ID: 950703630

View in Genome Browser
Species Human (GRCh38)
Location 3:14766885-14766907
Sequence CTCAAAGCCTCCCACAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 335}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950703630_950703638 13 Left 950703630 3:14766885-14766907 CCAGAGCTGTGGGAGGCTTTGAG 0: 1
1: 0
2: 2
3: 30
4: 335
Right 950703638 3:14766921-14766943 CGGCTTTGAGGAGCGTGGCCAGG 0: 1
1: 1
2: 0
3: 19
4: 120
950703630_950703639 26 Left 950703630 3:14766885-14766907 CCAGAGCTGTGGGAGGCTTTGAG 0: 1
1: 0
2: 2
3: 30
4: 335
Right 950703639 3:14766934-14766956 CGTGGCCAGGCAGCTTTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 123
950703630_950703637 8 Left 950703630 3:14766885-14766907 CCAGAGCTGTGGGAGGCTTTGAG 0: 1
1: 0
2: 2
3: 30
4: 335
Right 950703637 3:14766916-14766938 CCAGGCGGCTTTGAGGAGCGTGG 0: 1
1: 0
2: 0
3: 19
4: 145
950703630_950703634 -7 Left 950703630 3:14766885-14766907 CCAGAGCTGTGGGAGGCTTTGAG 0: 1
1: 0
2: 2
3: 30
4: 335
Right 950703634 3:14766901-14766923 CTTTGAGGAGCGTGGCCAGGCGG 0: 1
1: 0
2: 0
3: 17
4: 180
950703630_950703633 -10 Left 950703630 3:14766885-14766907 CCAGAGCTGTGGGAGGCTTTGAG 0: 1
1: 0
2: 2
3: 30
4: 335
Right 950703633 3:14766898-14766920 AGGCTTTGAGGAGCGTGGCCAGG 0: 1
1: 1
2: 1
3: 12
4: 197
950703630_950703635 1 Left 950703630 3:14766885-14766907 CCAGAGCTGTGGGAGGCTTTGAG 0: 1
1: 0
2: 2
3: 30
4: 335
Right 950703635 3:14766909-14766931 AGCGTGGCCAGGCGGCTTTGAGG 0: 1
1: 0
2: 0
3: 17
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950703630 Original CRISPR CTCAAAGCCTCCCACAGCTC TGG (reversed) Intronic
900415347 1:2532133-2532155 CGCCATGGCTCCCACAGCTCTGG + Intergenic
900478369 1:2886793-2886815 CTCCAAGCCTCCCAGCGCCCTGG + Intergenic
901533537 1:9868102-9868124 CTCAGAACCTCCTGCAGCTCAGG + Intronic
901672071 1:10861901-10861923 CCCTGTGCCTCCCACAGCTCTGG + Intergenic
902456167 1:16535401-16535423 CCCAAGTCCTCCCAGAGCTCAGG - Intergenic
902495998 1:16872510-16872532 CCCAAGTCCTCCCAGAGCTCAGG + Intronic
902574494 1:17368849-17368871 GTCTCAGCCTCCCAAAGCTCTGG + Intergenic
902776939 1:18680906-18680928 CCCAAAGCCTCCCAAAGTGCTGG - Intronic
903308979 1:22437667-22437689 CTCTCAGCCTCCCAAAGCGCTGG + Intergenic
903501459 1:23802243-23802265 CTCAAAGCCTCTCACTCCTCAGG + Exonic
904369189 1:30037747-30037769 CACACAGCCTCCCCCAGCCCTGG - Intergenic
904636408 1:31884876-31884898 GTCTTAGCCTCCCAAAGCTCTGG - Intergenic
904820058 1:33236291-33236313 CCCAAAGCCTCCCAAAGTACTGG - Intergenic
906185388 1:43858596-43858618 CTGGGAGCCTCACACAGCTCAGG - Intronic
906616125 1:47234064-47234086 CTCTAAGGGTCCCACAGCCCAGG - Intergenic
907381843 1:54097089-54097111 CCCGAAGCCTCCCACACCTCAGG + Exonic
908217036 1:61964537-61964559 ATCATAGCCTCCCAAAGCTCTGG - Intronic
908221773 1:62014303-62014325 GTCTCAGCCTCCCAAAGCTCTGG + Intronic
908535803 1:65075966-65075988 CTCAAGGCCTTCCAAGGCTCTGG + Intergenic
912527309 1:110293000-110293022 CTGAAAGCCATCCACAGCTGTGG + Intergenic
912607074 1:111002261-111002283 GTCTCAGCCTCCCACAGTTCTGG + Intergenic
915673002 1:157505811-157505833 CTCAGAGCCCCGCACAGCCCAGG + Intergenic
918136218 1:181676128-181676150 GTATAAGCCTCGCACAGCTCTGG - Intronic
919086137 1:192922517-192922539 CTCAAGGTTTCCCACAGCCCAGG + Intergenic
920308523 1:205034168-205034190 CTCACAGCCTCTGCCAGCTCAGG + Intergenic
920590623 1:207215364-207215386 TTCAAAGACTCCTACAGGTCAGG + Intergenic
