ID: 950692576

View in Genome Browser
Species Human (GRCh38)
Location 3:14671928-14671950
Sequence CGAGCATGGGGGCGACAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950692576_950692590 19 Left 950692576 3:14671928-14671950 CCTCCCTGTCGCCCCCATGCTCG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 950692590 3:14671970-14671992 CCTGACTTGGATCAGACTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 101
950692576_950692586 6 Left 950692576 3:14671928-14671950 CCTCCCTGTCGCCCCCATGCTCG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 950692586 3:14671957-14671979 TCACATTCAGGAGCCTGACTTGG 0: 1
1: 0
2: 0
3: 8
4: 176
950692576_950692588 18 Left 950692576 3:14671928-14671950 CCTCCCTGTCGCCCCCATGCTCG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 950692588 3:14671969-14671991 GCCTGACTTGGATCAGACTTGGG 0: 1
1: 0
2: 0
3: 16
4: 241
950692576_950692587 17 Left 950692576 3:14671928-14671950 CCTCCCTGTCGCCCCCATGCTCG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 950692587 3:14671968-14671990 AGCCTGACTTGGATCAGACTTGG 0: 1
1: 0
2: 0
3: 2
4: 97
950692576_950692584 -6 Left 950692576 3:14671928-14671950 CCTCCCTGTCGCCCCCATGCTCG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 950692584 3:14671945-14671967 TGCTCGGCTTCCTCACATTCAGG 0: 1
1: 0
2: 1
3: 11
4: 147
950692576_950692591 30 Left 950692576 3:14671928-14671950 CCTCCCTGTCGCCCCCATGCTCG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 950692591 3:14671981-14672003 TCAGACTTGGGGCTGCACAGTGG 0: 1
1: 0
2: 4
3: 20
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950692576 Original CRISPR CGAGCATGGGGGCGACAGGG AGG (reversed) Exonic
900226511 1:1535793-1535815 GGTGCCTGGGGGCGGCAGGGCGG + Exonic
900244364 1:1630671-1630693 CGAGCCTGGGGGCGAGGGGGGGG + Intergenic
900463434 1:2812230-2812252 CAAGGCTGGGGGCGACAGGTGGG - Intergenic
900485569 1:2921116-2921138 CGAGCAGCGGGGCGGCAGTGGGG - Intergenic
900955205 1:5882565-5882587 AGGGCATGTGGGCGACATGGAGG - Intronic
901230736 1:7640568-7640590 CCAGCGTGGGGGCGCCAGGCCGG - Intronic
905651621 1:39660754-39660776 AGAGAATGGGGACGTCAGGGAGG + Intronic
908128840 1:61054495-61054517 CGAGCAAGGGGGAGACAGGCAGG + Intronic
912765195 1:112402585-112402607 GGAGAATGGGGGCTCCAGGGAGG + Intronic
918040717 1:180912673-180912695 CGAGCTTGGGGACGACGGGGCGG - Intergenic
920446626 1:206023098-206023120 CGAGAATGGGGGGAAGAGGGAGG - Intronic
921305934 1:213796850-213796872 AGTGCATGGGGGCGAGAGGATGG - Intergenic
922705090 1:227786476-227786498 CGGGCATGGCGGCTGCAGGGTGG + Intergenic
1063339853 10:5252816-5252838 CCAGCATGGTGGCCACAGGGGGG - Intergenic
1063971727 10:11385766-11385788 CAAACATGGTGGGGACAGGGGGG + Intergenic
1064203094 10:13300517-13300539 CGAGCTTCGGTGCGGCAGGGAGG - Intronic
1067655608 10:48189234-48189256 GGAGCATGTGGGTGTCAGGGTGG + Intronic
