ID: 950717956

View in Genome Browser
Species Human (GRCh38)
Location 3:14863021-14863043
Sequence GAGGCGGGTGGGGGACATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 229}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950717956_950717967 -1 Left 950717956 3:14863021-14863043 CCCTGATGTCCCCCACCCGCCTC 0: 1
1: 0
2: 2
3: 29
4: 229
Right 950717967 3:14863043-14863065 CACTTCCCCCTGCCTGGGCCAGG 0: 1
1: 0
2: 4
3: 58
4: 583
950717956_950717964 -7 Left 950717956 3:14863021-14863043 CCCTGATGTCCCCCACCCGCCTC 0: 1
1: 0
2: 2
3: 29
4: 229
Right 950717964 3:14863037-14863059 CCGCCTCACTTCCCCCTGCCTGG 0: 1
1: 0
2: 3
3: 52
4: 415
950717956_950717965 -6 Left 950717956 3:14863021-14863043 CCCTGATGTCCCCCACCCGCCTC 0: 1
1: 0
2: 2
3: 29
4: 229
Right 950717965 3:14863038-14863060 CGCCTCACTTCCCCCTGCCTGGG 0: 1
1: 0
2: 1
3: 23
4: 326
950717956_950717977 17 Left 950717956 3:14863021-14863043 CCCTGATGTCCCCCACCCGCCTC 0: 1
1: 0
2: 2
3: 29
4: 229
Right 950717977 3:14863061-14863083 CCAGGGCCTGAGGGAAAGCTTGG 0: 1
1: 0
2: 2
3: 36
4: 411
950717956_950717968 0 Left 950717956 3:14863021-14863043 CCCTGATGTCCCCCACCCGCCTC 0: 1
1: 0
2: 2
3: 29
4: 229
Right 950717968 3:14863044-14863066 ACTTCCCCCTGCCTGGGCCAGGG 0: 1
1: 0
2: 1
3: 28
4: 421
950717956_950717973 7 Left 950717956 3:14863021-14863043 CCCTGATGTCCCCCACCCGCCTC 0: 1
1: 0
2: 2
3: 29
4: 229
Right 950717973 3:14863051-14863073 CCTGCCTGGGCCAGGGCCTGAGG 0: 1
1: 2
2: 11
3: 122
4: 901
950717956_950717974 8 Left 950717956 3:14863021-14863043 CCCTGATGTCCCCCACCCGCCTC 0: 1
1: 0
2: 2
3: 29
4: 229
Right 950717974 3:14863052-14863074 CTGCCTGGGCCAGGGCCTGAGGG 0: 1
1: 0
2: 7
3: 60
4: 584
950717956_950717979 23 Left 950717956 3:14863021-14863043 CCCTGATGTCCCCCACCCGCCTC 0: 1
1: 0
2: 2
3: 29
4: 229
Right 950717979 3:14863067-14863089 CCTGAGGGAAAGCTTGGCCCAGG 0: 1
1: 1
2: 2
3: 24
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950717956 Original CRISPR GAGGCGGGTGGGGGACATCA GGG (reversed) Intronic
900502179 1:3011742-3011764 GTCACGGGTGGGGCACATCAGGG - Intergenic
900772499 1:4556317-4556339 GTGGTGGGTGGGGGTCTTCAAGG + Intergenic
901128285 1:6944579-6944601 GAGGGTGGTGGAGGACAGCATGG - Intronic
901848794 1:12001939-12001961 GAGGGAGGTGGGGGCCACCAGGG - Intronic
903007168 1:20306346-20306368 GAGGGACGTGGGGGCCATCAGGG + Intronic
903398155 1:23018806-23018828 GATGGGGATGGGGGACATGAAGG + Intergenic
903535067 1:24061324-24061346 GAGGAGAATGGGGGCCATCAGGG + Intronic
904563587 1:31414058-31414080 GAGGCGGGTGCGGGTCGTCACGG + Intronic
904627852 1:31817546-31817568 GAAGCAGGGAGGGGACATCAAGG - Intergenic
904727534 1:32561061-32561083 GGTGGGGGTGGGGGACATTAAGG - Intronic
905271572 1:36790933-36790955 GAGGGGGGTGGGGGACCTGTGGG + Intergenic
906245493 1:44270601-44270623 GAGGCAGGTGAGGCTCATCATGG + Intronic
