:174160804-174160826 TTCCTCTTGTTAGTTTTTTTTGG + Intronic
1002653155 5:180719060-180719082 TTTACCATAATAGTTGTTATGGG + Intergenic
1003420862 6:5957330-5957352 TTAACTTTGTTTTTTGTTTTTGG - Intergenic
1003670697 6:8155324-8155346 TTTACCTTGTCATCTTTTTTGGG - Intergenic
1004402494 6:15301925-15301947 TTTACGTTGGTATGTGTTTTTGG + Intronic
1004985082 6:21072383-21072405 TTCACCTTTTTAATTGTTCTTGG + Intronic
1005102213 6:22184135-22184157 GTCATTTTGTTAGTTGTTTTGGG + Intergenic
1005783275 6:29216166-29216188 TTAACCTTGTTAGTTATTCTGGG - Intergenic
1007242108 6:40433624-40433646 TTTACATTCTTAATTGGTTTAGG + Intronic
1007492177 6:42231759-42231781 TTTACTTTGTTTTTTGCTTTAGG - Intronic
1008295497 6:49771155-49771177 TTTATTTTATTATTTGTTTTAGG + Intergenic
1008540591 6:52543570-52543592 TTTAGGTTGTGAGTTATTTTTGG + Intronic
1008896329 6:56560414-56560436 TTTCCCTTGTTAGTCGTTTGAGG - Exonic
1009245748 6:61235433-61235455 TTGATCTTGTTACTTGTTATTGG - Intergenic
1009295824 6:61945691-61945713 TTTACTTTGAAAGGTGTTTTTGG - Intronic
1009621164 6:66079494-66079516 TTCATTTTGTTAATTGTTTTTGG + Intergenic
1009775073 6:68195358-68195380 TTTCCTTTGTTAGATGTTCTGGG - Intergenic
1010328266 6:74590403-74590425 TTGATCTTGTTACTTGTTATTGG - Intergenic
1010519371 6:76813706-76813728 TTTACATGGTTACTTGTATTAGG - Intergenic
1010694755 6:78957451-78957473 TTTACCTTATTAATTATGTTTGG + Intronic
1011267537 6:85538752-85538774 TTTTCCTTTTTATTTGTATTAGG + Intronic
1011582000 6:88878537-88878559 TTTACTTTTTTAATTGTTCTGGG - Intronic
1011922974 6:92605361-92605383 TTGATCTTGCTAGTTGTTATTGG - Intergenic
1012059550 6:94461846-94461868 TCAATCTCGTTAGTTGTTTTGGG + Intergenic
1012184459 6:96195764-96195786 CTTATCTTTTTAGTTTTTTTTGG - Intronic
1012432647 6:99182027-99182049 TTTGTTTTGTTTGTTGTTTTGGG + Intergenic
1012454301 6:99387663-99387685 TTTACCTTGTTTCTGATTTTAGG - Intronic
1013543788 6:111135997-111136019 GGAACCTTCTTAGTTGTTTTAGG - Intronic
1013703420 6:112801711-112801733 TTTTCCCTATTATTTGTTTTGGG - Intergenic
1013750491 6:113400088-113400110 TTGACCTTGTGATTTGTTTATGG + Intergenic
1013909484 6:115256589-115256611 TTGTTCTTGTTATTTGTTTTTGG - Intergenic
1014634973 6:123834151-123834173 TTTATTTAGTTAGTTATTTTTGG + Intronic
1015439238 6:133228801-133228823 TTTTGCTTTTTATTTGTTTTAGG + Intergenic
1016251840 6:142052466-142052488 TTGATCTTGTTACTTGTTATTGG - Intergenic
1016623394 6:146138543-146138565 TTGACCTTCTTACTTGTTATTGG + Intronic
1017452242 6:154565027-154565049 TGTACCTGGTAAGTTGTTGTAGG + Intergenic
1018167976 6:161117272-161117294 TTTACCTTTTTTGTTGTTGTTGG + Exonic
1018316983 6:162566608-162566630 TTAATCTTGTTACTTGTTATTGG - Intronic
1018536052 6:164820380-164820402 TTTTGCTTGTTAGTTTGTTTAGG + Intergenic
1018680974 6:166264671-166264693 TTGACCATGTTCTTTGTTTTTGG + Intergenic
1019703992 7:2488817-2488839 TGGTCCTTGTTAGTTTTTTTTGG - Intergenic
1020664887 7:11027881-11027903 TTTACTTTCTTTGTTATTTTTGG + Intronic