1069943053 10:71968570-71968592 CTGGCATGGTGGAGACAGGGTGG - Intronic
1076613184 10:131738941-131738963 GGAGCATGGGGTGGGCAGGGTGG - Intergenic
1076721976 10:132396859-132396881 CGAGCCCGGGGGCGGCGGGGGGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077104141 11:834703-834725 TGAGCATGGGGAAGCCAGGGAGG - Intronic
1078449707 11:11431426-11431448 CTATCATGGGGGAGACAGGAAGG - Intronic
1080818967 11:35787127-35787149 CGGGCATGGGGACGAGAGGAGGG + Intronic
1081737837 11:45416721-45416743 TGAGCATGGGGAAGAGAGGGAGG - Intergenic
1084225369 11:67711809-67711831 CGAGCATGGGGACGGCGCGGAGG - Intergenic
1084263185 11:67991656-67991678 CGAGCATGGGGACGGCGCGGAGG - Exonic
1084360662 11:68666963-68666985 GGAGCATGGGGGAGACCAGGAGG + Intergenic
1084573822 11:69976012-69976034 AGAGCATGGTGGGGACAGGCGGG - Intergenic
1084810212 11:71607465-71607487 CGAGCATGGGGACGGCGCGGAGG + Intergenic
1090366281 11:126209276-126209298 CAAGCATGGGGTGGACATGGTGG - Intronic
1091562535 12:1626098-1626120 CGAGCATGGTGGTGCCTGGGAGG - Intronic
1091759352 12:3077107-3077129 CGGGCATGCGGGCGGCGGGGCGG + Intergenic
1091923119 12:4321383-4321405 CGAGCAGGGAGGGGAGAGGGTGG - Intronic
1095975925 12:47941212-47941234 CTAGATTGGGGGTGACAGGGGGG + Intronic
1101325989 12:103716373-103716395 AGAGAATGGGGGTCACAGGGTGG + Intronic
1103946956 12:124532204-124532226 GGGGCATGGGGGAGACAAGGGGG - Intronic
1104253940 12:127123644-127123666 AGAGCATGGGGGATAAAGGGTGG + Intergenic
1104254041 12:127123912-127123934 AGAGCATGGGGGATAGAGGGTGG + Intergenic
1104254167 12:127124222-127124244 AGAGCATGGGGGATAGAGGGTGG + Intergenic
1104919961 12:132285547-132285569 GCAGCCTGGGGGCGACAGGATGG + Intronic
1110848822 13:80220977-80220999 CAAGGATGGGGGCAAAAGGGAGG + Intergenic
1113781964 13:112982104-112982126 AGAGCATGGGGCCGACGAGGGGG + Intronic
1117065089 14:52005507-52005529 AGAGCAGGGGTGGGACAGGGTGG + Exonic
1117582035 14:57161123-57161145 AGAGCATGGGGCAGAGAGGGAGG - Intergenic
1119415036 14:74464275-74464297 CCAGCATGGGCGCATCAGGGAGG - Intergenic
1120953108 14:90060707-90060729 CAAGGAGGCGGGCGACAGGGTGG + Intergenic
1122298487 14:100718724-100718746 AGAGGATGGGGGTGACAGGCAGG + Intergenic
1122713759 14:103680704-103680726 ACAGGATGCGGGCGACAGGGAGG - Intronic
1128157782 15:65402519-65402541 TGGGCAGGGGGGCCACAGGGAGG + Intronic
1129239086 15:74241119-74241141 GGAGCATGGGGGAGAGAAGGAGG + Intronic
1129273056 15:74429423-74429445 GGAGCATGGAGGTGGCAGGGTGG - Intronic
1129356625 15:74996053-74996075 CGGGGATGGGGGCGACTGGAAGG + Intronic
1129698805 15:77755793-77755815 GGAGTGTGGGGGAGACAGGGAGG - Intronic
1129872888 15:78952328-78952350 GGACCCTGGGGGCGGCAGGGAGG - Intergenic
1129875344 15:78971781-78971803 CGGGTATGGAGGGGACAGGGTGG + Intronic
1135622409 16:23967354-23967376 CACCCATGGGGGCGATAGGGTGG + Intronic