906323613 1:44831113-44831135 GAGGAGGGTGGGGTACAGCATGG - Intronic
906807423 1:48792857-48792879 GAGGTGTCTGTGGGACATCAAGG - Intronic
907021969 1:51075237-51075259 GGGGAGGGTGGAGGACAGCATGG + Intergenic
907290725 1:53411010-53411032 GTGGCTGGTGGGGGAGAGCAGGG + Intergenic
912489498 1:110054136-110054158 GAGGAGGGTGGGGGAAGTAAAGG - Exonic
913202262 1:116504507-116504529 GAGGCTGTGGGGTGACATCAGGG + Intergenic
913332650 1:117680188-117680210 GGGGCCGGTGGGGGACAAGAGGG - Intergenic
915515134 1:156408273-156408295 GAGGTAGGTGGGGGCAATCAAGG - Intronic
915631122 1:157154846-157154868 GAGGGGGCTGGGGGATACCAGGG - Intergenic
915811063 1:158911054-158911076 GAGGAGAGAGAGGGACATCAGGG + Intergenic
916056725 1:161073361-161073383 GAGGCTGGTGGAGGACAAGAGGG - Intronic
916212148 1:162367816-162367838 GAGGGGGTAGGGGGGCATCACGG - Exonic
921262159 1:213394083-213394105 GAGGAGGCTGGGTGACCTCATGG + Intergenic
924083326 1:240421867-240421889 GGTGGGGGTGGGGGAAATCAAGG + Intronic
1062902647 10:1157574-1157596 GAGGCTGGTGGGTGTGATCAGGG + Intergenic
1063294214 10:4786520-4786542 AAGGCAGGTGGGAGGCATCACGG + Intergenic
1063391027 10:5649976-5649998 GAGGCTGGTGGGGAAAATTAGGG - Intronic
1069827010 10:71260568-71260590 GGGGAGGCTGGGGGGCATCAGGG + Intronic
1072158203 10:92742961-92742983 GAGTTGGGTGGGGGGCATCACGG + Intergenic
1072690773 10:97571040-97571062 GAGGCGGGTGGTGGACAGCTGGG + Exonic
1073146151 10:101283148-101283170 GAGGAGGGTGGGGGACTTCCAGG + Intergenic
1073178174 10:101569142-101569164 GAGGGGGGTGGGGGGCACCAGGG + Intergenic
1074777863 10:116779396-116779418 GATGAGGGTGGGGCACCTCAGGG + Intergenic
1075429100 10:122365573-122365595 GATGGGGGCGGGGGTCATCAAGG - Intergenic
1076494292 10:130886746-130886768 CAGGCAGGTGAGGGACAGCAGGG - Intergenic
1076788166 10:132761558-132761580 ATGGCTGGTGGGGGACAGCACGG + Intronic
1076883142 10:133249251-133249273 GAGGGGCGTGGGGGGCATGAGGG + Intergenic
1076979515 11:197215-197237 GAGCAGGGTCGGGGACATCAGGG + Intronic
1078042306 11:7879130-7879152 GAAGAGGGTGGGGGACAGGAAGG + Intergenic
1079407723 11:20160304-20160326 GAGGAGGCCGGGGAACATCATGG + Exonic
1080655190 11:34252814-34252836 GAGGAGGCTGGGGGACCTCCTGG + Intronic
1080661070 11:34296333-34296355 GAGGAGGGTGGGAGAGTTCATGG + Intronic
1081567548 11:44269421-44269443 GAGGAGGGTGGGGGTGAGCAGGG + Intronic
1081606619 11:44531208-44531230 GAGGCGGGTGGTAGAGATGAGGG - Intergenic
1083235748 11:61349775-61349797 GAGGTGGGGTGGAGACATCATGG - Exonic
1083365577 11:62139817-62139839 GAGGTGGGTGGGGCACGTCTGGG + Intronic
1083721407 11:64605410-64605432 GAGGAGGGTTGCGGACCTCAAGG - Intergenic
1084360264 11:68664567-68664589 GTTGGGGATGGGGGACATCATGG + Intergenic
1084956432 11:72694033-72694055 GAGGCAGGGGGTGGAGATCATGG - Intronic
1085516198 11:77113222-77113244 GAGGCGGATGGTGGACAAGAGGG - Intronic
