ID: 950711931

View in Genome Browser
Species Human (GRCh38)
Location 3:14819303-14819325
Sequence CCCAAGGACGAGGGCAGTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950711923_950711931 4 Left 950711923 3:14819276-14819298 CCCAGGGTTCCGCTGAGGGAGGA 0: 1
1: 0
2: 2
3: 10
4: 122
Right 950711931 3:14819303-14819325 CCCAAGGACGAGGGCAGTGTGGG 0: 1
1: 1
2: 1
3: 14
4: 161
950711925_950711931 -5 Left 950711925 3:14819285-14819307 CCGCTGAGGGAGGATGAACCCAA 0: 1
1: 1
2: 3
3: 9
4: 123
Right 950711931 3:14819303-14819325 CCCAAGGACGAGGGCAGTGTGGG 0: 1
1: 1
2: 1
3: 14
4: 161
950711916_950711931 27 Left 950711916 3:14819253-14819275 CCGACGAGGATTACATCGTGGTC 0: 1
1: 0
2: 1
3: 1
4: 20
Right 950711931 3:14819303-14819325 CCCAAGGACGAGGGCAGTGTGGG 0: 1
1: 1
2: 1
3: 14
4: 161
950711921_950711931 5 Left 950711921 3:14819275-14819297 CCCCAGGGTTCCGCTGAGGGAGG 0: 1
1: 1
2: 0
3: 17
4: 141
Right 950711931 3:14819303-14819325 CCCAAGGACGAGGGCAGTGTGGG 0: 1
1: 1
2: 1
3: 14
4: 161
950711924_950711931 3 Left 950711924 3:14819277-14819299 CCAGGGTTCCGCTGAGGGAGGAT 0: 1
1: 0
2: 0
3: 13
4: 101
Right 950711931 3:14819303-14819325 CCCAAGGACGAGGGCAGTGTGGG 0: 1
1: 1
2: 1
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950711931 Original CRISPR CCCAAGGACGAGGGCAGTGT GGG Exonic
900032664 1:382131-382153 CCACAGGACGGGGGCAGAGTCGG - Intergenic
900053422 1:611193-611215 CCACAGGACGGGGGCAGAGTCGG - Intergenic
900286984 1:1906528-1906550 CACAGGGTCGAGGGCAGTGGGGG + Intergenic
900806787 1:4772759-4772781 CCCCTGGACGTGGGCAGTGGCGG + Intronic
901881154 1:12194508-12194530 CCTAAGTAGGAGGGCAGTATGGG - Intronic
902434039 1:16385687-16385709 CCCAAGGAGGAGAGCAGGGAAGG - Intronic
902650928 1:17837100-17837122 CCCAAGGATGGGGACAGTGGGGG + Intergenic
902755827 1:18548573-18548595 CCCAATGACTGGGGCAGTATGGG - Intergenic
903846005 1:26280285-26280307 CCCCAGGACGGGGGCGGGGTGGG + Intronic
905814305 1:40936825-40936847 CCCAAGGAGGGGGGAAGTATTGG + Intergenic
906199277 1:43948643-43948665 CCCTTGGAGCAGGGCAGTGTTGG + Intronic
912436081 1:109661871-109661893 CCCAAGGTGAAGGGCAGTGGCGG + Intronic
912512592 1:110199101-110199123 CCCAGGGACCAGGGCAGAGGAGG - Exonic
912810111 1:112787721-112787743 CCCAAGCTGGAGGGCAGTGGTGG + Intergenic
915728832 1:158038263-158038285 CCCAGGGACCAGAGCAGTGCGGG - Intronic
921371405 1:214426811-214426833 CCCAGGGAAGATGCCAGTGTGGG + Intronic
921625620 1:217374891-217374913 CCCCAGGAAGAGGCCTGTGTAGG - Intergenic
922868461 1:228880855-228880877 CCCAATAAAGAAGGCAGTGTGGG + Intergenic
1067085166 10:43234353-43234375 CCCAAGAACAAAGGCAGAGTTGG + Intronic
1069709034 10:70477743-70477765 CCCCAGGATGCAGGCAGTGTAGG - Intergenic
1069793895 10:71040380-71040402 GCACAGGACGAGGGCAGTGCTGG + Intergenic