920975464 1:210781491-210781513 CTCGGAGCCTCCCTCAGCTATGG - Intronic
921179993 1:212624697-212624719 CTCAGAGCCTCCCAGAGGCCGGG - Exonic
921791402 1:219294697-219294719 CTCAAGCCTTCCCACAGCTCAGG + Intergenic
922199102 1:223386208-223386230 CTCAAAGCCACCCACACATGGGG - Intergenic
922241595 1:223758938-223758960 CTCACAGCCTCCCAAAGTGCTGG + Intronic
922562186 1:226577434-226577456 CAGATAGCCTCCCACAGCCCTGG - Intronic
922893189 1:229077372-229077394 CTCAGGGCCTCCAACAGGTCTGG + Intergenic
1062824789 10:559464-559486 CTCAAAGCTCCCCACAGACCTGG + Intronic
1063441899 10:6079492-6079514 CTCACAGCCTCCCAAAGTGCTGG - Intergenic
1065708056 10:28489315-28489337 GGCAGAACCTCCCACAGCTCTGG - Intergenic
1066314700 10:34232949-34232971 GTCTCAGCCTCCCAAAGCTCTGG + Intronic
1067575210 10:47404421-47404443 CTCAAGCCTTCCCCCAGCTCAGG - Intergenic
1067810081 10:49419258-49419280 CACCAAGCCTCCCACAGAGCCGG - Intergenic
1069658417 10:70107361-70107383 CTCAACCCCACACACAGCTCTGG + Intronic
1069752594 10:70753830-70753852 CCCCCAGCTTCCCACAGCTCCGG - Exonic
1069947952 10:72000472-72000494 CTCAAATGCCCCCCCAGCTCTGG - Intronic
1071080716 10:81806705-81806727 ATCAAAGCCTCTTTCAGCTCTGG + Intergenic
1072208193 10:93222740-93222762 CTGAAAGTCACCCATAGCTCAGG - Intergenic
1073385428 10:103123462-103123484 CTCACAGCCTCCCAAAGCACTGG + Intronic
1075234970 10:120719584-120719606 TTCAAAGCCTTCACCAGCTCAGG + Intergenic
1076337837 10:129720439-129720461 CCCCAACCCTCCCACAGCACCGG + Intronic
1076584840 10:131539646-131539668 CGCCAAGCCTCCCACAGCAGTGG + Intergenic
1077206974 11:1349428-1349450 CTCCAAGCCCCCCCCAGCACAGG - Intergenic
1077669567 11:4145352-4145374 TTAAAAGACTTCCACAGCTCTGG - Intergenic
1077996629 11:7458229-7458251 ATCACAGCCTCCCAAAGCGCTGG - Intronic
1078445649 11:11403169-11403191 CTCAAAGCCTCCCACAGGAAGGG + Intronic
1079197119 11:18338696-18338718 ATCTTAGCCTCCCAAAGCTCTGG + Intronic
1081633016 11:44702099-44702121 CCCATGGCCTCCCACAGCCCTGG + Intergenic
1081899312 11:46614484-46614506 ATCTGAGCCTCCCAAAGCTCTGG - Intronic
1083155922 11:60822722-60822744 CCCTCAGCCTCCCAAAGCTCTGG - Intergenic
1083251979 11:61474450-61474472 CTCACAGCCTCCCACAATCCTGG - Intronic
1083829989 11:65225485-65225507 CTCACAGCCTCCCAGAGTTGGGG - Intergenic
1084342348 11:68514314-68514336 GTCAGAGCCTCCCAAAGCTCTGG + Intronic
1084715233 11:70869476-70869498 ATGAAAGCCTCCTACAGCACAGG - Intronic
1085532465 11:77200017-77200039 ATCTCAGCCTCCCAAAGCTCTGG - Intronic
1088199790 11:107319991-107320013 CTGAAAGCCTCCCAAATCTGGGG - Intergenic
1088494077 11:110416329-110416351 GTCTCAGCCTCCCAAAGCTCTGG + Intergenic
1088892188 11:114053671-114053693 CTCAAAGCCCACCACAGCCTTGG + Intergenic
1091689916 12:2588912-2588934 ATGAAAGCCTCCCCCAGCACAGG - Intronic
1091947589 12:4562205-4562227 CTCACAGCCTCCCGCAGCGGCGG + Intronic
1092371116 12:7917166-7917188 CTCTAAGCCTCCCACCCCTCTGG + Intergenic
1092832644 12:12459557-12459579 GTCTCAGCCTCCCAAAGCTCTGG + Intronic
1092834211 12:12472634-12472656 CTAAAAGCCCCTCACTGCTCGGG + Intergenic
1093159034 12:15723072-15723094 CCCTCAGCCTCCCACAGTTCTGG - Intronic
1099468292 12:83014586-83014608 CTCTCAGCCTCCCAAAGTTCTGG + Intronic
1101036808 12:100715599-100715621 CTCCAAGCCTCCCCCAGACCTGG - Intergenic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1102147826 12:110668159-110668181 CTCAGAGCAGCCCCCAGCTCTGG + Intronic
1103294792 12:119877103-119877125 CTCCAGGCCTCCCGCAGCCCTGG + Intronic
