ID: 950690874

View in Genome Browser
Species Human (GRCh38)
Location 3:14656392-14656414
Sequence TTAACGTTTTTAAAGGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950690870_950690874 0 Left 950690870 3:14656369-14656391 CCTTTTGGTTGTCTGTTATGCCA 0: 1
1: 0
2: 0
3: 14
4: 136
Right 950690874 3:14656392-14656414 TTAACGTTTTTAAAGGGTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 140
950690868_950690874 6 Left 950690868 3:14656363-14656385 CCCTTGCCTTTTGGTTGTCTGTT 0: 1
1: 0
2: 2
3: 60
4: 599
Right 950690874 3:14656392-14656414 TTAACGTTTTTAAAGGGTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 140
950690869_950690874 5 Left 950690869 3:14656364-14656386 CCTTGCCTTTTGGTTGTCTGTTA 0: 1
1: 0
2: 2
3: 22
4: 387
Right 950690874 3:14656392-14656414 TTAACGTTTTTAAAGGGTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950690874 Original CRISPR TTAACGTTTTTAAAGGGTCC AGG Intronic
906055679 1:42915014-42915036 TTAAAGTTTTTAAAGAGACGGGG - Intergenic
907068288 1:51508938-51508960 TTAATGGTTTTATAGGATCCAGG - Intronic
907071216 1:51536685-51536707 TTCACATTTTTAAAGAGTACTGG + Intergenic
908524296 1:64972945-64972967 TTAAATTTTTTATAGAGTCCAGG - Intergenic
910004193 1:82375366-82375388 TTAACATATTTACAGGCTCCAGG + Intergenic
913272200 1:117105396-117105418 ACAAGGTTTTTAAAGGGCCCAGG - Exonic
914870051 1:151465886-151465908 TTAAATTTTTTAAAGGTTTCTGG + Intergenic
915248870 1:154574480-154574502 TAAACGTTTTTAAAGGGACCAGG + Intronic
916712425 1:167423665-167423687 TTAACTTTTTGACAGTGTCCTGG - Exonic
920732813 1:208503820-208503842 TTAACGTTTTTAAGACTTCCAGG + Intergenic
921353379 1:214261043-214261065 TTGACATTTTTAAAGGGTCTGGG + Intergenic
921695920 1:218210185-218210207 TAAACATTTTTAAAAGGTGCAGG + Intergenic
922007618 1:221548063-221548085 TAAACATTTTTGAAGGGTACTGG - Intergenic
922816897 1:228455739-228455761 TTAAGGTTTTTGCAGGGTCTGGG - Intergenic
924471844 1:244349618-244349640 TTATCATTTTTAAAGAGTCCAGG + Intergenic
1063104043 10:2977225-2977247 TTAAAGTTTTTAAAAAGTGCTGG + Intergenic
1066505140 10:36034568-36034590 AAATCATTTTTAAAGGGTCCTGG - Intergenic
1068691966 10:59925796-59925818 GTAACCTATTTAGAGGGTCCAGG - Intergenic
1070255045 10:74806736-74806758 TTGATGTTTTTAAAGGTTTCAGG - Intergenic
1072296589 10:94014301-94014323 TTAACCATTTTAAAGTGTACAGG + Intronic
1072714982 10:97745030-97745052 TTAACCTTTTTAACAGTTCCGGG + Intronic
1072998686 10:100268966-100268988 TTGACTTTTTTGAAGGGTTCAGG + Intergenic
1074376392 10:112944215-112944237 TAATCGTTATTAAAGGTTCCAGG - Intergenic
1078120770 11:8506686-8506708 GTAACATTTTTACAGGTTCCAGG + Intronic
1082115818 11:48327133-48327155 TTAATTTTTTTAAAAGTTCCAGG + Intronic
1083482869 11:62960951-62960973 TTAACATTCTTCAAGGGTCTGGG + Intronic
1086720741 11:90118128-90118150 TTGACATTTTTAAAGGTCCCAGG + Intergenic
1087025653 11:93646955-93646977 TTAAAATTTTTTAAGGGACCGGG - Intergenic
1087046556 11:93848327-93848349 TTAACGTCTTTTAAGGGCGCAGG + Intronic