1086416450 11:86593177-86593199 AAGGAGGGTGGAGGAAATCATGG - Intronic
1088849746 11:113695188-113695210 GTGGCTGGTGAGGGACATGATGG + Intronic
1088858008 11:113773561-113773583 CCGGCGGGTGGAGGAGATCAAGG - Exonic
1089011440 11:115135380-115135402 GAGGCGGGTGGATGACCTGAGGG + Intergenic
1089685133 11:120141871-120141893 GACTGGGGTGGGGGACTTCACGG - Intronic
1090414090 11:126528831-126528853 GAGGAGGGTGAGGGGCAGCATGG + Intronic
1093693024 12:22128574-22128596 GAGGAGGTTGGGGGACATACAGG + Intronic
1094059793 12:26301566-26301588 GAGGGGAGTGGGAGACAACAAGG - Intergenic
1096102549 12:48978502-48978524 GGGGCGGGCGGCGGACAGCATGG - Intronic
1096805149 12:54136046-54136068 GAGGCAGGTGGGGGACAAGAGGG + Intergenic
1097705794 12:62866948-62866970 GAGGCAGGAGGGGGAAAGCATGG - Intronic
1100125595 12:91420954-91420976 GAGGCGGGTGGATCACATGAGGG + Intergenic
1100401727 12:94236466-94236488 TAGGCAGGTGTTGGACATCACGG + Intronic
1101008576 12:100426802-100426824 AAGGGGGGTGGGGAACATGAGGG + Intergenic
1102050179 12:109856348-109856370 GAAGCGGATGGGGTACAACAAGG + Intronic
1102723445 12:115037477-115037499 GAGAAGAGTTGGGGACATCACGG - Intergenic
1102730711 12:115106463-115106485 GAGGTGCCTGGGGGACATCCAGG - Intergenic
1102998551 12:117367754-117367776 GGGCTGGGTGGGAGACATCAGGG + Intronic
1103041993 12:117703417-117703439 GAGGCAACTGAGGGACATCAGGG - Intronic
1103969017 12:124658067-124658089 AAGGAGGGTGGGAGAAATCAGGG + Intergenic
1104103530 12:125637589-125637611 GAAGCGGGTAGGGGACTTCCAGG + Intronic
1104360549 12:128129127-128129149 GGGGCGGGCGGGGGACAGAAGGG - Intergenic
1112219200 13:97470854-97470876 GAGGCAGGTTGGGGACAGCAGGG + Intergenic
1113748054 13:112759193-112759215 GAGGCGGCTGGGGGAGCTCTGGG + Intronic
1115298798 14:31860373-31860395 GAGGGGGGTGGTGGATTTCATGG - Exonic
1119808695 14:77499003-77499025 GAGGAGGGTGGGGGACGTCCAGG - Intergenic
1120227259 14:81804851-81804873 GAGGTGAGTGAGGGACAGCAAGG - Intergenic
1121201071 14:92118739-92118761 GAGGCGGGTGGACGACAACAAGG + Intronic
1122599801 14:102915594-102915616 GAGGAAGGAGGAGGACATCAGGG - Intergenic
1122919537 14:104874357-104874379 GAGGTGGGTGGTGGCTATCAAGG + Intronic
1122992268 14:105242072-105242094 GAGCCTGGTGGGGCACAGCAGGG - Intronic
1123018532 14:105386861-105386883 GAGGCTGCTGGGGGTCAGCAGGG - Intronic
1123476539 15:20595444-20595466 CAGGAAGGTGGGGGAGATCAAGG - Intergenic
1123527930 15:21120486-21120508 CAGGCAGGGGGGGGACATCCAGG + Intergenic
1123641472 15:22404920-22404942 CAGGAAGGTGGGGGAGATCAAGG + Intergenic
1124374898 15:29123789-29123811 GAGGAGGGATGGGGACAGCAGGG - Intronic
1124560709 15:30770943-30770965 GAGACGGGTGGAGAACATCCGGG + Intronic
1124670499 15:31634500-31634522 GAGACGGGTGGAGAACATCCCGG - Intronic
1125919895 15:43519152-43519174 GGGGCAGGTGAGGGATATCAAGG - Intronic