1103596146 12:122025246-122025268 GTCTCAGCCTCCCAAAGCTCTGG - Intronic
1103824702 12:123728344-123728366 CTCAAAGCCTCCCAAAGTGTTGG + Intronic
1104469421 12:129017842-129017864 CTCATACCCACCCACAGCCCTGG + Intergenic
1104906281 12:132215139-132215161 CACAAAGCCACCCAGAGCTGCGG - Intronic
1105518236 13:21109519-21109541 CTGAAGGGATCCCACAGCTCAGG - Intergenic
1106184052 13:27392969-27392991 GTCTCAGCCTCCCACAGTTCTGG - Intergenic
1106222389 13:27757308-27757330 ATCTCAGCCTCCCAAAGCTCTGG + Intergenic
1106267695 13:28124810-28124832 CGCAAAGCCTCCCAGAGTGCTGG - Intergenic
1106399247 13:29412638-29412660 GTCTCAGCCTCCCAAAGCTCTGG - Intronic
1107469831 13:40681568-40681590 CTCCAGGCCTCCCACAGTTGGGG + Intergenic
1111782101 13:92741353-92741375 CTCAGAGCCTCCCACGGCAAAGG - Intronic
1112091593 13:96090032-96090054 GCCAAAGCCTCCCCCAGCCCCGG - Intergenic
1112248394 13:97755136-97755158 CTCTGGGCCTCCCAAAGCTCTGG + Intergenic
1113281243 13:108790110-108790132 CGCAGATCCTCCCACAACTCGGG + Intronic
1113448281 13:110387353-110387375 CTCAAGGCCTCCAGCAGCTCAGG - Intronic
1113536512 13:111070844-111070866 CTCACAGGCTCCAACACCTCTGG - Intergenic
1114279551 14:21179084-21179106 CCCACAGCCTCCCACAGTGCTGG + Intergenic
1114717992 14:24848595-24848617 CACAAAGCCACTCCCAGCTCAGG + Intronic
1116373643 14:44169366-44169388 CTCACAGCCTCCCAAAGTGCTGG + Intergenic
1116664977 14:47763016-47763038 CTGAAGGACTCCCAGAGCTCAGG + Intergenic
1118751116 14:68808444-68808466 CTCAGAGCCTCCCACAGGTGGGG + Intergenic
1119148955 14:72340730-72340752 TTCACAGTCTCCCAGAGCTCTGG - Intronic
1120824799 14:88945426-88945448 CTCAATGCCTCCCACACATGTGG - Intergenic
1120849818 14:89159776-89159798 CTAAAAGCCATCCACAGCTATGG - Exonic
1122256628 14:100482907-100482929 CACAAGGGCTCCCACAGCGCAGG - Intronic
1122263392 14:100535612-100535634 CTCCAAGCTTCCCCCGGCTCAGG + Intergenic
1122777849 14:104130618-104130640 CCCCCAGCCTCCCTCAGCTCCGG - Intergenic
1123047919 14:105527458-105527480 CTCCAAGCCTCCCCGCGCTCTGG - Intronic
1123822168 15:24041892-24041914 ATCTCAGCCTCCCAAAGCTCTGG - Intergenic
1124458546 15:29867656-29867678 CCCAAAGCCTCCCAGAGTGCTGG - Intronic
1124605102 15:31163701-31163723 CTCAAAGCCCCTCAGAGCTCAGG + Intergenic
1125513852 15:40307252-40307274 CTCCTAGCCTGCCTCAGCTCTGG + Intronic
1125537247 15:40448759-40448781 CTCCTGGCCTCCCACAGCACAGG + Intronic
1128506557 15:68277371-68277393 CTCAAGCCCTCCCACATTTCGGG + Intergenic
1128677663 15:69623803-69623825 CTCCTAGCCTCCCCCAGCACTGG + Intergenic
1128772420 15:70292185-70292207 CTCCAATCCTCCCACTGCCCTGG - Intergenic
1128918165 15:71586498-71586520 CTCAAAGCATCCCTCAGCTGAGG - Intronic
1129031497 15:72621501-72621523 GTCTAAGCCTCCCAAAGCACTGG + Intergenic
1129042296 15:72699331-72699353 CCCAAAGCCTCCCAAAGTTCTGG + Intronic
1129719645 15:77871181-77871203 CTCAAAACCCCCAACAGCCCTGG + Intergenic
1129751142 15:78065376-78065398 ATCAAAGCCTCTCACAGCCCAGG + Intronic
1131225323 15:90620118-90620140 CCCACAGCCTGCCACAGCTCGGG - Intronic
1131794764 15:96004361-96004383 CTCAATGGATCCCACTGCTCCGG - Intergenic
1132797463 16:1732259-1732281 CCCCAAGCCTCCCACAGCCAGGG + Intronic
1133315406 16:4880510-4880532 CTCAGAGCACCCCACTGCTCAGG + Exonic
1134522331 16:14924479-14924501 CTCACTGCCTCCCACCGCCCCGG + Intronic
1134710001 16:16323130-16323152 CTCACTGCCTCCCACCGCCCCGG + Intergenic
1134717216 16:16363130-16363152 CTCACTGCCTCCCACCGCCCCGG + Intergenic
1134949602 16:18345515-18345537 CTCACTGCCTCCCACCGCCCCGG - Intergenic