1090126263 11:124088247-124088269 ATAACGTTTTAAAAGTGTTCTGG + Intergenic
1090956409 11:131516672-131516694 GTAACTTTTTTAAAGGGTCAGGG - Intronic
1092182580 12:6456230-6456252 TTGACATTTTTGAAGGGTCCAGG + Intronic
1092799336 12:12148103-12148125 TTTACATTTTTAAAAGGTCATGG + Intronic
1093114502 12:15192780-15192802 TTAACACTTTTAAAGAGTACTGG + Intronic
1097216249 12:57415833-57415855 TTAATATTTTTGAAGTGTCCAGG - Intronic
1100580177 12:95931421-95931443 GTAACGTATTTACAGGTTCCAGG + Intronic
1103177571 12:118877906-118877928 TTAAAGTTTTTTAAGGTTTCTGG - Intergenic
1109998265 13:70158799-70158821 TTAATGTTTTTAAACGGTCAGGG - Intergenic
1110096662 13:71532618-71532640 TTCACATGTTTAAAGGATCCTGG + Intronic
1110100833 13:71598962-71598984 CTAACTTTTTTAAAGTGTCTAGG + Intronic
1111841049 13:93451438-93451460 TTTACGTTTTTAAATGGTTGGGG + Intronic
1113318708 13:109211408-109211430 TTAAAGTTTATAAAGCATCCTGG - Intergenic
1117530776 14:56658600-56658622 TTAACATGTTTGAAGAGTCCTGG - Intronic
1119264790 14:73258151-73258173 TTAACCCTTTTAAAGTGTACAGG + Intronic
1119523640 14:75304580-75304602 TTAACCATTTTTAAGTGTCCAGG + Intergenic
1125105479 15:35966115-35966137 ATAACATTTTTAAAAGGTTCAGG - Intergenic
1125374236 15:39011750-39011772 TGAACGTTATTAAATGTTCCTGG + Intergenic
1125815679 15:42581853-42581875 TAAACGTTTTACAAGGGGCCAGG + Intronic
1127356056 15:58201147-58201169 TTAACATTTTAACAGGTTCCAGG - Intronic
1127532206 15:59854461-59854483 ATAAGGTTTTTAAATGGGCCCGG - Intergenic
1129042531 15:72702139-72702161 TTAATGATTTTAAAGCGGCCAGG - Intronic
1130934591 15:88458226-88458248 TTAATGTTTTTAAATGATCAGGG - Intergenic
1131938022 15:97528684-97528706 TTAACGTTTCTAAAAGGTGAGGG + Intergenic
1137331439 16:47501278-47501300 CTGACATTTTTAAAGAGTCCAGG - Intronic
1139074219 16:63423812-63423834 TTAACATTTTTAAGGGGTCTTGG + Intergenic
1142959672 17:3544699-3544721 TTAAAGTTTTAAAATGGGCCGGG + Intronic
1142992693 17:3742161-3742183 TTAACATTTTTGAAGGGTACAGG - Intronic
1146436898 17:32858460-32858482 TTAACATTTTTGAAGGTTACAGG + Intronic
1147344445 17:39779671-39779693 TTTACGTTTTTAAAAGGCCGTGG - Intronic
1149233117 17:54559054-54559076 TCAACTTTTTTAAAGCATCCTGG + Intergenic
1151272309 17:73006421-73006443 TTTACATTTTTAAAGGGTCTTGG + Intronic
1152156790 17:78639009-78639031 TTCAAGCTTTTAAAGGGTCTGGG - Intergenic
1155202664 18:23530930-23530952 CTAAGGGTTTTAAAGGGTCTGGG + Intronic
1156616793 18:38796144-38796166 TAAAGGTTTTTAAAGGGTTGAGG - Intergenic
1158161010 18:54483452-54483474 TTATCATCTTTCAAGGGTCCTGG - Intergenic
1159886133 18:73909167-73909189 TTAGGGTATTTAAAAGGTCCTGG - Intergenic
1163145293 19:15375437-15375459 TTTACGTTTTTAAATGGTTGGGG + Intronic
1164262834 19:23583180-23583202 TGCACGTTTTGAAGGGGTCCAGG - Intronic
1166264387 19:41669201-41669223 TTAACATTTTTAAAGAGTATCGG - Intronic
1167140212 19:47645249-47645271 TTGACATTTTAGAAGGGTCCAGG + Intronic
925015524 2:521526-521548 TTAATTTTTCTAAAGAGTCCTGG + Intergenic