1136403204 16:30029511-30029533 CCAGCCTGGGGGAGAGAGGGAGG + Exonic
1136913112 16:34159956-34159978 CGAGGATGGGCGCGGCAGGGCGG - Intergenic
1137929804 16:52576147-52576169 CATGCATGGGGGCAACAGTGAGG - Intergenic
1138431158 16:56970011-56970033 CAGGAATGGGGGCCACAGGGTGG - Intronic
1139443195 16:66979365-66979387 CCAGCTTGGGGGCAGCAGGGAGG - Intergenic
1139711885 16:68782202-68782224 CGTGGACGGGGGCCACAGGGAGG + Intronic
1139939145 16:70592044-70592066 GGGGCATGGGGGCGGCGGGGAGG + Intronic
1140985223 16:80152396-80152418 CGAGCTTGGGGGAGGCAAGGAGG - Intergenic
1141240259 16:82259317-82259339 TGAGCAAGGGGGCAAGAGGGGGG + Intergenic
1142668323 17:1475028-1475050 TGTGCCTGGGGGTGACAGGGAGG + Exonic
1142763505 17:2054156-2054178 CGAGCAGCGGCGCGACAGTGCGG + Intronic
1143223813 17:5282920-5282942 CAAGGATTGGGGCGGCAGGGAGG - Intronic
1143390171 17:6555612-6555634 CCAGCATGGGCGCAGCAGGGGGG + Intronic
1143513633 17:7408554-7408576 CGGGCAGGCGGGCGGCAGGGTGG - Exonic
1146469631 17:33113535-33113557 ACAGCATGGAGGCCACAGGGAGG + Intronic
1147847709 17:43416701-43416723 CCAGCATGGGGGGCACAGGCAGG - Intergenic
1148744203 17:49909471-49909493 CCAGCAAGGGGGCTCCAGGGTGG - Intergenic
1149614657 17:57988036-57988058 GGGGCACGGGGGGGACAGGGGGG - Intronic
1152337061 17:79704788-79704810 GGAGCAAGAGGGCGAGAGGGAGG + Intergenic
1152352658 17:79792012-79792034 CGAGGATGGGGGCGGGAGGACGG + Intergenic
1153942008 18:9986605-9986627 GGAGCATGTGGGGGACAGGGAGG + Intergenic
1154347200 18:13551962-13551984 GGAGCAAGAGGGTGACAGGGAGG + Intronic
1157478986 18:48040705-48040727 GGAGCCTGGGGGGGACGGGGGGG - Exonic
1157576631 18:48748176-48748198 AGAGCATAGGGGCGAGACGGGGG + Intronic
1160882604 19:1328373-1328395 TCAGCATGGGGGTGAAAGGGCGG - Intergenic
1161431283 19:4233691-4233713 TGAGCAAGGGGGAGACAGGGAGG - Intronic
1161564391 19:4992077-4992099 AGGGCCTGGGGGCGACAGAGTGG + Intronic
1161644506 19:5444729-5444751 GGAGCAAGGGGGAGACAGGGAGG - Intergenic
1161664215 19:5565147-5565169 GGAGCAAGGGGGAGAGAGGGAGG - Intergenic
1161760578 19:6168162-6168184 TGAGCAAGGGGGAGAGAGGGAGG - Intronic
1162065596 19:8123611-8123633 TGAGCTTGGGGACGTCAGGGTGG - Intronic
1162085616 19:8247258-8247280 TGAGCAAGGGGGAGAGAGGGAGG - Intronic
1162463484 19:10827124-10827146 TGAGAATGGGAGCAACAGGGTGG - Intronic
1163682275 19:18690000-18690022 GGAGCAAGGGGGTGACAGAGCGG + Intronic
1163812736 19:19444128-19444150 TGAGCAGGGAGGCGACAGGAAGG - Intronic
1164683028 19:30148543-30148565 CCAGCATGGGTGAGGCAGGGTGG - Intergenic
1165735121 19:38170827-38170849 CAAGGATGAGGGGGACAGGGAGG + Intronic
1167674733 19:50877313-50877335 CCAGCATGGGGGCTGCAGGAGGG - Intronic
1168072076 19:53958981-53959003 AGAGGATGGGGGAGAGAGGGGGG - Intergenic
1168226120 19:54996654-54996676 CGGGCATGAGTGAGACAGGGAGG - Intronic
925609902 2:5693707-5693729 CGAGGACGCGGGCGACAGCGCGG - Exonic