1134957535 16:18389029-18389051 CTCACTGCCTCCCACCGCCCCGG - Intergenic
1135304930 16:21359873-21359895 CTCACAGGCTCCCCCACCTCTGG - Intergenic
1135730981 16:24894868-24894890 CTCACAGCCTCCCAAAGTGCGGG - Intronic
1137565746 16:49531513-49531535 GACAGAGTCTCCCACAGCTCAGG - Intronic
1137728644 16:50673776-50673798 CCGAAAGCCTCGCGCAGCTCCGG + Exonic
1138347233 16:56327474-56327496 CTCAGAACCTCCCCCACCTCAGG - Intronic
1139541009 16:67616371-67616393 CTCTTAGCCTCCCAGAGTTCTGG + Intronic
1141742038 16:85899896-85899918 CGTAAAGCCTTTCACAGCTCTGG - Intronic
1142063365 16:88045625-88045647 CTCACAGGCTCCCCCACCTCTGG - Intronic
1142183123 16:88681332-88681354 CTCAAAGCCGCCCGGGGCTCGGG + Exonic
1142687316 17:1585097-1585119 CTTAAAGCCTCCCAAAGTACTGG - Intronic
1142922349 17:3200430-3200452 TTGAAAGGCTCCCACATCTCAGG + Intergenic
1145411703 17:22671275-22671297 CTGTAAGCCTGCCAAAGCTCAGG - Intergenic
1147742794 17:42678302-42678324 CTCAGAGCCTCCCGCAGCAGCGG - Intergenic
1147917069 17:43894687-43894709 CTCTCAGCCTCCCAAAGCACTGG - Intronic
1148468459 17:47878648-47878670 CTCAAAGCCACCGACAGGTATGG - Intergenic
1149657733 17:58319153-58319175 CTCCAAGGCTCCCACAGTCCAGG + Exonic
1150279392 17:63920311-63920333 CTCAAAGCCACCCAAAGTTTGGG - Intergenic
1150656515 17:67043394-67043416 CTCAAGGCCCCACCCAGCTCAGG + Intergenic
1150686648 17:67326454-67326476 CTCATAGCCTCCCAAAGTGCTGG + Intergenic
1151989464 17:77564928-77564950 CTCGAGGCCTCCCACAGTGCTGG - Intergenic
1152574787 17:81135252-81135274 CTCAAAGCCTGGCTCAGCTCAGG - Intronic
1152609370 17:81308123-81308145 CTCAAACCCACCCTCAGCCCAGG + Intergenic
1152615343 17:81335294-81335316 CACACTGCATCCCACAGCTCTGG - Intergenic
1152638176 17:81438720-81438742 CTCAAGACCTCTCACTGCTCAGG + Intronic
1153194180 18:2575378-2575400 AGCAAAGCCTCCCAAAGCGCTGG - Intronic
1154309452 18:13255741-13255763 CTCCAAGCACCCCACAGCCCTGG - Intronic
1155137640 18:23011967-23011989 ATCACAGCCTCCCAAAGTTCTGG - Intronic
1155348799 18:24885653-24885675 CTCAATGCCTCGCACAGGTTTGG - Intergenic
1157465381 18:47939772-47939794 TTCCAGGCCTCCCAAAGCTCTGG - Intergenic
1157807853 18:50671640-50671662 CCCAAAGCCTCCCAAAGCTCTGG - Intronic
1158669761 18:59464181-59464203 CTCTGAGCCTCCCACAGTGCTGG - Intronic
1161853775 19:6752717-6752739 GTCAGGGCCTCCCTCAGCTCCGG + Exonic
1162794098 19:13077886-13077908 CTGAATGCCACCCACACCTCTGG + Intronic
1162896180 19:13765834-13765856 CTCAAAGCCTCTCATTGCTGTGG - Intronic
1163021811 19:14485402-14485424 CTCACAGCCTCCCAAAGTGCTGG - Intronic
1163255978 19:16156102-16156124 CTCTCAGCCTCCCAAAGCACTGG - Intronic
1163340701 19:16704994-16705016 CTCCAAGCCTCCCAAAGTTCTGG - Intergenic
1163676572 19:18658335-18658357 TTCCAGGCCCCCCACAGCTCTGG + Intronic
1163769437 19:19182007-19182029 CTTAAAGCCTCCCTTGGCTCTGG + Intronic
1166611317 19:44200215-44200237 ATCTCAGCCTCCCAAAGCTCTGG - Intergenic
1166760501 19:45221291-45221313 CTCACAGCCTCCCAAAGTGCTGG + Intronic
1166893551 19:46009086-46009108 GTGACAGCCTCCCACAGCACAGG - Intronic
1167351722 19:48979269-48979291 TTAAAATCCTCCCATAGCTCTGG + Intronic
1167702449 19:51057912-51057934 ATCAGAGAATCCCACAGCTCTGG + Intronic
1167992453 19:53371896-53371918 CTCTCAGCCTCCCACAGTGCTGG + Intronic
1202707054 1_KI270713v1_random:31757-31779 CCCAAGTCCTCCCAGAGCTCAGG - Intergenic
924976415 2:179621-179643 CTCTAAACCTCACACAGCACAGG + Intergenic