1069956291 10:72053908-72053930 CTCCAGGACAAGGGGAGTGTTGG + Intergenic
1073459698 10:103659585-103659607 CCCAGGGAGGAGCCCAGTGTGGG + Intronic
1074291249 10:112139427-112139449 GCCTACCACGAGGGCAGTGTGGG - Intergenic
1075486653 10:122827960-122827982 CCCATGGAGGAGGGCAGTTTTGG + Intergenic
1077048406 11:555985-556007 CCCAAGGGCGAGGTCGGTGCGGG - Exonic
1077177934 11:1199017-1199039 CCCAAGAGCCAGGGCAGGGTCGG - Intronic
1078932680 11:15924844-15924866 GCCATGGACAGGGGCAGTGTAGG - Intergenic
1079094501 11:17501883-17501905 CCCCAGGAACAGGGCAGTGTGGG - Intronic
1083726354 11:64630557-64630579 CCCCAGGACCAGGGCACCGTGGG - Exonic
1084153207 11:67300792-67300814 CCCAGGGAGGAGGGCAGCTTGGG + Intronic
1084603383 11:70159582-70159604 CCCCAGGACCAGGGGCGTGTGGG - Intronic
1090261083 11:125320761-125320783 CTTAAGGGCAAGGGCAGTGTGGG - Intronic
1091353521 11:134916191-134916213 CCTCAGGAGGAGGGCAGGGTGGG - Intergenic
1092261152 12:6953913-6953935 CCCAGGGACGAGGGGAGGGCGGG - Intronic
1094068980 12:26391974-26391996 CCCAGGCACCAGGGCAGTGGAGG + Intronic
1096668873 12:53185901-53185923 CTCCAGGAAGAGGGCAGTGGTGG + Intronic
1097159647 12:57037356-57037378 CCCCAGGCTCAGGGCAGTGTAGG + Intronic
1097747642 12:63317528-63317550 CCCAAGCCCCAGGGCAGTCTTGG - Intergenic
1101065550 12:101016694-101016716 CCCAAGGAAGTGGGCCATGTGGG + Intronic
1101270746 12:103141570-103141592 CCCAAGGCAGAGTGCAGTGGCGG + Intergenic
1102201357 12:111059885-111059907 CCCAAGGTCGGGGGCAGGGAAGG - Intronic
1102360639 12:112284760-112284782 CCCAAGAAGGATGGCAGTGATGG - Intronic
1103626944 12:122226753-122226775 CCGAAGAACGAGGGCAGTTTGGG - Intronic
1103902043 12:124308451-124308473 TCCAAGGACAAGGGCAGTGTGGG - Intronic
1107335368 13:39348806-39348828 CCCTAGGAAGAGGGTAGTGTGGG - Intronic
1112241571 13:97687046-97687068 GCCAAGGAAGAGGGAAGTGCTGG + Intergenic
1116773828 14:49157278-49157300 CCCAGGGTGGAGTGCAGTGTGGG - Intergenic
1116860675 14:49993088-49993110 GCCAAGGCCAAGGGCAGTGCAGG - Intronic
1118681355 14:68245111-68245133 TCCTAGGACGAGGACAGGGTAGG - Intronic
1122334678 14:100963686-100963708 CCCACGGACCAGGGCAGGGAGGG - Intergenic
1122787353 14:104169945-104169967 CGCTGGGACCAGGGCAGTGTGGG + Intronic
1202884538 14_KI270722v1_random:92176-92198 TGTAAGGACAAGGGCAGTGTTGG + Intergenic
1129680793 15:77657358-77657380 CCCAAGCCTGAGGGCAGTGAAGG + Intronic
1132903270 16:2269715-2269737 CACAGGGAAGAGGGCAGTGATGG - Intergenic
1134422540 16:14107829-14107851 ACCAAGGAAGAGGGCACAGTAGG + Intronic
1134434338 16:14241931-14241953 CCAAAGGAGGATGGCAGTGGAGG - Intronic
1136502271 16:30677905-30677927 CCCAAGGTGGTGGGCAGTGATGG + Intergenic
1141069435 16:80939931-80939953 CCCAAAGCAGAGGACAGTGTGGG - Intergenic
1141081330 16:81055760-81055782 CCCAAGCTGGAGTGCAGTGTTGG + Intronic
