ID: 950698995

View in Genome Browser
Species Human (GRCh38)
Location 3:14727128-14727150
Sequence CTGGACATTCAGACTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950698995_950699006 30 Left 950698995 3:14727128-14727150 CCATCTTCAGTCTGAATGTCCAG 0: 1
1: 1
2: 0
3: 7
4: 209
Right 950699006 3:14727181-14727203 TTTTAGGTCCCACTGGGCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 130
950698995_950699001 23 Left 950698995 3:14727128-14727150 CCATCTTCAGTCTGAATGTCCAG 0: 1
1: 1
2: 0
3: 7
4: 209
Right 950699001 3:14727174-14727196 TTCCCCATTTTAGGTCCCACTGG 0: 1
1: 0
2: 0
3: 7
4: 103
950698995_950699002 24 Left 950698995 3:14727128-14727150 CCATCTTCAGTCTGAATGTCCAG 0: 1
1: 1
2: 0
3: 7
4: 209
Right 950699002 3:14727175-14727197 TCCCCATTTTAGGTCCCACTGGG 0: 1
1: 0
2: 0
3: 9
4: 84
950698995_950699000 14 Left 950698995 3:14727128-14727150 CCATCTTCAGTCTGAATGTCCAG 0: 1
1: 1
2: 0
3: 7
4: 209
Right 950699000 3:14727165-14727187 CAGAGATATTTCCCCATTTTAGG 0: 1
1: 0
2: 1
3: 18
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950698995 Original CRISPR CTGGACATTCAGACTGAAGA TGG (reversed) Intronic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901364158 1:8731199-8731221 CTGGAGGTCCAGACTTAAGAGGG + Intronic
903030674 1:20462188-20462210 CTGGACATTCTGAATAAGGAAGG + Intergenic
903851709 1:26310993-26311015 GTGGATATTCAGTCTGATGATGG + Intronic
904208251 1:28869036-28869058 CTGCAGATCCAGACTGAAGCCGG + Intergenic
906724419 1:48033611-48033633 CTAGACAGTCAGACTGAGAATGG - Intergenic
908894496 1:68883098-68883120 CTGGATATAAAGACTGGAGAAGG + Intergenic
912935798 1:114002834-114002856 GTGGACATTCAGAATGAATCTGG - Intergenic
913008641 1:114660456-114660478 CTGGACATTCAGAAGAAAGCAGG + Intronic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
914438756 1:147682481-147682503 CTGGACATGCTGACTGGTGAAGG + Intergenic
914840759 1:151246678-151246700 CTGGAGATTGAAACAGAAGAGGG + Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
916033065 1:160895190-160895212 CTGGACCTTCAGAGTTATGATGG + Intergenic
918370282 1:183854054-183854076 CTAGACATTCAGCATGAAGAAGG - Intronic
918386423 1:184012929-184012951 CTGGAGATTCAAAAAGAAGAGGG + Intronic
920045537 1:203129931-203129953 CTGGACACCCACACTGAGGACGG - Intronic
922244600 1:223783263-223783285 CTGGATATCCAGGCTGCAGAAGG - Intronic
922350148 1:224728546-224728568 CTGGACTTTGAGAATAAAGAAGG + Intronic
923859418 1:237878053-237878075 CTGAATATTCTGAGTGAAGATGG + Exonic
1064574353 10:16729443-16729465 CTGGCCACTCAGGCTGAAAAGGG + Intronic
1066349286 10:34622310-34622332 CTGAATTTTCAGACTGAAGCTGG + Intronic
1066552211 10:36571563-36571585 CTGGGCTTTCATACTGCAGAAGG - Intergenic
1067787699 10:49262653-49262675 TTGGACATTCACACTGAGGATGG + Intergenic
1069707747 10:70469282-70469304 CTGGAGATTCTGGCTGAGGAGGG + Intergenic
1071822424 10:89291964-89291986 CTGGAAATTGAGAGTAAAGAGGG - Intronic
1072188209 10:93061529-93061551 ATGGGCATTGAGACTGAGGAGGG - Intronic
1072382634 10:94891059-94891081 CTGTAGATTCTCACTGAAGAGGG - Intergenic
1074407843 10:113194820-113194842 CTAGACATTGAGAGTGAAAATGG - Intergenic
1074538935 10:114349064-114349086 CTGGACAGTAAGAGTGCAGAAGG + Intronic
1075631233 10:124001758-124001780 CTGGTCACTGCGACTGAAGATGG + Intergenic