928176374 2:29036935-29036957 GTCACAGCCACCCACACCTCTGG + Intronic
928693931 2:33829649-33829671 CTCCAAACATCACACAGCTCTGG - Intergenic
928945261 2:36766277-36766299 ATCTCAGCCTCCCAAAGCTCTGG - Intronic
929095511 2:38259817-38259839 CTCTCAGCCTCCCAAAGCACTGG + Intergenic
929305358 2:40355303-40355325 CACAAAGCCTCTCAGTGCTCAGG + Intronic
930326942 2:49932164-49932186 CTCTCAGCCTCCCAAAGCACTGG - Intronic
931093751 2:58916276-58916298 TCCAAAGCTTCCCACAACTCAGG - Intergenic
931141522 2:59463613-59463635 CTCACAGCCTCTCTCAGCCCAGG - Intergenic
934664914 2:96163451-96163473 CCCAGAGCCTCCCAGAGCTTGGG + Intergenic
938459779 2:131490080-131490102 CTCACTGCCACCCAGAGCTCAGG - Intronic
939105975 2:137949240-137949262 ACCTCAGCCTCCCACAGCTCTGG - Intergenic
941819930 2:169834091-169834113 CTAAAAACCTCCCACAACACAGG - Intronic
942360700 2:175168487-175168509 ATCACAGTCTTCCACAGCTCCGG - Intergenic
943770953 2:191716146-191716168 CTCAAACCCACCCACACCACTGG + Intergenic
943935838 2:193915843-193915865 TTCCAAAACTCCCACAGCTCTGG - Intergenic
944273851 2:197813105-197813127 CTCTAAGCCTCCCTTGGCTCAGG + Intronic
946671607 2:222110664-222110686 CTCTAAGCCTCCCTCAGGTGCGG + Intergenic
948391367 2:237613828-237613850 CTCACAGCAGTCCACAGCTCAGG + Intergenic
948566969 2:238893597-238893619 CTCAAAGCCTCCGTGTGCTCAGG + Intronic
948599658 2:239101040-239101062 CCCACAGACTCCGACAGCTCAGG - Intronic
948729414 2:239953580-239953602 CTCCGAACCTCCTACAGCTCTGG + Intronic
948921438 2:241067767-241067789 CTCGAAGCCTTCCACAGGGCGGG - Exonic
949003189 2:241629218-241629240 GTCTCAGCCTCCCAAAGCTCTGG - Intronic
949049219 2:241888342-241888364 CTCAGAGGCAGCCACAGCTCAGG + Intergenic
1169970238 20:11261838-11261860 CTCAAATCCTCCCAAAGCCCTGG - Intergenic
1170404388 20:16020806-16020828 CTCAAAGCCTCGCTCGGCTCTGG + Intronic
1173446743 20:43126098-43126120 CTCACAGCCTCCCAAAGTGCTGG - Intronic
1173934123 20:46846292-46846314 CTCAAAGAGTCCCAAAGCTAAGG + Intergenic
1174114498 20:48217732-48217754 TTCAAAGCCTCTCACGGGTCTGG + Intergenic
1175358780 20:58390465-58390487 CCCAGAGCCTCCCACATCACTGG - Intronic
1175903745 20:62369985-62370007 CTCAGATCCTCCCCCAGCCCTGG + Intergenic
1176091168 20:63319257-63319279 CTGAAGGCCTCCCAGGGCTCTGG - Intronic
1176184196 20:63769249-63769271 GGCACAGCCTCCCCCAGCTCAGG - Intronic
1176991307 21:15500022-15500044 CTCAATGCATTCTACAGCTCTGG - Intergenic
1177468426 21:21521197-21521219 CTCAGATCCTCCCACAGCCTTGG - Intronic
1177697621 21:24593864-24593886 CTCAAGGCCTCCCAAAGTGCTGG + Intergenic
1178095565 21:29211825-29211847 CTCCCATCCCCCCACAGCTCAGG + Intronic
1178313579 21:31550959-31550981 CTCCAAGCCTCCCAAAGTGCTGG - Intronic
1178439473 21:32586665-32586687 CACAAACCCTCACACACCTCAGG - Intronic
1178618629 21:34155116-34155138 CCCACACCCTCCCCCAGCTCAGG - Intergenic
1180898592 22:19355015-19355037 CTCTCAGCCTCCCACAGCGCTGG + Intronic
1181118808 22:20651537-20651559 CTGAAGGCCTCCCAAAGCTGTGG - Intergenic
1181545824 22:23601950-23601972 CTCTCAGCCTCCCACAGTGCTGG - Intergenic
1181545835 22:23601994-23602016 CTCTCAGCCTCCCACAGTGCTGG - Intergenic
1181545846 22:23602038-23602060 CTCTCAGCCTCCCACAGTGCTGG - Intergenic
1181545857 22:23602082-23602104 CTCTCAGCCTCCCACAGTGCTGG - Intergenic
1181545868 22:23602126-23602148 CTCTCAGCCTCCCACAGTGCTGG - Intergenic
1181545879 22:23602170-23602192 CTCTCAGCCTCCCACAGTGCTGG - Intergenic
1181545890 22:23602214-23602236 CTCTCAGCCTCCCACAGTGCTGG - Intergenic