925973195 2:9122115-9122137 GGACCATGGGGGCAACAGGGAGG + Intergenic
927452625 2:23222109-23222131 CCAGCATGGTGGCCTCAGGGTGG + Intergenic
928953813 2:36840341-36840363 AGAGCATGGTGGGGACAGGAAGG - Intergenic
929952805 2:46429108-46429130 GAAGCATGGCGGCGGCAGGGAGG + Intergenic
934714649 2:96536688-96536710 CGAGCAGGGGCGGGACGGGGCGG + Intergenic
937974342 2:127572982-127573004 CCATCATGGGGGCGACTGGTTGG - Intronic
938537074 2:132256247-132256269 CGAGATTGGGCGCGGCAGGGCGG + Intronic
948524213 2:238560310-238560332 CCAGCATGGGAGGGACTGGGAGG + Intergenic
1169005317 20:2202199-2202221 TAAGCATGGGGGCGTCAGAGTGG + Intergenic
1170835214 20:19878202-19878224 GGAGCATGGGTGAGGCAGGGAGG - Intergenic
1171170964 20:23015084-23015106 AGAGCCTGGGGGTGGCAGGGAGG + Intergenic
1172020367 20:31909636-31909658 AGAGCATGGAGGCTGCAGGGTGG + Intronic
1172644416 20:36461201-36461223 CGAGCATGGGGGGGTGGGGGTGG - Intronic
1173182270 20:40814365-40814387 CGGGGATGGGGGCGGCAGGGTGG + Intergenic
1173946045 20:46951756-46951778 AGAGGATGGGGGCGAGAGTGTGG + Intronic
1175383298 20:58578181-58578203 AGAGCATGGGGGAGGCAGGATGG - Intergenic
1176081369 20:63274973-63274995 GAGGCATGGGGGCGACAGTGTGG - Intronic
1178691581 21:34754526-34754548 CGAGGGTGGGGGCCGCAGGGCGG - Intergenic
1180342539 22:11629472-11629494 CGAGGATGGGTGCGGCAGGGCGG - Intergenic
1180727981 22:17960674-17960696 GGACCATGGGGGTGAGAGGGTGG + Intronic
1180728144 22:17961492-17961514 GGACCATGGGGGTGAGAGGGTGG - Intronic
1182880050 22:33725292-33725314 GGAGCACAGAGGCGACAGGGTGG + Intronic
1185172731 22:49303200-49303222 CGGGCCTGGGGGCTGCAGGGTGG + Intergenic
950692576 3:14671928-14671950 CGAGCATGGGGGCGACAGGGAGG - Exonic
951310916 3:21125157-21125179 CGAGCATGGTGAGGAGAGGGGGG + Intergenic
955003852 3:54951594-54951616 AGAGCCTGGGAGCCACAGGGCGG + Intronic
955229919 3:57089578-57089600 AGAGCATGGGGGTCACAGGAGGG + Intergenic
961402662 3:126658079-126658101 CGTGCATGGGGGGGCCAGGCTGG + Intergenic
962635332 3:137325547-137325569 GAAGCATGGGGGCTTCAGGGAGG + Intergenic
965477339 3:169173385-169173407 CCAGCATTGGGGAGAGAGGGAGG - Intronic
966683818 3:182671999-182672021 AGAGATTGTGGGCGACAGGGAGG - Intergenic
969480742 4:7445619-7445641 CCAGGATGGGGGCTGCAGGGAGG + Intronic
969496278 4:7528077-7528099 CTATCATGGGGGTGACAGGCTGG - Intronic
969616502 4:8255961-8255983 GGAGCAGGGGGAGGACAGGGAGG - Intergenic
969732159 4:8963849-8963871 CGAGCATGGGGACGCCGCGGAGG + Intergenic
969791755 4:9497934-9497956 CGAGCATGGGGACGGCGCGGAGG + Intergenic
985663601 5:1169772-1169794 CGAGCACGGGGGCTCCTGGGGGG + Intergenic
992766164 5:80002507-80002529 AGAGCATGGGGGTCACTGGGAGG - Intronic
993083476 5:83332851-83332873 AGAGCATGGAGGAGACAGGCAGG + Intronic
993613668 5:90084546-90084568 TGAGCCTGGGGGTGACATGGTGG + Intergenic