1141589408 16:85057908-85057930 ACCAATGAGGAGGGCAGTGGGGG - Intronic
1141631762 16:85291694-85291716 CCACAGGGTGAGGGCAGTGTAGG - Intergenic
1144770697 17:17757851-17757873 CCCATGGAACAGGGCAGTGTTGG + Intronic
1148738794 17:49880437-49880459 CCCCAGGACGGGGGCAGGATGGG - Intergenic
1150482690 17:65522754-65522776 TCCATGGACGAGGGCGGCGTGGG + Intergenic
1152930767 17:83108506-83108528 GAGGAGGACGAGGGCAGTGTGGG + Intergenic
1152947276 17:83205054-83205076 CCACAGGACGGGGGCAGAGTCGG + Intergenic
1153921216 18:9792037-9792059 CCCAAGGACCAGGGCTTTTTGGG + Intronic
1155203638 18:23538410-23538432 CCAAAGGACCAGGACAGGGTGGG + Intronic
1158519880 18:58163019-58163041 CCCAAGGTGGAGTGCAGTGGCGG - Intronic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1163151996 19:15421071-15421093 CCCAAGCTGGAGTGCAGTGTAGG - Exonic
1165245241 19:34494821-34494843 CACAAGGTCGAGGGAAGTGGTGG + Intronic
1165350370 19:35271924-35271946 CCCTAGGGAGAGGGGAGTGTGGG + Intronic
1165818376 19:38657835-38657857 ACCAAGGCCAAGGGCAGTGGTGG + Intronic
1165834229 19:38744457-38744479 ACCAAGAAGGAGGTCAGTGTGGG + Exonic
1166317266 19:41996240-41996262 CCCTAGGAAGAGGGCAGAGTTGG - Intronic
1166504260 19:43361600-43361622 CCCAAGGATGAAGGCACTGGTGG + Intronic
1166762677 19:45234691-45234713 CCCAAGGCCGAGGGCGCTGGCGG - Intronic
1167701316 19:51048382-51048404 CTTAAGGATGAGGGCAGTGAGGG - Intergenic
925142513 2:1559741-1559763 TTCTAGAACGAGGGCAGTGTGGG - Intergenic
925233455 2:2256225-2256247 CCGCAGGCCGAGGCCAGTGTGGG + Intronic
929934991 2:46287908-46287930 CCCAAGGCCCAGCACAGTGTTGG + Intergenic
930106795 2:47646635-47646657 CCCAATGCCTAGGGCAGAGTAGG - Intergenic
933374651 2:81464105-81464127 CCCATGGTGGAGGGCAGTGGGGG + Intergenic
937859053 2:126694022-126694044 CCTAAGGACTTGGGCAGTGGTGG + Intronic
939521762 2:143239946-143239968 CCCAGGGTGGAGGGCAGTGATGG - Intronic
941846567 2:170140238-170140260 GCCAAAGACGTGGGCAGTGCTGG + Intergenic
947876425 2:233470813-233470835 CCCAAAGAGAAGGACAGTGTTGG + Exonic
947876433 2:233470864-233470886 CCCAAAGAGAAGGACAGTGTTGG + Exonic
948031984 2:234826336-234826358 CCCAATGACCAGTGCAGAGTTGG - Intergenic
948053006 2:234992423-234992445 CACAAGGAGGAAGGCATTGTGGG + Intronic
948683773 2:239658171-239658193 CCTAAGGGAGAGGGCACTGTGGG - Intergenic
948802383 2:240438727-240438749 CTCATGAAAGAGGGCAGTGTCGG + Intronic
1172537427 20:35684928-35684950 CCCAAGGTGGAGTGCAGTGGCGG + Intronic
1174500141 20:50978284-50978306 CCCAAGGACCAGAGCATTGCTGG - Intergenic
1176599966 21:8783147-8783169 TGTAAGGACAAGGGCAGTGTTGG + Intergenic
1178340628 21:31783149-31783171 CACAAGGAAGAGGGGAGTGATGG - Intergenic
1178609651 21:34069658-34069680 CCCAGGGAAGAGGACAGAGTAGG + Intergenic