1181545900 22:23602257-23602279 CTCTCAGCCTCCCACAGTGCTGG - Intergenic
1181545911 22:23602301-23602323 CTCTCAGCCTCCCACAGTGCTGG - Intergenic
1181545922 22:23602345-23602367 CTCTCAGCCTCCCACAGTGCTGG - Intergenic
1181545933 22:23602389-23602411 CTCTCAGCCTCCCACAGTGCTGG - Intergenic
1181800580 22:25345456-25345478 CTCTCAGCCTCCCACAGTGCTGG + Intergenic
1181800591 22:25345500-25345522 CTCTCAGCCTCCCACAGTGCTGG + Intergenic
1181800600 22:25345544-25345566 CTCTCAGCCTCCCACAGTGCTGG + Intergenic
1181800621 22:25345632-25345654 CTCTCAGCCTCCCACAGTGCTGG + Intergenic
1181800644 22:25345720-25345742 CTCTCAGCCTCCCACAGTGCTGG + Intergenic
1181800664 22:25345807-25345829 CTCTCAGCCTCCCACAGTGCTGG + Intergenic
1181800675 22:25345851-25345873 CTCTCAGCCTCCCACAGTGCTGG + Intergenic
1181800684 22:25345895-25345917 CTCTCAGCCTCCCACAGTGCTGG + Intergenic
1181800693 22:25345939-25345961 CTCTCAGCCTCCCACAGTGCTGG + Intergenic
1181800714 22:25346027-25346049 CTCTCAGCCTCCCACAGTGCTGG + Intergenic
1182121609 22:27790846-27790868 ATCAAAGTCACCCACAGCCCAGG + Intronic
1183126325 22:35784879-35784901 CTCAAACCCTGCCACCGCCCTGG - Intronic
1184428302 22:44425882-44425904 CTCAAAGGGTCCCACAACTCTGG - Intergenic
1185391762 22:50565436-50565458 CTCAAGACCTCCCAAAGCACAGG + Intergenic
1203296482 22_KI270736v1_random:47378-47400 CTCAAAGCCTCACATGTCTCTGG + Intergenic
950223219 3:11212526-11212548 CTCTGAGGCTCCCACAGCACAGG - Intronic
950703461 3:14766133-14766155 CTCCAAGCCTCACACAGCTCTGG - Intronic
950703630 3:14766885-14766907 CTCAAAGCCTCCCACAGCTCTGG - Intronic
951525788 3:23651340-23651362 CTCCCAGCCTCCCACAGTCCTGG - Intergenic
952178333 3:30891426-30891448 CTTAAAGCCACACACATCTCAGG + Intronic
954684472 3:52362870-52362892 CACCAAGCCTGCCACAGCTGAGG - Intronic
955681732 3:61508499-61508521 ATCTAAGCCTCCCAAAGCACTGG + Intergenic
956555602 3:70519199-70519221 CTCAAAGTCCCGCTCAGCTCTGG - Intergenic
959217629 3:103472922-103472944 GTCTCAGCCTCCCACAGCGCTGG - Intergenic
959505536 3:107152583-107152605 CTCAGAGCCCCCCACAGCCCTGG + Intergenic
960595195 3:119401966-119401988 ATCAAAGCCACCCTCAGCCCCGG - Exonic
960897960 3:122526055-122526077 CACATAGCCTCCTACATCTCAGG + Intergenic
960900473 3:122549529-122549551 ATCTCAGCCTCCCAAAGCTCTGG - Intronic
961662301 3:128475878-128475900 CCCCCAGCCTCCCCCAGCTCTGG + Intergenic
963649323 3:147958064-147958086 CTCCAAGGCACCCACAGCTCTGG - Intergenic
963876677 3:150483675-150483697 CTCTATGCCTCTCACAGCTATGG - Intergenic
965460523 3:168956286-168956308 CGCAAAGCCTCCCCAAGTTCTGG + Intergenic
965807937 3:172561487-172561509 GCCTCAGCCTCCCACAGCTCTGG - Intergenic
968240845 3:197083706-197083728 ACCCCAGCCTCCCACAGCTCTGG - Intronic
968583900 4:1407098-1407120 TCCGAAGGCTCCCACAGCTCTGG + Intergenic
968934024 4:3600594-3600616 CTCACAGCCTCCCAGGGCTGAGG + Intergenic
969800044 4:9556708-9556730 CTCAAAGCCCCCCAAACCTAGGG - Intergenic
969842996 4:9897286-9897308 CTGAGAGCCTCCAACAGCACTGG + Intronic
971712753 4:30137981-30138003 CTCATAGCATACCACAGCTTGGG - Intergenic
972413155 4:38813099-38813121 GCCACAGCCTCCCACAGTTCTGG - Intronic
973208081 4:47582898-47582920 TCCACAGCCTCCCAAAGCTCTGG - Intronic
973294799 4:48506282-48506304 CGCTCAGCCTCCCAAAGCTCTGG - Intronic
975660216 4:76681152-76681174 CTCAAAGCATCAAACAGCACAGG - Intronic
977021530 4:91766462-91766484 CCCAAAGCCTCCCAAAGTGCTGG - Intergenic
981710660 4:147706080-147706102 ATCACAGCCTCCCAAAGCGCTGG - Intergenic