1075804722 10:125178242-125178264 CTGGTGTCTCAGACTGAAGAGGG + Intergenic
1076228790 10:128802826-128802848 CAGGACATTCATCCTGGAGAAGG + Intergenic
1078361005 11:10667553-10667575 CTGGACATGTAGAATGAATAGGG - Intronic
1079619428 11:22535170-22535192 CTGGACACTGAGAGAGAAGAAGG - Intergenic
1079693816 11:23453623-23453645 AAGCACATTCAAACTGAAGAGGG + Intergenic
1082567304 11:54696303-54696325 CAGGACAATCAGACAGGAGAAGG - Intergenic
1083688043 11:64389040-64389062 CTGGACATGCAGGTTGCAGAGGG + Intergenic
1084115436 11:67040335-67040357 CTGAAGCTTCAGACTGTAGAGGG + Intronic
1085005385 11:73083721-73083743 TAGGACATTCAGTCAGAAGAAGG - Exonic
1085351964 11:75803354-75803376 CAGCACTTTGAGACTGAAGATGG + Intergenic
1085417793 11:76330772-76330794 CTGGACCTGAAGAATGAAGAGGG - Intergenic
1086945171 11:92837536-92837558 CTGGAAAATCAAACTAAAGATGG + Intronic
1088556934 11:111071306-111071328 ATGGACATACAGAGAGAAGATGG + Intergenic
1088759207 11:112913253-112913275 CTGCAGATTCAGGCTGCAGATGG + Intergenic
1095562895 12:43586677-43586699 CTGGAGATACATACTGAAGCAGG + Intergenic
1097423112 12:59406044-59406066 ATTGGCATTCATACTGAAGAGGG + Intergenic
1097734335 12:63165461-63165483 CTGTACTATAAGACTGAAGAAGG - Intergenic
1100867040 12:98868146-98868168 CTGGACACTCAGAGTCTAGAAGG + Intronic
1101474481 12:105031710-105031732 CTGTCCATTCCAACTGAAGAAGG + Intronic
1101483725 12:105129731-105129753 AGGGACATTCAGAATGAAGAGGG + Intronic
1102806039 12:115781932-115781954 CTGAAGATTCAGACATAAGAGGG - Intergenic
1103024387 12:117561936-117561958 CTGGAGATTCACAATGAACAAGG + Intronic
1105458382 13:20561876-20561898 CTGGACACTGAAACTCAAGAAGG - Intergenic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1107136752 13:36953269-36953291 CTGGAGATTTAGACTGGAAATGG - Intronic
1107598883 13:41992325-41992347 CTGGATATTGAGACTCAGGAAGG - Intergenic
1107749044 13:43544839-43544861 CAGAACATTTAGGCTGAAGAGGG + Intronic
1108238285 13:48432241-48432263 CTGGAAATACAGATTGGAGAAGG - Intronic
1109985782 13:69982886-69982908 AAGGACATTCAAACTGAAAAGGG + Intronic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111372553 13:87336026-87336048 CTGGAGATCCATACTGAGGATGG - Intergenic
1111959529 13:94794721-94794743 CTGGACCCTCACACTGATGATGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1114653885 14:24304346-24304368 CTGTACCTTCAGACTCAAAAAGG + Intronic
1117420642 14:55541585-55541607 CTGGTCAACCAGACTGAAGCAGG + Intergenic
1118629301 14:67688168-67688190 CTGAACCCTCAGACTGAATAAGG + Intronic
1119760696 14:77148855-77148877 CTGGGCCTCAAGACTGAAGATGG + Intronic
1123462055 15:20482098-20482120 CTTGACACTGAAACTGAAGAGGG + Intergenic
1123656001 15:22518274-22518296 CTTGACACTGAAACTGAAGAGGG - Intergenic
1124309910 15:28613455-28613477 CTTGACACTGAAACTGAAGAGGG - Intergenic
1125328629 15:38562342-38562364 CTGGACCTCCACACTGTAGAAGG - Intronic
1129025116 15:72564626-72564648 CTGAACATTAAGACAGAAAATGG - Intronic
1129573213 15:76712932-76712954 CAGGGCAGTCAGACTGGAGAAGG - Intronic
1130521222 15:84662028-84662050 CTTTACTTTCAGAGTGAAGAAGG + Intergenic
1131268807 15:90934412-90934434 CTGGAGAATCAGACAGACGAGGG - Intronic
1137321618 16:47389141-47389163 CGGGACAGTCAGACCGAAAAAGG - Intronic