1126920087 15:53511523-53511545 AAGGGGGTTGGGGGACATCCTGG + Intergenic
1127117706 15:55743559-55743581 GGGGTGGGCGGGGGCCATCAAGG - Intergenic
1127558753 15:60114840-60114862 GAGGGGGGTGGGGAAGATAATGG + Intergenic
1128511680 15:68317367-68317389 GAGGTGGGTGGCAGACATCATGG + Intronic
1128535625 15:68487886-68487908 GAGGAGGCTGTGGGACATCAAGG + Intergenic
1128865638 15:71113394-71113416 GAAGAGGGTGGGGGATATAAGGG + Intronic
1129500594 15:76033833-76033855 GAGTCTGCTGGGGGACTTCACGG - Intronic
1130046022 15:80445580-80445602 GAGGTGGGTGGGAGACAGGATGG + Intronic
1131133087 15:89912642-89912664 GATGCGGGTGGGGGAAAACTGGG - Intronic
1131585172 15:93684897-93684919 CAGGGGTGAGGGGGACATCATGG - Intergenic
1132663561 16:1071938-1071960 GAGGGGGCTGGGGGACCTCCTGG + Intergenic
1134054996 16:11164478-11164500 AAGGAGGCTGAGGGACATCAGGG + Intronic
1140476439 16:75241632-75241654 TTGGCGGGTGGGGGACTCCATGG - Intronic
1141680125 16:85538888-85538910 GAGGTGGGTGGGGGAGATTTGGG - Intergenic
1142534447 17:604755-604777 GAGGGGAGTTGTGGACATCAAGG + Intronic
1142744303 17:1948076-1948098 GCGGCGGGTTGGGTGCATCAGGG - Intronic
1143652340 17:8271275-8271297 GAGCTGGGTGGGGGTCAGCAAGG - Intergenic
1143712314 17:8743451-8743473 GAGACAGGTGGGGGACATAAAGG + Intronic
1143997875 17:11023758-11023780 GAGGGGGGAGGGGGTCCTCAGGG - Intergenic
1145043437 17:19593900-19593922 GAGGGGTGTGGGAGACAACATGG - Intergenic
1145931537 17:28689555-28689577 GAGGCAGGTAAGGGACAGCATGG + Exonic
1148756954 17:49978216-49978238 GAGGCAGGAGGGGGACATGATGG + Intergenic
1149564406 17:57630892-57630914 GAGGCGGCTGGGGTACAGAAGGG + Intronic
1152495350 17:80667240-80667262 GAGGCTGGAGGGGGACAGCCGGG + Intronic
1152861476 17:82698838-82698860 GGGGCGGGTGGGCGACAGCCCGG - Intergenic
1153996109 18:10442822-10442844 GAGGCTGGGGGAGGCCATCATGG + Intergenic
1156447909 18:37250496-37250518 GAGGTGGAAGGGGGACCTCAGGG - Intronic
1158555871 18:58474220-58474242 GAGACGGGAGGGTGACTTCAGGG + Intergenic
1159901645 18:74052865-74052887 GAGGCGGATGGGAGACTCCAGGG + Intergenic
1160300618 18:77674498-77674520 AAGGCGGGTGGGCTGCATCATGG - Intergenic
1161267114 19:3369511-3369533 GCGGGGGGTGGGGGGCATCTCGG + Intronic
1161439228 19:4280924-4280946 GAGGGGGCTGGGGGACTGCAGGG - Intronic
1162849213 19:13417655-13417677 GAGGCGGGTGGATCACAACAAGG + Intronic
1163183357 19:15619325-15619347 AAGGAGGGTGGGGGGCATAAAGG - Intronic
1163721180 19:18898974-18898996 GAGGTGGGTGGGTGGCAGCAGGG - Intergenic
1164810247 19:31149501-31149523 GAGGCGGGAGGGGCACAGCCAGG + Intergenic
1165395423 19:35561101-35561123 CAGGCGAGTGTGGGACATGAGGG - Intronic
1165419817 19:35717347-35717369 GAGGCGGGTGGCCGAAAGCAGGG - Intergenic
1166311785 19:41967202-41967224 GAGGGGGGCGGGGGGCAGCAGGG - Intronic
1166802891 19:45469064-45469086 TAGGCAGGTGGGGGAAATCCCGG + Intronic