986576087 5:9214286-9214308 CACAAAGGCTTCCAGAGCTCGGG + Intronic
988447210 5:31300869-31300891 CCCTCAGCCTCCCAAAGCTCTGG - Intronic
989307851 5:39978034-39978056 CTCAAAGCTTCCCAAAGTTCGGG + Intergenic
990152504 5:52835218-52835240 CTCAACGCCTAGCACAGTTCTGG - Intronic
990520536 5:56575037-56575059 GTCTGAGCCTCCCAAAGCTCTGG - Intronic
991261496 5:64673486-64673508 CTCAAAGCCTCCCAAAGTGCTGG - Intergenic
997867904 5:137481063-137481085 CTCAGAGCCTCACACAGCCAGGG - Intronic
999399549 5:151253706-151253728 CTCAAACCCTCCCAACTCTCAGG - Intronic
1000625473 5:163533414-163533436 CTCAAAGGTTCCCGCAGCACTGG - Intergenic
1001010770 5:168095933-168095955 CTCAGGGCCTCCCTCAGGTCGGG + Intronic
1001082573 5:168677937-168677959 CTCAAAGCCACTCAAAGCCCTGG - Intronic
1001436802 5:171705511-171705533 CTCCATGCCTCCCACTGCCCTGG - Intergenic
1001958743 5:175866824-175866846 GTCTTAGCCTCCCAAAGCTCTGG - Intronic
1003650169 6:7952036-7952058 CGCTCAGCCTCCCAAAGCTCTGG + Intronic
1004335552 6:14761430-14761452 GTCTAAGCCTCCCTCATCTCTGG - Intergenic
1004723423 6:18289094-18289116 CTCACAGCCTCCCAAAGTGCTGG - Intergenic
1004867731 6:19870518-19870540 CTCAAAGCTTCCCAGATCTATGG - Intergenic
1006385554 6:33728841-33728863 CTCACAGCCTTCCAGGGCTCAGG + Intronic
1007061261 6:38942752-38942774 CTCCAGGCTTCCCACACCTCAGG - Intronic
1009489728 6:64274428-64274450 CTCTCAGCCTCCCACAGTGCTGG + Intronic
1012095755 6:94957186-94957208 CTCTCAGCCTCCCAAAGCACTGG + Intergenic
1013371404 6:109473831-109473853 CTCCCAGCCTCCCAAAGCGCTGG - Intronic
1015066218 6:129032157-129032179 CTCAGAGCCTACCACAGGGCTGG - Intronic
1015323033 6:131897281-131897303 CTACATGCCTCACACAGCTCAGG - Intergenic
1016300324 6:142623391-142623413 CACAATGCCTCCCTGAGCTCTGG - Intergenic
1017337632 6:153280912-153280934 GTCAAGGCCTCCCAGAGCGCTGG + Intergenic
1017965482 6:159261085-159261107 CTCAAAGCCTGTCACGGTTCAGG + Intronic
1019034236 6:169041311-169041333 CTCTCACCCTCTCACAGCTCTGG + Intergenic
1019440547 7:1044296-1044318 CTCAAAAACTCCCAGAGCCCTGG + Intronic
1019514061 7:1432079-1432101 CTCACAGCCTCCTGCAGCACAGG + Intronic
1019750759 7:2727796-2727818 CCCACAGCCTCCCACAGTGCTGG - Intronic
1019784728 7:2968151-2968173 ATCACAGCCTCCCAGAGCACTGG + Intronic
1020266340 7:6562803-6562825 CACTAAGCCTCCCACAGTGCTGG + Intergenic
1021903245 7:25308772-25308794 CCCTAAGCCACTCACAGCTCAGG + Intergenic
1021903422 7:25310265-25310287 CGCCAAGCCACCCACAGCTCGGG - Intergenic
1026101138 7:67385499-67385521 CTCAGCCCCTCCCACAGCACTGG + Intergenic
1026955889 7:74376292-74376314 CTCAAAGCCACCCTGAACTCGGG + Exonic
1029452871 7:100651815-100651837 CTCAAGGCCTCCCAAAGTGCTGG + Intronic
1029460291 7:100690391-100690413 CTTCAAGCCTCCCACAGTGCTGG - Intergenic
1029605954 7:101599506-101599528 CTGAGAGCCTCTCTCAGCTCAGG + Intergenic
1029688223 7:102163483-102163505 CTCAGACCCTCCCACAGGCCTGG - Intronic
1029744787 7:102510904-102510926 CTCACATCCTCACCCAGCTCTGG + Intronic
1029762779 7:102610066-102610088 CTCACATCCTCACCCAGCTCTGG + Intronic
1030634806 7:111936733-111936755 ATCAAAATCTCCCACAGCGCAGG + Intronic
1032504097 7:132422925-132422947 AGCAAAGCCTCCCACAGCCGAGG + Intronic
1033195881 7:139326896-139326918 CCCAAATCCTGCCACAGATCTGG - Intergenic
1035049884 7:155992573-155992595 CCTGCAGCCTCCCACAGCTCTGG - Intergenic
1037612924 8:20491533-20491555 CTCAAAGCTCCCCACAGAACTGG - Intergenic
1037812864 8:22097227-22097249 CTCAACTCCTCCCTCAGTTCCGG - Intronic