1139095945 16:63704660-63704682 CCGGAGATTCAAACTAAAGAGGG - Intergenic
1148512472 17:48184071-48184093 TTGGTCATTCAGCATGAAGATGG + Intronic
1148811676 17:50296926-50296948 CTGGGCATTCAGGCCCAAGAAGG - Intergenic
1153725567 18:7950847-7950869 CTGGATATTCTGACTCAATATGG - Intronic
1158521366 18:58174113-58174135 CTGGACATTGAGGGTGAGGAGGG + Intronic
1159431393 18:68357466-68357488 AGAGACATACAGACTGAAGATGG - Intergenic
1165279618 19:34785047-34785069 CTGGACCGTCAGACTCAACATGG + Intergenic
1167764704 19:51473842-51473864 CTGAACAATCAGGATGAAGATGG - Intergenic
926516008 2:13847323-13847345 ATAGACATTCATATTGAAGATGG - Intergenic
927874827 2:26648304-26648326 CTTGACATTCAGAGAGCAGAGGG + Intergenic
928090924 2:28374704-28374726 CTGCCCAACCAGACTGAAGATGG + Intergenic
928676435 2:33655772-33655794 AGAGACATACAGACTGAAGATGG - Intergenic
929350116 2:40940481-40940503 CTGGACTTTTAGCCTGAAGAAGG - Intergenic
930729682 2:54715982-54716004 CTGGACACTCCGTCTGAAAATGG + Intergenic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
931076692 2:58723197-58723219 TTGTACATTCAAACTGAAGCTGG - Intergenic
931829604 2:66037121-66037143 ATGGCCATTAAAACTGAAGAAGG + Intergenic
932832978 2:75008488-75008510 AAGGACATTCAGGGTGAAGATGG - Intergenic
933276133 2:80286248-80286270 CTGGACATGCAGACTCCATAGGG - Intronic
935051357 2:99527730-99527752 CTAGACATTAAGAATGCAGAAGG + Intergenic
935377147 2:102411177-102411199 CGTGGCCTTCAGACTGAAGAAGG - Intergenic
935677733 2:105610057-105610079 GTGAACATTCTGACAGAAGAGGG + Intergenic
937144847 2:119635797-119635819 CTGGTCATTCAGTCTGGAGGAGG + Intronic
939807926 2:146796314-146796336 CTGGACATTAAGACAGAGGTAGG + Intergenic
939839007 2:147164831-147164853 CTGGACATTAGCAGTGAAGATGG + Intergenic
940014198 2:149086389-149086411 CTGCTCTTCCAGACTGAAGAAGG + Intronic
940257951 2:151751220-151751242 AAGGATATTCAGACTAAAGAAGG - Intergenic
942753280 2:179312439-179312461 CTGAACATTGAAGCTGAAGATGG + Intergenic
943203350 2:184859743-184859765 CTGGACAGACTGACTGAAGTAGG - Intronic
945501850 2:210585559-210585581 ATGGCCATTCACACTGAAGAAGG - Intronic
948286525 2:236790178-236790200 CTGGAAATCCAAAATGAAGATGG - Intergenic
948549592 2:238761327-238761349 CTGGAGATTAAACCTGAAGAAGG + Intergenic
1169456470 20:5756887-5756909 AGGGACATTCAGATTGGAGAGGG - Intronic
1170882892 20:20313085-20313107 CTGGACATACAGTCTTTAGAAGG + Intronic
1171306883 20:24114261-24114283 CAGGCCTTTCAGACTGGAGAAGG - Intergenic
1172473009 20:35214803-35214825 CTGGACATTGAGACTGAGTCGGG + Intergenic
1172883230 20:38215095-38215117 CTGGACACACAGACAGATGATGG - Intronic
1173228858 20:41178638-41178660 CTGGAGATTCAGCCCCAAGAGGG + Exonic
1173656909 20:44705747-44705769 CTGGATATCCTGACTGATGAAGG + Intergenic
1179097861 21:38331553-38331575 CTGGACAGTGAGCCTGTAGAGGG + Intergenic
1179810598 21:43866718-43866740 ATTGACATTCAGACAGAACAGGG + Intronic
1184003850 22:41694655-41694677 GTGGAAATTCAGATGGAAGAGGG + Exonic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
949878734 3:8645081-8645103 CTAGAGAGTCAGACTGATGAGGG - Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
950698995 3:14727128-14727150 CTGGACATTCAGACTGAAGATGG - Intronic
950771115 3:15311968-15311990 CTGGACTACAAGACTGAAGATGG - Intronic