1167119900 19:47510633-47510655 GAGGTGGCTGGGAAACATCAGGG + Intronic
1168254803 19:55159497-55159519 GTGGAGGGTGGGGAACATCCTGG - Intronic
1168381395 19:55926712-55926734 GAGGGTGGTGGGGGAAATCTTGG + Intronic
927781022 2:25939455-25939477 CAGGCGGGTCGGGGACAGCATGG - Intronic
927880030 2:26683821-26683843 GAGGCAGTTGGGGGACATGAAGG - Intergenic
928640278 2:33290816-33290838 GAGGTACCTGGGGGACATCAAGG + Intronic
929151341 2:38751570-38751592 GAGGAGGGGGCGGGACAGCATGG - Intronic
932815735 2:74860174-74860196 TAGGAGGGTGGGGGGCATGAGGG + Intronic
934660485 2:96140972-96140994 TGGGTGGGTGGGGGACATCTGGG - Intergenic
934784760 2:96996921-96996943 GAAGCGGGTGGGGAACACAAAGG + Intronic
938537442 2:132257509-132257531 GAGGTGAGTGGGGGAAAGCAAGG - Intronic
938764375 2:134450592-134450614 GAGGAGGGTGGGGGGCACCCGGG + Exonic
946134317 2:217633341-217633363 AAGGCAGGTGGGGGAAATCTGGG + Intronic
947727885 2:232410957-232410979 CAGGAGGGTGGGGGACATGGGGG + Intergenic
948315848 2:237027626-237027648 GTGGCCGGTGGGTGACATGAAGG + Intergenic
948455984 2:238104857-238104879 GAGGTGGGAAGGGGACATCCAGG + Intronic
948503433 2:238411245-238411267 GGGGCAGGTGGGGGGCGTCAAGG + Intergenic
948660936 2:239506029-239506051 GTGGGGGGCGGGGGGCATCACGG + Intergenic
948896578 2:240930493-240930515 GAGGTAGGTTGGGGACACCAAGG + Intronic
1169437072 20:5602171-5602193 GAGGAGGCTGAGGGACAGCAAGG - Intronic
1170604065 20:17862964-17862986 CAGGAGGGTGGGGCACAGCAGGG - Intergenic
1171030072 20:21669167-21669189 GAGGGGTGTGGTGGACAGCAAGG - Intergenic
1172100424 20:32481899-32481921 GAGGTGTTTGGGGGACCTCATGG - Intronic
1172949422 20:38713192-38713214 GAGGAGGGTGGAAGACATCTTGG + Intergenic
1175265876 20:57703250-57703272 GATGGGGGTGGGGGACATCAGGG + Intronic
1175872693 20:62215922-62215944 GAGCCGGGTAGGGGGCAGCAGGG + Exonic
1176124830 20:63470767-63470789 CAGCCAGGTGGGGGCCATCAGGG + Intronic
1181004012 22:20001099-20001121 TTGGGGGGTGGGGGACATCTTGG + Intronic
1181027271 22:20133259-20133281 GAGGTGGGTGGGGGGCAGCCTGG + Intronic
1182109837 22:27715310-27715332 CAGGCGGGTGGGGGACAGAAGGG - Intergenic
1182328895 22:29536324-29536346 GAGGCCGGTGGGGGCCATGCAGG + Intronic
1182551111 22:31101122-31101144 GAGGCGGGTGGGGGAAGTAAGGG + Intronic
1182754569 22:32668476-32668498 GAGGAGGGAGGGGGAAATGAGGG - Intronic
1182994676 22:34801314-34801336 CAAGCGGCTGGGGAACATCAAGG + Intergenic
1183383122 22:37500435-37500457 TAGTCAGGTGGGGGACAGCAAGG - Intronic
1183668093 22:39256569-39256591 GAGTCGGATGGGGGACATCCGGG + Intergenic
1184019255 22:41809523-41809545 GAGGAGGGTGAGGGGCATCCTGG + Intronic
1184129338 22:42508540-42508562 GAGGCTGGCTGGGGCCATCACGG + Intergenic
1184139535 22:42570633-42570655 GAGGCCGGCAGGGGCCATCACGG + Intronic
1185296973 22:50059138-50059160 GGGGCTGGTGGGGGACTTGAAGG + Intergenic
