ID: 950703965

View in Genome Browser
Species Human (GRCh38)
Location 3:14768725-14768747
Sequence TGGGCTAGCCGCAATACCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950703960_950703965 6 Left 950703960 3:14768696-14768718 CCTGAAGTAGACCAGGGGCTCAG 0: 1
1: 0
2: 2
3: 8
4: 156
Right 950703965 3:14768725-14768747 TGGGCTAGCCGCAATACCATGGG 0: 1
1: 0
2: 0
3: 1
4: 36
950703963_950703965 -5 Left 950703963 3:14768707-14768729 CCAGGGGCTCAGAAATAGTGGGC 0: 1
1: 0
2: 0
3: 14
4: 113
Right 950703965 3:14768725-14768747 TGGGCTAGCCGCAATACCATGGG 0: 1
1: 0
2: 0
3: 1
4: 36
950703959_950703965 10 Left 950703959 3:14768692-14768714 CCTTCCTGAAGTAGACCAGGGGC 0: 1
1: 0
2: 0
3: 11
4: 154
Right 950703965 3:14768725-14768747 TGGGCTAGCCGCAATACCATGGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950703965 Original CRISPR TGGGCTAGCCGCAATACCAT GGG Intronic
921775107 1:219088848-219088870 CTGGCTAGCCCCACTACCATGGG + Intergenic
1070472901 10:76801523-76801545 TCAGCCAGCCCCAATACCATGGG - Intergenic
1098489300 12:71056587-71056609 TGGGCTGCCAGCAATACCATAGG - Intronic
1108137853 13:47385188-47385210 TGGGCTAGCCTCACTATTATGGG + Intergenic
1131439540 15:92448505-92448527 TGGCCTAGCATCAAAACCATGGG + Intronic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1158685940 18:59614580-59614602 TTGACTAGCCGCCATAGCATGGG - Intronic
936983732 2:118288540-118288562 TGGGCTGGCTGCAAGACAATAGG + Intergenic
1170062672 20:12276018-12276040 CTGGCTAGCCCCACTACCATGGG + Intergenic
1172979396 20:38929442-38929464 TGGGCCAGCCCCCATACCCTAGG - Intronic
1176124101 20:63467487-63467509 TGGGCTAGCCTCAGCCCCATAGG - Intronic
950703965 3:14768725-14768747 TGGGCTAGCCGCAATACCATGGG + Intronic
968449444 4:668416-668438 TGGGGTAGCGGGAATAGCATGGG - Intronic
968449474 4:668529-668551 TGGGGTAGCGGGAATAGCATGGG - Intronic
968449489 4:668585-668607 TGGGGTAGCGGGAATAGCATGGG - Intronic
968449500 4:668622-668644 TGGGGTAGCGGGAATAGCATGGG - Intronic
968449685 4:669310-669332 TGGGGTAGCGGGAATAGCATGGG - Intronic
968449714 4:669402-669424 TGGGGTAGCGGGAATAGCATGGG - Intronic
968449743 4:669515-669537 TGGGGTAGCGGGAATAGCATGGG - Intronic
968449756 4:669572-669594 TGGGGTAGCGGGAATAGCATGGG - Intronic
968449761 4:669591-669613 TGGGGTAGCGGGAATAGCATGGG - Intronic
968449766 4:669610-669632 TGGGGTAGCGGGAATAGCATGGG - Intronic
968449785 4:669685-669707 TGGGGTAGCGGGAATAGCATGGG - Intronic
968449790 4:669704-669726 TGGGGTAGCGGGAATAGCATGGG - Intronic
968449795 4:669723-669745 TGGGGTAGCGGGAATAGCATGGG - Intronic
969264889 4:6057844-6057866 TGGGCTTGCCCCCAAACCATGGG + Intronic
969494809 4:7520475-7520497 TGGGCTGGGCGCAATCCCAGAGG - Intronic
1012762710 6:103321799-103321821 TGGGCTAGCCCTATTACCACTGG - Intergenic
1016521666 6:144953419-144953441 TGGCCTAGCCTGAATACTATAGG - Intergenic
1028282034 7:88942680-88942702 TGGTCTAACCTAAATACCATTGG - Intronic
1031149043 7:118031388-118031410 TGGGCTAGATGTAATAGCATAGG - Intergenic
1037757995 8:21723769-21723791 TGGGCTGGCCATAAGACCATTGG + Intronic
1046335433 8:112780822-112780844 TGGACTAGCCCTACTACCATAGG + Intronic
1059886593 9:118751241-118751263 CTGGCTAGCTGCACTACCATGGG + Intergenic
1188455605 X:30361817-30361839 TGGTCTAGGCAAAATACCATGGG + Intergenic
1191706986 X:64104157-64104179 TGGGCTAGATGCAATACTACAGG + Intergenic
1191947005 X:66545198-66545220 TTGGCAAGCCCCACTACCATAGG - Intergenic
1192958884 X:76104808-76104830 TCGGCTAGCCTCACCACCATGGG - Intergenic