ID: 950707026

View in Genome Browser
Species Human (GRCh38)
Location 3:14789182-14789204
Sequence AGACCAAAGGGACCACAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950707026_950707032 17 Left 950707026 3:14789182-14789204 CCTCCTTGTGGTCCCTTTGGTCT No data
Right 950707032 3:14789222-14789244 TCTTTCAGACCCTGCACTGAGGG No data
950707026_950707031 16 Left 950707026 3:14789182-14789204 CCTCCTTGTGGTCCCTTTGGTCT No data
Right 950707031 3:14789221-14789243 TTCTTTCAGACCCTGCACTGAGG No data
950707026_950707033 24 Left 950707026 3:14789182-14789204 CCTCCTTGTGGTCCCTTTGGTCT No data
Right 950707033 3:14789229-14789251 GACCCTGCACTGAGGGCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950707026 Original CRISPR AGACCAAAGGGACCACAAGG AGG (reversed) Intergenic
No off target data available for this crispr