997521459 5:134526625-134526647 CGGGAGAGGGGGCGACAGGGCGG - Intronic
1001706254 5:173743252-173743274 CGGGCATGGGGGTCACAGGATGG - Intergenic
1004335850 6:14763804-14763826 CCAGCCTGTGGGAGACAGGGTGG - Intergenic
1005962540 6:30704283-30704305 TGAGCTTGGGGGTGACAGGCTGG + Exonic
1006144212 6:31948583-31948605 CTACCTTGAGGGCGACAGGGAGG + Intronic
1007371040 6:41427417-41427439 TGAGAATGGGGGCTAAAGGGAGG + Intergenic
1007494711 6:42251969-42251991 CAAGCATGGGGGAGTCAGGGTGG - Intronic
1018977421 6:168575938-168575960 CCAGCATGTGGCCGACAGGCAGG - Intronic
1019353679 7:568135-568157 CGAGCATGGGTGAGACTGTGAGG - Intronic
1019513671 7:1430396-1430418 TGAGCAGGGGAGGGACAGGGAGG - Intronic
1020309123 7:6855596-6855618 CGAGCATGGGGACGGCGCGGAGG - Intergenic
1022411754 7:30144087-30144109 GGAGGATGGGGGAGACAGAGGGG - Intronic
1022942940 7:35257085-35257107 AGAGCATTGGGGCCACAGGAGGG + Intergenic
1024852007 7:53729793-53729815 CCAGCCTGGGGGACACAGGGAGG - Intergenic
1025759765 7:64378896-64378918 CGAGCATGTGGGCCTCAGAGAGG + Intergenic
1029547456 7:101217697-101217719 AGAGGCTGGCGGCGACAGGGAGG + Exonic
1033220061 7:139521976-139521998 GGTGCATGGGGGCTACAAGGAGG + Intergenic
1034270251 7:149800200-149800222 GGAGCTTGGGGGCTTCAGGGAGG + Intergenic
1034392897 7:150800349-150800371 CGAGCAGGGGAGCGACGGGAGGG + Intronic
1035602644 8:905800-905822 CGTGCTTGGGGGCGGGAGGGTGG - Intergenic
1049213351 8:141396679-141396701 TGGGGATGGGGGCTACAGGGTGG + Intronic
1049422031 8:142521300-142521322 CGAGCGTAGGGGTGAGAGGGTGG - Intronic
1049763855 8:144343845-144343867 GGAGCATGGGGGCTAGGGGGTGG - Intergenic
1051414880 9:16828983-16829005 TGAGCAGGGGGGCGGCGGGGTGG + Intronic
1053291469 9:36882232-36882254 AGAGCGTGTGAGCGACAGGGGGG - Intronic
1056543533 9:87594599-87594621 AGAGCATGGTGGTGACAGGAAGG - Intronic
1057858975 9:98624810-98624832 CGAGCCCGGGGCAGACAGGGAGG + Intronic
1059145554 9:111896692-111896714 CGGGCGCGCGGGCGACAGGGTGG + Intergenic
1061589237 9:131588136-131588158 GGAGCGTGGAGGCTACAGGGCGG + Intronic
1062380967 9:136286292-136286314 CGAGCGTGGGGGCGGCAGGTAGG + Exonic
1062463729 9:136672323-136672345 GGGGCATGGGGGCTGCAGGGCGG - Exonic
1062499525 9:136846285-136846307 CGAGCGTGGCGGCGCCAGCGCGG - Exonic
1185779192 X:2830043-2830065 CAGGCCTGGGGGCGACAGCGTGG - Exonic
1186509140 X:10117435-10117457 CGAGCTTGGGGGCGACAGCGAGG - Exonic
1186521775 X:10212657-10212679 CGACCATGGGTGGGGCAGGGAGG + Intronic
1187177405 X:16909016-16909038 GCAGCATGGGGACGAAAGGGGGG - Intergenic
1190750791 X:53359785-53359807 TGAGCATGGGGGAGATAAGGAGG - Intergenic
1192561723 X:72131810-72131832 GGAGGATGCGGGCGACACGGTGG + Exonic
1195248337 X:103017460-103017482 AGAGGATGGGGGTGACAGAGTGG - Intergenic
1196915399 X:120529188-120529210 AGAGCATGAGGGTGAGAGGGTGG + Intronic
1201290854 Y:12420450-12420472 CAGGCCTGGGGGCGACAGCGTGG + Intergenic