1020817129 7:12919403-12919425 TTTTCCGTGTTAGTGGTTGTGGG + Intergenic
1020842247 7:13233518-13233540 TTTATTTTGTTATTTTTTTTTGG + Intergenic
1021296317 7:18911115-18911137 TCTATCTTGTTATTTGTTATTGG + Intronic
1021449444 7:20769322-20769344 TTTACTTTGTTAACTGATTTAGG - Intronic
1021727120 7:23558814-23558836 TTAATCTTGTTACTTGTTATTGG + Intergenic
1022356981 7:29625210-29625232 TTTGGCTTGTTAGCAGTTTTTGG - Intergenic
1023486864 7:40696900-40696922 TTTACCATTTTGGTTGTTTCTGG - Intronic
1024489681 7:49965852-49965874 TTTATTTTGGTAGTTGCTTTAGG - Intronic
1024498623 7:50075727-50075749 TCTATCTTGTTACTTGTTATTGG - Intronic
1025967271 7:66285958-66285980 TTTACGTTCTTAGTGGTTTATGG + Intronic
1026400546 7:70007907-70007929 TTTACCTTTATAGGTGTTTGGGG + Intronic
1027003395 7:74670988-74671010 TTTTCCTTGTTTGTTTTTTAAGG + Intronic
1027510741 7:79076723-79076745 TCTACATTGTTAGTTCTTTAGGG - Intronic
1027774534 7:82447396-82447418 TTTACCTTGTTTATTAGTTTAGG - Intergenic
1027885173 7:83894981-83895003 TTTGCCTTTTTAGTAGTTTGGGG - Intergenic
1028732139 7:94163441-94163463 TTTACATTGTTAGCTTTGTTAGG - Intergenic
1029991250 7:104964610-104964632 TTTATTTTGTTAGTTTTCTTTGG + Intergenic
1030235801 7:107260762-107260784 TTTATTTTGTTCTTTGTTTTTGG - Intronic
1030444443 7:109631845-109631867 TTTTTCTTGTTTGTTGTTTATGG - Intergenic
1030524197 7:110633984-110634006 TTTAACATGCTAGTTGTATTAGG + Intergenic
1030978074 7:116152196-116152218 TTTGACTTTTTAGTTGTTTAAGG - Intronic
1031325342 7:120389711-120389733 TCTACCATTTTAGTTATTTTAGG + Intronic
1032901034 7:136308481-136308503 TTTACTTTGTTGGTTGTTTGTGG + Intergenic
1032901517 7:136314933-136314955 TCAATCTTGTTACTTGTTTTGGG + Intergenic
1032952017 7:136925506-136925528 TTTACATTGTTCTTTGTTTTTGG - Intronic
1033659228 7:143392298-143392320 TTTACTTTGCTAATGGTTTTTGG - Intronic
1033863294 7:145657007-145657029 TTGATCTTCTTATTTGTTTTTGG - Intergenic
1035060902 7:156068866-156068888 TTTATCTTGTTGGAAGTTTTTGG + Intergenic
1035489656 7:159262401-159262423 TTTATCTTAATAGTTGTTCTTGG - Intergenic
1036282677 8:7415088-7415110 TTTTCCCTGTTAGGTGTTTTTGG - Exonic
1036338797 8:7896461-7896483 TTTTCCCTGTTAGGTGTTTTTGG + Exonic
1036720291 8:11168046-11168068 TTTGCTTTTTTTGTTGTTTTTGG - Intronic
1037550410 8:19965446-19965468 CTACCCTTGTTAGTTATTTTAGG + Exonic
1039727805 8:40238589-40238611 TATATCTTGTTACTTGTTATTGG + Intergenic
1040938299 8:52805044-52805066 TTTTCCTTTTTACTTTTTTTTGG + Intergenic
1041226473 8:55705266-55705288 TTTACATTTTTCGGTGTTTTGGG + Intronic
1041607953 8:59806756-59806778 TTTACCTTGTTCCCTGTCTTAGG - Intergenic
1042676290 8:71325984-71326006 TTTACCTTGATAGATGATCTGGG - Intronic
1042979314 8:74507558-74507580 ATTAACTTGTAAATTGTTTTTGG - Intergenic
1043122338 8:76342970-76342992 TTTACCTTGTTAGTTAGTCTTGG - Intergenic
1043123205 8:76357801-76357823 TTAACTTTGTTAGCTGTTTTAGG + Intergenic
1043762911 8:84092095-84092117 TTTATCTTGTTATTTGTTATTGG + Intergenic
1043796490 8:84547983-84548005 TTTTACTTGTTAGCTGTTCTCGG + Intronic