1038121975 8:24627372-24627394 CTCAAAGCCTCTCAAAGGGCTGG + Intergenic
1038547856 8:28439659-28439681 CTCAACAACTCCCAGAGCTCAGG - Intronic
1038551917 8:28477777-28477799 GTCTCAGCCTCCCAAAGCTCTGG - Intronic
1038717358 8:30003885-30003907 CCCAAAGCCTCCCAAAGTGCTGG + Intergenic
1039955979 8:42207562-42207584 CTCTGAGCTCCCCACAGCTCCGG + Exonic
1040619350 8:49072268-49072290 CTCCGAGTCACCCACAGCTCAGG + Intronic
1041143627 8:54847861-54847883 CTCAGAGCCCCGCACTGCTCCGG - Intergenic
1041638546 8:60171752-60171774 CTCTCAGCCTCCCACAGCACTGG + Intergenic
1041701809 8:60798387-60798409 CTCCAAGCCACACACAGCTGTGG - Intronic
1043189340 8:77198221-77198243 CTCAAAGACTCCAGCAGCTGAGG - Intergenic
1044678826 8:94756772-94756794 CTCTCAGCCTCCCACAGTGCTGG - Intronic
1045198735 8:99956984-99957006 CTGAAAGCATCCCACAGCATGGG - Intergenic
1047357914 8:124140806-124140828 GCCTAAGCCTCCCAAAGCTCTGG - Intergenic
1047964033 8:130032433-130032455 CTCTCAGCCTCCCACAGTGCTGG + Intergenic
1048108861 8:131443990-131444012 GGCCAAGCCTCCCACATCTCAGG - Intergenic
1048174571 8:132140248-132140270 GTCAAAGCCTTCCACGCCTCTGG + Intronic
1048613656 8:136051040-136051062 CTCACAGTTTCCCACAGCTGGGG - Intergenic
1048783611 8:138027214-138027236 CTCAAAGCCAACCAGAGATCAGG - Intergenic
1048836157 8:138520786-138520808 CTCAGAGCCTCCCACTGTGCAGG - Intergenic
1049456425 8:142693338-142693360 CCCAAAGGATCCCACACCTCTGG + Intergenic
1049490434 8:142897231-142897253 GCCTAAGCCTCCCACAGTTCTGG + Intronic
1049764081 8:144345019-144345041 CTCTCAGCCTCCCAAAGTTCTGG - Intergenic
1050160012 9:2708632-2708654 CTCTCAGCCTCCCAAAGCACTGG + Intergenic
1053017384 9:34670307-34670329 CTCCAAGCCACCCACATTTCTGG - Intergenic
1053480325 9:38412058-38412080 CACCAAGCCTCCCAGAGCTGTGG + Intronic
1055001448 9:71454285-71454307 CTCAAAGCATCACACAGGTCAGG + Intergenic
1057086259 9:92213648-92213670 CTCAAGTCATCTCACAGCTCTGG - Intronic
1057519704 9:95751533-95751555 CTCCCTCCCTCCCACAGCTCAGG - Intergenic
1058683958 9:107464816-107464838 GTTAAAACCTCCCACAGCCCAGG + Intergenic
1059216758 9:112571699-112571721 GTCTCAGCCTCCCAAAGCTCAGG - Intronic
1060062600 9:120474501-120474523 CTCAAAGCCTCATACTGCTGAGG + Intronic
1061508989 9:131049038-131049060 CTCAGAGCCCCCCACACTTCTGG - Exonic
1061555409 9:131365227-131365249 ATCACAGCCTCCCAAAGCACTGG + Intergenic
1062173761 9:135149460-135149482 CTGAGAGGCTCCCAGAGCTCAGG + Intergenic
1062347738 9:136123134-136123156 CTTAAAGTCTCCCACAGACCTGG - Intergenic
1062623812 9:137434119-137434141 CTCTAAGCCCCCCACACCCCGGG - Intronic
1185467645 X:364113-364135 CTCACAGCCTTGCAGAGCTCTGG + Intronic
1185481382 X:449053-449075 CTCAGAGGCACCCCCAGCTCGGG - Intergenic
1186336751 X:8597917-8597939 CTCTAAGCCTCCCAAAGCACTGG + Intronic
1186851191 X:13581830-13581852 AGCTAAGACTCCCACAGCTCAGG + Intronic
1187406787 X:19011588-19011610 CTCAGAGCCTCCCAAAGTGCTGG - Intronic
1192139938 X:68638732-68638754 CTCAAGGCCTAACAGAGCTCAGG - Intergenic
1194372411 X:93090669-93090691 CCCAAAGCCCCACACAGCACTGG + Intergenic
1196741370 X:119028765-119028787 CTTAAGGCCTCCCTCAGCACTGG - Intergenic
1200256886 X:154587246-154587268 CTTCAAGCCTCCCACAGTGCTGG - Intergenic
1200260883 X:154617157-154617179 CTTCAAGCCTCCCACAGCGCTGG + Intergenic
1200750515 Y:6940448-6940470 CCCAAAGCCTCCCAAAGTGCTGG + Intronic
1200767221 Y:7090335-7090357 CTAAAAGCTTCCCTCAGCACTGG - Intronic
1202109692 Y:21406743-21406765 ATGAGGGCCTCCCACAGCTCAGG + Intergenic