ID: 950706269

View in Genome Browser
Species Human (GRCh38)
Location 3:14784388-14784410
Sequence TCCCTAGGTTTAGGGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950706257_950706269 3 Left 950706257 3:14784362-14784384 CCTTCCCCTCCTGCCTCTTTCTC No data
Right 950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG No data
950706261_950706269 -6 Left 950706261 3:14784371-14784393 CCTGCCTCTTTCTCCCTTCCCTA No data
Right 950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG No data
950706258_950706269 -1 Left 950706258 3:14784366-14784388 CCCCTCCTGCCTCTTTCTCCCTT No data
Right 950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG No data
950706256_950706269 24 Left 950706256 3:14784341-14784363 CCAGGAAGGAGATTGGGTGGGCC No data
Right 950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG No data
950706250_950706269 30 Left 950706250 3:14784335-14784357 CCCCTTCCAGGAAGGAGATTGGG No data
Right 950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG No data
950706259_950706269 -2 Left 950706259 3:14784367-14784389 CCCTCCTGCCTCTTTCTCCCTTC No data
Right 950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG No data
950706252_950706269 29 Left 950706252 3:14784336-14784358 CCCTTCCAGGAAGGAGATTGGGT No data
Right 950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG No data
950706263_950706269 -10 Left 950706263 3:14784375-14784397 CCTCTTTCTCCCTTCCCTAGGTT No data
Right 950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG No data
950706260_950706269 -3 Left 950706260 3:14784368-14784390 CCTCCTGCCTCTTTCTCCCTTCC No data
Right 950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG No data
950706253_950706269 28 Left 950706253 3:14784337-14784359 CCTTCCAGGAAGGAGATTGGGTG No data
Right 950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950706269 Original CRISPR TCCCTAGGTTTAGGGGCTGC TGG Intergenic
No off target data available for this crispr