927161453 2:20266716-20266738 TTGACATTTTTAAAGGGTATAGG - Intronic
927433156 2:23043974-23043996 GTAACATTGTTAAAGGTTCCAGG - Intergenic
929878448 2:45816349-45816371 TTAAAGTTTTTGGAGTGTCCTGG + Intronic
931220061 2:60281320-60281342 TTGACATTTTTAAAGAGTACTGG - Intergenic
933076551 2:77934792-77934814 TTAACTTTTTAAAATGGTGCAGG - Intergenic
938888740 2:135680925-135680947 TTAAGGTTTTTATAGGGGTCTGG + Intronic
946106419 2:217373999-217374021 TTAGGGTTTTCAAAGGGCCCAGG + Intronic
946295316 2:218779244-218779266 TTAGAGTTATTAAAGGTTCCAGG + Intergenic
947343663 2:229167523-229167545 GTAACGTTTTTGAAGAGTTCTGG - Intronic
1172223676 20:33290321-33290343 TTCACATTTTTAAAGACTCCTGG + Intronic
1173932047 20:46829033-46829055 CTAACATTTTCAAAGGCTCCAGG - Intergenic
1178140433 21:29676773-29676795 TTGACATTTTTAAAGAGTCCAGG - Intronic
1178241763 21:30911300-30911322 TAAACTATTTTGAAGGGTCCAGG + Intergenic
1178379414 21:32095507-32095529 TGATCATTTTTAAAGGGTTCTGG - Intergenic
1180737492 22:18028736-18028758 TTTACTTTTTTAAAGAGTCAGGG + Intergenic
1182476165 22:30577505-30577527 TTAATTTTTTTAAAGGGACAGGG + Intronic
949599603 3:5583631-5583653 TTAACATTTTTAAATGGTTGGGG + Intergenic
950690874 3:14656392-14656414 TTAACGTTTTTAAAGGGTCCAGG + Intronic
950717587 3:14860676-14860698 TTAAAGTGTTAAAAGGGTCCGGG + Intronic
951479310 3:23142441-23142463 TAAATGTTTTTCAAGGGTTCTGG + Intergenic
951808679 3:26676012-26676034 TTAACGTTTTTGAAGAGTGTTGG + Intronic
955022299 3:55132952-55132974 TTAAACTTGTTAAAGGGGCCAGG - Intergenic
959058133 3:101588691-101588713 TTAACATTTTTGAAGAGTACAGG + Intronic
962846215 3:139275924-139275946 TTTACATTTTGAAAGGATCCTGG - Intronic
965829530 3:172768767-172768789 TTGACGTTTTTGAAGAGTACAGG + Intronic
968122312 3:196134352-196134374 TTAATGTTTTTATAGAGTCAGGG + Intergenic
971314740 4:25558365-25558387 TTAACATTTTTGAAGAGTTCAGG + Intergenic
971638527 4:29097506-29097528 GTAACGTATGTAAAAGGTCCTGG + Intergenic
972475138 4:39443023-39443045 TTGACGTGTTTGAAGAGTCCAGG + Intronic
974559651 4:63500316-63500338 TTAATATTTTTAAAGGGTACAGG + Intergenic
975675111 4:76820344-76820366 TTCAAGTATTCAAAGGGTCCAGG + Intergenic
976744687 4:88391456-88391478 TTAACATATTTACAGGCTCCAGG + Intronic
979453230 4:120897494-120897516 ATAATGTTTTTAAAAAGTCCTGG + Intronic
979991298 4:127378847-127378869 GTAATCTTTTTAGAGGGTCCTGG + Intergenic
980252030 4:130329535-130329557 GTAACGTATTTACAGGTTCCGGG - Intergenic
980643983 4:135618009-135618031 TTACCTTCTTTAAAGGGTCAAGG - Intergenic
981008536 4:139900508-139900530 TAAATGTTTTTACAGGCTCCTGG + Intronic
981098825 4:140808989-140809011 TTAACCTTTTTTAAGCGTACAGG + Intergenic
984493307 4:180464201-180464223 TTAATATTTTTAAAGGGTCTTGG - Intergenic
988820967 5:34885177-34885199 TTGACATTTTTAAAAGGTCTAGG - Intronic
991455100 5:66794688-66794710 TTAACTTTTTTGAAGGGACAAGG + Intronic
992244364 5:74803930-74803952 TTAACATTTTTAAATGACCCAGG - Intronic
993396247 5:87392826-87392848 TTAACGTTTTTAATGGGGCTGGG + Intronic