1043928361 8:86063377-86063399 GTTAACTTTTTTGTTGTTTTGGG - Intronic
1043975999 8:86585512-86585534 TTTTCCTTGTGAGTTCTTTCTGG - Intronic
1044227049 8:89730967-89730989 TTTACCTTGTTCCTTTATTTGGG - Intergenic
1044765269 8:95565738-95565760 TTTACCTTATTTGTTTTTTGAGG + Intergenic
1047492131 8:125383889-125383911 TCTACTTTGTGAGTTGTTGTAGG + Intergenic
1047810305 8:128401637-128401659 TTTACCAAGTCAGTTGATTTAGG - Intergenic
1048155509 8:131944723-131944745 TTTATCTTGTTATTGTTTTTAGG + Exonic
1049055972 8:140237859-140237881 TTTGCCATTTTAGTAGTTTTTGG - Intronic
1050079305 9:1898716-1898738 TTTCTCTTTTTAGTTGTCTTGGG - Intergenic
1050790485 9:9462717-9462739 TTTTCCCTGTTAGGTGATTTGGG - Intronic
1050807258 9:9696058-9696080 TCGACCTTGTTAGTTTTTATTGG + Intronic
1051202693 9:14646128-14646150 TTTACTTTGTTTCTAGTTTTTGG - Intronic
1051400316 9:16674425-16674447 TTTAGATTGTTATTTTTTTTAGG - Intronic
1051486810 9:17617489-17617511 TTTAACATGCTAGTTATTTTAGG - Intronic
1054709552 9:68497814-68497836 GTTACCTTATCAGTTGTCTTAGG + Intronic
1056059906 9:82873962-82873984 TTTACATTTTTTTTTGTTTTAGG - Intergenic
1056203204 9:84296226-84296248 TTTAGCTGGTTTGATGTTTTAGG - Intronic
1056457642 9:86777364-86777386 TTTGCCTTGTTCGTAGTTGTAGG + Intergenic
1057393913 9:94662541-94662563 GTTACATTCTTGGTTGTTTTTGG + Intergenic
1057558668 9:96110094-96110116 TTTTGTTTGTTTGTTGTTTTTGG + Intronic
1058506226 9:105668963-105668985 TTTTACTTGTTATTTGTTCTTGG + Intergenic
1059316786 9:113432516-113432538 CTTACCTTGTTACTTAGTTTTGG + Intergenic
1059828964 9:118070017-118070039 TTTAGCTTTGTAGTTGTTTTGGG + Intergenic
1059940195 9:119351570-119351592 TTTGCATTGTTAGGTGCTTTGGG - Intronic
1060474714 9:123978118-123978140 TTTTCCTTGCTAGTTGTGGTGGG - Intergenic
1060476648 9:123992005-123992027 TTTTCCTTGCTAGTTGTGGTGGG + Intergenic
1203636077 Un_KI270750v1:113350-113372 TTAACCTTGCTACTTGTTATTGG + Intergenic
1186183988 X:7002300-7002322 TTTACCTTGGTAGCTGATATGGG - Intergenic
1187088847 X:16072070-16072092 TTGATCTTGTTACTTGTTATTGG + Intergenic
1187610371 X:20936872-20936894 TTGACCTTGTTACTTGTTATTGG + Intergenic
1187786630 X:22895724-22895746 TTTATGTTGTTTCTTGTTTTGGG - Intergenic
1188211831 X:27434840-27434862 TTTATGTTGTTACTGGTTTTAGG + Intergenic
1188719269 X:33503313-33503335 TTAACCTTGCTACTTGTTATTGG - Intergenic
1188866721 X:35322088-35322110 TCTATCTTGTTACTTGTTATTGG - Intergenic
1189019895 X:37324181-37324203 TCGACCTTGTTAATTGTTATTGG - Intergenic
1189098992 X:38169862-38169884 TTTCCATTTTTAGTTATTTTTGG - Intronic
1189560700 X:42188751-42188773 TTTTCCTGTTCAGTTGTTTTTGG + Intergenic
1189657687 X:43263677-43263699 TTTCCATTGTTATTTGTTTCAGG + Intergenic
1190410444 X:50131861-50131883 TTGACCTGATTGGTTGTTTTGGG - Intergenic
1190749980 X:53353642-53353664 TTTATTTTTTTAGCTGTTTTAGG - Intergenic
1190893567 X:54593290-54593312 TCTACCTTGTTACTTGTTATTGG + Intergenic
1190899410 X:54655138-54655160 TTCATCTTGTTATTTGTTATTGG - Intergenic