1179110979 21:38444963-38444985 CCCAGGCACGAGGGCTCTGTGGG - Intronic
1180165486 21:46023601-46023623 GGCCAGGACCAGGGCAGTGTGGG + Intergenic
1180338860 22:11601544-11601566 CCCGAGGACGAGGACGGTGAAGG - Intergenic
1180957764 22:19748651-19748673 GCCCAGGACCAGGGGAGTGTGGG - Intergenic
1181028866 22:20140561-20140583 CCCAAGGTCCAGGCCAGGGTGGG - Intronic
1182511483 22:30823108-30823130 CCCCAGGACGAGGCCCTTGTGGG - Intronic
1184231117 22:43158984-43159006 CCCAAGGTCGAGGTGAGGGTGGG + Intronic
1184244494 22:43228968-43228990 CCCAGGGTTGAGGGCAGGGTTGG + Intronic
1184742665 22:46438108-46438130 CCCAAAGCCGAGGGGAGGGTTGG + Intronic
1184788200 22:46682111-46682133 CCCCAGGAGGAGGGCAGAGCTGG - Intergenic
1185048335 22:48540284-48540306 CCCCAGGACCAGGGCGGTGGGGG + Intronic
1185266402 22:49906510-49906532 CCCAGGCCCGAGGGCAGTGCGGG + Intronic
1185278268 22:49959173-49959195 CCGCAGTACGAGGGCAGGGTTGG - Intergenic
950590741 3:13934484-13934506 CCCAAGGACGGGGGCAGTGTGGG + Intergenic
950711931 3:14819303-14819325 CCCAAGGACGAGGGCAGTGTGGG + Exonic
953667991 3:44939914-44939936 CCCAAGGAGAAGGGTAGTGTGGG - Intronic
953749978 3:45601507-45601529 CCCCAGGAAGGGGGCACTGTGGG - Intronic
954451039 3:50571894-50571916 TCCAAGGACTAGGGAGGTGTTGG + Intronic
954672868 3:52299856-52299878 CCCAGGGAGGAGGGCAGGGTAGG + Intergenic
955596525 3:60596367-60596389 CCCAAAGGCTAGTGCAGTGTCGG - Intronic
961820843 3:129574953-129574975 CCCAAAGAGGAGGGCAGGGAGGG + Intronic
962827074 3:139107961-139107983 CCCAAGGCCGAGGGCAGGCAGGG + Intronic
963156372 3:142101454-142101476 CCAAAAGAGGAGGGCAGGGTGGG + Intronic
963286269 3:143437356-143437378 GCCAAGGACCAGGGCAGTTCTGG - Intronic
964797640 3:160517122-160517144 CCTAGGGATGAAGGCAGTGTGGG - Intronic
967787032 3:193508287-193508309 CCCAAGGTCAAGAGCAGTGCTGG + Intronic
968517695 4:1021759-1021781 CCCAAGGACAAGGGCAGTAGGGG - Intronic
969259265 4:6023270-6023292 CCCAGGGGCGATGGGAGTGTGGG - Intergenic
970474572 4:16409390-16409412 CCCAAGGAGGAAGAAAGTGTGGG - Intergenic
970618499 4:17791699-17791721 CCCAAGCAGGAGTGCAGTGGCGG - Intergenic
973836971 4:54819443-54819465 CCCAAGGAAGAGGGCCCAGTAGG + Intergenic
974094369 4:57346461-57346483 CCCAAAGAAGAAGGCAGTGCTGG + Intergenic
975590097 4:75991085-75991107 CCCAAGGGCGAGGGGCGGGTCGG - Intergenic
976154671 4:82129558-82129580 CCCATGAAAGAGGGCAGTTTTGG + Intergenic
979382774 4:120027848-120027870 CCCAAGCTGGAGGGCAGTGGCGG - Intergenic
982266690 4:153544472-153544494 CCCAAGGCAGAGGGCAGCCTGGG - Intronic
983336384 4:166398799-166398821 CCAAAGGACGATGGCAGTGAGGG + Intergenic
984380170 4:178982718-178982740 CCTAAAGACCAGGGCAATGTGGG + Intergenic
986236112 5:5912250-5912272 CCCAGGGAGGAGGGGAGTGTGGG + Intergenic
989650013 5:43677460-43677482 CCCAAGGGTGTGTGCAGTGTCGG + Intronic