995030554 5:107475886-107475908 TTAGCATTTTTAAAGGATCTGGG - Intronic
995757114 5:115517961-115517983 TTGACATTTTTAAAGAGTACTGG - Intergenic
995906612 5:117131711-117131733 TTGACATTTTTAAAGAGTACTGG + Intergenic
996497603 5:124179251-124179273 TTTAAGTTCTTAAAGGCTCCAGG + Intergenic
997029505 5:130109152-130109174 TTAACGGTTTTAAAGTTTCTTGG - Intronic
997393615 5:133538233-133538255 TTAATATTTTTGAAGGGTACAGG + Intronic
997770498 5:136549040-136549062 TTAATCTTTTTAAAGCGTGCTGG + Intergenic
1001965855 5:175909302-175909324 TGACCAGTTTTAAAGGGTCCTGG - Intergenic
1002251090 5:177929899-177929921 TGACCAGTTTTAAAGGGTCCTGG + Intergenic
1004827584 6:19440240-19440262 TTTACATTTTTAAATGATCCGGG - Intergenic
1006010098 6:31035487-31035509 ATGACGTATTTAAAGGCTCCTGG - Intergenic
1012332056 6:98004278-98004300 TTAACATTTTTAAATGATCTAGG - Intergenic
1017150972 6:151279838-151279860 TTTACTTTTTTAAAGAGACCAGG - Intronic
1018956516 6:168413765-168413787 TTAACCATTTTTAAGTGTCCCGG + Intergenic
1019498709 7:1353577-1353599 TTAACATTTTCAAAAAGTCCAGG - Intergenic
1022049642 7:26653415-26653437 TTCACATTTTTAAAAGGTCATGG - Intergenic
1022613720 7:31906280-31906302 TTAACACTTTTAAAAGGCCCTGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1027566863 7:79806191-79806213 TTAACGTATTTACAGGTTCATGG - Intergenic
1028293123 7:89092835-89092857 TATACATTTTTAAAGAGTCCTGG + Intronic
1029792628 7:102861321-102861343 TTGACTTTTTTTAAGGGTCTAGG + Intronic
1031055670 7:116990686-116990708 TTTACAATTTTAAAGGGTCATGG - Intronic
1032158830 7:129494137-129494159 TTTACGTTTTTAAATGGTTGGGG + Intergenic
1032277126 7:130467747-130467769 TTGACGGTTTTGAAGGGTTCTGG + Intergenic
1036161662 8:6394579-6394601 TTGACGTTTTTGAAGGATACAGG + Intergenic
1036227884 8:6975235-6975257 TTCACATTTTTAAAAGGTCTTGG - Intergenic
1036230337 8:6994352-6994374 TTCACATTTTTAAAAGGTCTTGG - Intergenic
1036232789 8:7013455-7013477 TTCACATTTTTAAAAGGTCTTGG - Intronic
1036610246 8:10343649-10343671 TTTACATTTGTAAAGGGTGCTGG + Intronic
1042491463 8:69403481-69403503 GTAACAATTTTAAAGTGTCCAGG + Intergenic
1043008083 8:74845523-74845545 TTAACGTCTTTAAAGGATCCAGG - Intronic
1046670332 8:117049941-117049963 TTAAAGTGTTTAAAGTGACCCGG + Intronic
1050518148 9:6467412-6467434 GTAACGTATTTATAGGTTCCTGG + Intronic
1051497655 9:17742806-17742828 TTTAGGTTTTTAAATGGTACAGG + Intronic
1059307359 9:113364963-113364985 TTAACATTTTTAAAGAGTCAAGG + Intronic
1186337378 X:8605144-8605166 TTAACATTTTCAAAGTGCCCAGG - Intronic
1187263156 X:17705881-17705903 TTAACATTTTCAAAGAGTACTGG - Intronic
1190885249 X:54525969-54525991 TTTATGTTTTTGAAGAGTCCAGG - Intergenic
1197280399 X:124528952-124528974 TTAACATTTCTAAAGTGTCTAGG + Intronic
1202273454 Y:23092703-23092725 TTAATTTTTTTAAAGGAGCCAGG + Intergenic
1202292572 Y:23327979-23328001 TTAATTTTTTTAAAGGAGCCAGG - Intergenic
1202426451 Y:24726447-24726469 TTAATTTTTTTAAAGGAGCCAGG + Intergenic
1202444338 Y:24943639-24943661 TTAATTTTTTTAAAGGAGCCAGG - Intergenic