950931125 3:16789771-16789793 CTGGACATTGAGCCTGCAGAGGG + Intergenic
952287607 3:31983217-31983239 ATTGACATACAGACTGAAGGTGG + Intronic
954386925 3:50249026-50249048 CTGGCCACTGAGAGTGAAGAGGG - Intronic
954986079 3:54793377-54793399 CTGGGCATTTAGACAGAAGTTGG - Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956173376 3:66450770-66450792 CAGGAAATTCAGTGTGAAGAGGG + Intronic
957389535 3:79546017-79546039 CATGATATTCATACTGAAGAGGG - Intronic
958006364 3:87816703-87816725 ATGCTCATTCAGACTGAAGGTGG - Intergenic
959904444 3:111694831-111694853 GTGGACATTCATGCTGAAGGAGG + Intronic
965761618 3:172083684-172083706 CTGGATAATTAGAGTGAAGATGG + Intronic
966538377 3:181061071-181061093 GTGGACTTTCAGTATGAAGAAGG + Intergenic
966609012 3:181849913-181849935 TTTGACATCCAGGCTGAAGAAGG - Intergenic
966631827 3:182084624-182084646 CTTGATATTCATTCTGAAGAGGG + Intergenic
966923968 3:184632745-184632767 CTTGCCCTTCAGACAGAAGAAGG + Intronic
967522662 3:190452646-190452668 CTGGAAAGTCAAGCTGAAGATGG + Intergenic
968051248 3:195656479-195656501 CAGTACATGCAGACTGAAGGAGG + Intergenic
968104576 3:195991860-195991882 CAGTACATGCAGACTGAAGGAGG - Intergenic
968302867 3:197629443-197629465 CAGTACATGCAGACTGAAGGAGG - Intergenic
970687075 4:18580636-18580658 TTGGCTATTCAGGCTGAAGAAGG + Intergenic
971231722 4:24805544-24805566 CTAGACATTCAGACTCTAAAAGG - Intergenic
971768952 4:30871390-30871412 CTGTGCATCCAGCCTGAAGAAGG + Intronic
972121642 4:35710954-35710976 CTGGACACTTAGACCAAAGAGGG - Intergenic
973996463 4:56464117-56464139 CTGGGCCTTCAGCCTGCAGAAGG + Intergenic
976682544 4:87773218-87773240 CAGGACAATCAGACAGGAGAAGG + Intergenic
979810032 4:125025820-125025842 CTGGACATTGAAGGTGAAGAGGG + Intergenic
980418945 4:132533948-132533970 CTTGACATTCAGCCTGGGGATGG - Intergenic
984559049 4:181246819-181246841 ATGGGCATTCTGACTGAATAGGG + Intergenic
986122907 5:4858547-4858569 CGAGAGATTCAGGCTGAAGATGG + Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986726439 5:10601561-10601583 CAGGACATTCAGTCTGGGGAAGG - Intronic
987699070 5:21371747-21371769 ATGGACATTCAGTCCAAAGATGG - Intergenic
988478952 5:31613444-31613466 CTGAACTTACAGACTGAATAAGG - Intergenic
988753584 5:34219730-34219752 ATGGACATTCAGTCCAAAGATGG + Intergenic
990340794 5:54821100-54821122 CTGGACTTTAAGACTGGATAGGG + Intergenic
991513856 5:67412070-67412092 CTTGAAACTCAGAATGAAGATGG + Intergenic
991741368 5:69680580-69680602 ATGGACATTCAGTCCAAAGATGG + Intergenic
991756250 5:69873861-69873883 ATGGACATTCAGTCCAAAGATGG - Intergenic
991792942 5:70260317-70260339 ATGGACATTCAGTCCAAAGATGG + Intergenic
991820827 5:70556654-70556676 ATGGACATTCAGTCCAAAGATGG + Intergenic
991835653 5:70749775-70749797 ATGGACATTCAGTCCAAAGATGG - Intergenic
991885391 5:71260625-71260647 ATGGACATTCAGTCCAAAGATGG + Intergenic
992162412 5:74016139-74016161 GTGGAGTTTCAGACTGAGGAGGG - Intergenic
1000136566 5:158358367-158358389 CTTTACATTCAAATTGAAGAAGG + Intergenic
1001554165 5:172624982-172625004 CGGGAAATTTAGACTGCAGAGGG + Intergenic
1004461066 6:15836670-15836692 CTGGACATTGTCACTGAAAATGG + Intergenic
1004748367 6:18535836-18535858 CATGACATACAGACAGAAGAAGG + Intergenic
1005551752 6:26926551-26926573 ATGGACATTCAGTCCAAAGATGG + Intergenic