992758490 5:79931271-79931293 GCCAGGGACGAGGACATTGTAGG + Intergenic
995844169 5:116476147-116476169 CCCAAGGACTGGGGCAGGGCTGG - Intronic
1002399925 5:178986092-178986114 CCCAAGGGCCAGGGCAGGGAGGG - Intronic
1002741156 5:181436737-181436759 CCACAGGACGGGGGCAGAGTCGG + Intergenic
1004626794 6:17384634-17384656 CCCAGGGTAGAGGGCAGTGGTGG - Intergenic
1011558633 6:88593316-88593338 TGCCAGGACAAGGGCAGTGTTGG - Intergenic
1013719521 6:113007172-113007194 CAGATGGACGAAGGCAGTGTAGG + Intergenic
1015025993 6:128533117-128533139 CCCAATGCCCAGGGCAGTGTTGG - Intergenic
1018686589 6:166308322-166308344 CCCCAGGAGGAGGGGAGGGTGGG - Exonic
1018836133 6:167485528-167485550 CCCAGCGAAGAGGACAGTGTGGG - Intergenic
1019246270 6:170712434-170712456 CCACAGGACGGGGGCAGAGTCGG + Intergenic
1023319916 7:38984181-38984203 CCCTAGGACTAGGGAAGTGCTGG - Intronic
1023736816 7:43242725-43242747 TCCAAGGAGGAAGGCAGTGCAGG + Intronic
1033275609 7:139969624-139969646 CCCAGGGAGGAGGGCATGGTTGG + Intronic
1035501802 8:95255-95277 CCACAGGACGGGGGCAGAGTCGG - Intergenic
1036773439 8:11594008-11594030 CTCCAGGACGAGGGCAGTGGGGG + Intergenic
1038321625 8:26532221-26532243 CCCAGGGATGAGGTCAGAGTTGG + Intronic
1040855215 8:51942224-51942246 CCCAAGGCAGAGGGAAGTGGTGG + Intergenic
1044620288 8:94184559-94184581 CCCAAGGCTGAGGGGAGTGGAGG + Intronic
1048457722 8:134593058-134593080 CCCAAGGCCAAGGGCAGAGGAGG - Intronic
1049451005 8:142661443-142661465 CCCAAAGATGAAGGCAGTGGTGG + Intronic
1049473183 8:142785266-142785288 CCCCAGGCTGAGGGCACTGTGGG + Exonic
1049671321 8:143871322-143871344 CAGAAGGATGAGGGCAGTGCCGG + Exonic
1050325959 9:4497271-4497293 CCCAAGGTCGAGGGCAGAGCCGG + Intronic
1050906393 9:11011899-11011921 TCCAAGGAAGAAGGCAGTGGGGG + Intergenic
1051132685 9:13880115-13880137 CCCATGGAGGAGGGCTTTGTTGG - Intergenic
1052291812 9:26850308-26850330 CACAAGTACGTGGGCAGAGTGGG + Intronic
1059065253 9:111076735-111076757 CCCCAGGCCGAGTGCAGTGGTGG + Intergenic
1060492455 9:124094889-124094911 CCCAAGGAGCAGGGGAGGGTTGG + Intergenic
1060871099 9:127040720-127040742 CCCAAGGAAGAAGGCAGGATTGG + Intronic
1061207811 9:129174634-129174656 CGCACCGGCGAGGGCAGTGTGGG + Intergenic
1061907718 9:133707421-133707443 CCAAAGGGCCAGGGCAGTCTGGG + Intronic
1062536426 9:137023061-137023083 CCCACGGGAGAGGGCAGGGTCGG + Intronic
1203607034 Un_KI270748v1:67817-67839 CCACAGGACGGGGGCAGAGTCGG + Intergenic
1186342123 X:8656484-8656506 CCAAAGGATGAGGGCAGTAAAGG - Intronic
1186746747 X:12577464-12577486 CCTCAAGAAGAGGGCAGTGTGGG + Intronic
1187560133 X:20394831-20394853 CTCATGGAGGAGGGGAGTGTGGG + Intergenic
1197147067 X:123183262-123183284 ACCAAGGAGGAGGGAGGTGTGGG - Intergenic
1198340317 X:135707769-135707791 CCCAAGGTGGAGTGCAGTGGCGG + Intergenic