1190964892 X:55289980-55290002 TTGATCTTGTTACTTGTTATTGG + Intergenic
1191664833 X:63690460-63690482 TTGATCTTGTTACTTGTTATTGG - Intronic
1191909748 X:66136472-66136494 TTGATCTTGTTACTTGTTATTGG + Intergenic
1192067915 X:67905392-67905414 TTGATCTTGTTATTTGTTATTGG - Intergenic
1192070254 X:67931863-67931885 TTGATCTTGTTACTTGTTATTGG - Intergenic
1192104421 X:68300108-68300130 TTAAGCTTGTTGGTTATTTTTGG + Intronic
1192135435 X:68594585-68594607 TTGATCTTGTTACTTGTTATTGG - Intergenic
1192505838 X:71682211-71682233 TTTCCCTTTTAAGTTGTTCTTGG + Intergenic
1192718856 X:73670713-73670735 TTTTCCTTTTTATTTGTTTTTGG + Intronic
1193245869 X:79228656-79228678 TTTATCTTGTTACTTGTTATTGG + Intergenic
1193370013 X:80684377-80684399 TTTACCTTCATAGTTATTTACGG - Intronic
1193614932 X:83675496-83675518 TTGAACTTGTAAATTGTTTTGGG - Intergenic
1193697000 X:84720737-84720759 TCAACCTTGTTACTTGTTATTGG + Intergenic
1193727103 X:85054976-85054998 TTTAGCTTGTTAATGGTGTTTGG + Intronic
1193837985 X:86370143-86370165 TTTACCTATTTACTTGTTTTAGG - Intronic
1194072937 X:89350387-89350409 ATTACTTTGTTAGGTGTTCTAGG + Intergenic
1194221361 X:91196359-91196381 TTTACCTTTTTAATTATTTTTGG - Intergenic
1194673314 X:96763353-96763375 TTCACCTTTTTTTTTGTTTTTGG + Intronic
1194709963 X:97223762-97223784 TTTTCATAGTTAGTTGTTTTGGG + Intronic
1194788846 X:98120228-98120250 TTAATCTTGTTACTTGTTATTGG - Intergenic
1195489080 X:105445059-105445081 TTGACCTTGTTACTTATTCTTGG + Intronic
1195610963 X:106865804-106865826 TTTATCTTGTTATTGGTGTTTGG + Exonic
1195628396 X:107028500-107028522 GTTACTATCTTAGTTGTTTTGGG - Intergenic
1196162458 X:112500947-112500969 TCAATCTTGTTAGTTGTTATTGG + Intergenic
1196980280 X:121205459-121205481 TTGATCTTGTTACTTGTTATTGG + Intergenic
1196982918 X:121234948-121234970 TTAATCTTGTTACTTGTTATTGG + Intergenic
1197068403 X:122263096-122263118 TCTACCTTGTTACTTGTTATTGG + Intergenic
1197077861 X:122374955-122374977 TTGATCTTGTTACTTGTTATTGG + Intergenic
1197476611 X:126932797-126932819 TTTATCTTATTACTTGTTATTGG + Intergenic
1197677964 X:129351165-129351187 TTTATCTTGTTACATGTTATTGG - Intergenic
1197983552 X:132243924-132243946 TTTACCCTCTTAGTTTCTTTTGG - Intergenic
1198378904 X:136065849-136065871 TTTACCTTTTTTGTTGTATCAGG - Intergenic
1199114353 X:143973014-143973036 TTGATCTTATTAGTTGTTATTGG + Intergenic
1199135598 X:144247335-144247357 TTGATCTTGTTACTTGTTATTGG - Intergenic
1199325670 X:146495160-146495182 TTGAACTTGTTACTTGTTATTGG - Intergenic
1199871781 X:151904764-151904786 TTTCCCTTCCTAGTTGTCTTGGG + Intergenic
1200523326 Y:4239749-4239771 TCAAACTTGTTACTTGTTTTTGG + Intergenic
1201380353 Y:13369592-13369614 TTTACTTTGTTACTTTTTTATGG - Intronic
1202119207 Y:21507128-21507150 TTTCATTTTTTAGTTGTTTTGGG - Intergenic
1202121659 Y:21530668-21530690 TTTCATTTTTTAGTTGTTTTGGG - Intronic
1202157346 Y:21898714-21898736 TTTCATTTTTTAGTTGTTTTGGG + Intronic
1202159793 Y:21922255-21922277 TTTCATTTTTTAGTTGTTTTGGG + Intergenic