1007193086 6:40036604-40036626 CTGGACACTCAGACTTGAGGTGG - Intergenic
1007848186 6:44778456-44778478 TTGAACATTTAGAATGAAGAGGG + Intergenic
1009969228 6:70609102-70609124 CTGGACCTTCAGAGTTATGATGG - Intergenic
1011096068 6:83664540-83664562 TTGGACATGGAGCCTGAAGATGG + Intronic
1012215789 6:96581903-96581925 CTGGAGATTGAGTCTGTAGATGG - Intronic
1013657042 6:112256805-112256827 CTGGGCAGGCAGACAGAAGAGGG - Intergenic
1018788516 6:167128012-167128034 CTGGAGTTGCAGACAGAAGAGGG - Intronic
1021190453 7:17613677-17613699 CTGAATATGCAGGCTGAAGAAGG - Intergenic
1021517463 7:21503989-21504011 GGGGTCACTCAGACTGAAGATGG - Intronic
1022328400 7:29354577-29354599 CTTGACGTTCAGGCTGATGATGG + Intronic
1022531589 7:31070206-31070228 CTGGGCAGGCAGACTGCAGAAGG - Intronic
1022618612 7:31958481-31958503 CTGGATATTCAGATTGCAAAAGG - Intronic
1027361297 7:77413280-77413302 CTGGCCATTTTGACTGAACATGG - Intronic
1027800901 7:82747740-82747762 CTGGTCATCCAGTCTGAGGAAGG + Intergenic
1029747384 7:102523937-102523959 CTGAACACCCAGACTGAAGTAGG + Intergenic
1029765337 7:102623027-102623049 CTGAACACCCAGACTGAAGTAGG + Intronic
1031660061 7:124412688-124412710 ATGAACACTCATACTGAAGAGGG - Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032709732 7:134451270-134451292 CTGGAGATTCAGTTTGCAGATGG + Intronic
1033538359 7:142332629-142332651 CTGGAACTTCAGAGTGGAGATGG - Intergenic
1033551967 7:142455563-142455585 CTGGATCTTCAGAGTGGAGACGG - Intergenic
1035068766 7:156125957-156125979 TTGGAAATTGAGACTGGAGAAGG - Intergenic
1037703555 8:21296580-21296602 CTGGAAATTCAAACTGCAGTGGG + Intergenic
1037706628 8:21321038-21321060 ATGGACAGCAAGACTGAAGATGG - Intergenic
1037776997 8:21842105-21842127 CTGGACATACAGAGATAAGAAGG - Intergenic
1038912531 8:31982533-31982555 CTGCACATTTAGAATTAAGAGGG + Intronic
1039678420 8:39699987-39700009 CTGGACACTCAGAGTGCATAGGG + Intronic
1040883687 8:52236168-52236190 CTGTACATTGACACTGATGAAGG + Intronic
1042662308 8:71168359-71168381 CGGGATATACAGACTGAAGAAGG - Intergenic
1043062468 8:75521955-75521977 CAATACATTCAGACTTAAGATGG + Intronic
1044130477 8:88517537-88517559 CTGGACATGTAGACAGAACAGGG - Intergenic
1045199276 8:99962600-99962622 CTGGCCATTCAGAATGTACAGGG - Intronic
1047929521 8:129712939-129712961 CAACACATTCAGACTGAAGCTGG + Intergenic
1048316899 8:133369501-133369523 CTGGACATTCAGAGAGAACTGGG + Intergenic
1049273141 8:141706716-141706738 CTGGAGATCCTGACTGCAGAAGG - Intergenic
1054936711 9:70696071-70696093 TTGGACAATCAGCTTGAAGAAGG + Intronic
1056499529 9:87194687-87194709 CTGGACTTTCACACTGGAAAGGG + Intergenic
1059302835 9:113329243-113329265 CTGGAGGTTCTGACTGTAGATGG + Intronic
1185634717 X:1543311-1543333 CTGGACATTCAGACGGAAGAGGG + Intergenic
1186207597 X:7216644-7216666 CTGCTCACTCAGACTGAGGATGG + Intergenic
1187295466 X:17995680-17995702 ATGGACAATCAGACTGTAGCAGG - Intergenic
1187485134 X:19695904-19695926 CTTGAGATTCAGGCTAAAGAAGG + Intronic
1187702025 X:21971937-21971959 CTGGACCTTCAGAGTTATGATGG + Exonic
1195129014 X:101836887-101836909 CTTGACACTCACACAGAAGAGGG + Intronic
1199214923 X:145252540-145252562 GTGGATATTGAGACTGATGAAGG + Intronic
1200933129 Y:8715186-8715208 CTGGACTTCCAGATTGAAGGAGG - Intergenic
1201579428 Y:15495315-15495337 CTGCTCACTCAGACTGAGGATGG + Intergenic