ID: 950707589

View in Genome Browser
Species Human (GRCh38)
Location 3:14792697-14792719
Sequence GGCTGCTGGAACCTCTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950707582_950707589 10 Left 950707582 3:14792664-14792686 CCACAGGCTAGGCCAATGTGGGC No data
Right 950707589 3:14792697-14792719 GGCTGCTGGAACCTCTGAGATGG No data
950707586_950707589 -2 Left 950707586 3:14792676-14792698 CCAATGTGGGCAGAGGGGCAAGG No data
Right 950707589 3:14792697-14792719 GGCTGCTGGAACCTCTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950707589 Original CRISPR GGCTGCTGGAACCTCTGAGA TGG Intergenic
No off target data available for this crispr