950164100 3:10780580-10780602 GATGCGGGTGGCCTACATCAGGG - Intergenic
950256751 3:11512214-11512236 GAGGGGTGTGGGGGACCTCTGGG - Intronic
950717956 3:14863021-14863043 GAGGCGGGTGGGGGACATCAGGG - Intronic
954619280 3:51986417-51986439 GAGGAGGTTGGGGGTCACCAAGG + Exonic
954634514 3:52064403-52064425 TAGCTGGGTGGGGGAAATCAAGG - Intergenic
954671163 3:52292041-52292063 GGGCCGGCTGGGTGACATCATGG + Intronic
956776927 3:72572741-72572763 GAGGCTGAAGGGGGCCATCAAGG + Intergenic
962274229 3:134000135-134000157 GAGAAGGGAGGGTGACATCAGGG + Intronic
966133410 3:176670635-176670657 GAGGCAAGTGGGGGACCACAGGG - Intergenic
966881539 3:184353764-184353786 GGTGCGTGTGGAGGACATCATGG - Exonic
967113612 3:186317579-186317601 GGGCAGGGTGGAGGACATCATGG - Intronic
967145900 3:186605731-186605753 GAGGCAGGTGCTGGAAATCAAGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969306136 4:6327284-6327306 GAGGCGGGTGGGGGACCACTAGG + Intronic
969636136 4:8370425-8370447 GAGGCGGTTGGGGGAAAGCGGGG + Intronic
972726908 4:41752417-41752439 GAGGCGGGTGGGTAACAGGATGG + Intergenic
976130984 4:81883650-81883672 GAGGCAGGTGGGAGAAGTCAGGG + Intronic
977209639 4:94204802-94204824 GAGGCGGGTTGGGGGCATCAAGG - Intergenic
980194066 4:129565270-129565292 GAGTTTGGTGGGGGACATCAGGG + Intergenic
985512480 5:320623-320645 GGGGCGGGTTGGGGGCGTCAGGG + Intronic
985827647 5:2204892-2204914 GAGGCTGGTGGGGGTTATCTGGG + Intergenic
987050328 5:14143308-14143330 GAGGGGGGAGGGGGAAATCACGG - Intergenic
990532769 5:56690068-56690090 GAGGCTGGGGGAGGACAGCAAGG - Intergenic
992456638 5:76922454-76922476 GAGGTGGGAGGGAGACATTATGG - Intergenic
997476009 5:134142955-134142977 GGGGCAGGTGGGGTGCATCAGGG - Intronic
997551353 5:134756175-134756197 GAGGCGGGTGGATCACATGAGGG - Intergenic
998940834 5:147280434-147280456 GAGGGGGGTGGTGGAAAGCACGG + Intronic
1001382453 5:171313498-171313520 GAGGCGGGTGGGGGTGCTCGTGG - Intergenic
1002448174 5:179302724-179302746 GAGGGGGGCGGGGGACTTCCTGG + Intronic
1002805860 6:573387-573409 GAGGCAGGTGGGAGGCAGCAGGG - Intronic
1002878524 6:1232514-1232536 GAGGCGGGTGGGTGACATGTGGG - Intergenic
1002900680 6:1407368-1407390 GAGGAGGGTGGGGGACACTCAGG + Intergenic
1003563663 6:7204290-7204312 GGGGCGGGGGGAGGACAGCAAGG - Intronic
1004745191 6:18502270-18502292 GGTGCAGGTGTGGGACATCAGGG + Intergenic
1005930483 6:30480697-30480719 GAGGCTGGTTGCGGAGATCAGGG - Intergenic
1006132073 6:31875720-31875742 GAGGTGGGGTGGGGACAGCAGGG + Intronic
1007643746 6:43364435-43364457 TAGGCGGGTGGGGGAGAGCTGGG - Intronic
1012474180 6:99603295-99603317 GAGGCGCGGGTGGGACATTAAGG - Intergenic
1015280023 6:131423118-131423140 AAGGCAGGAGGAGGACATCATGG - Intergenic
1017367033 6:153655130-153655152 AAGGTGGATGGGGGAAATCAGGG - Intergenic
1017604965 6:156123964-156123986 AAGCAGGGTGGGGGACTTCAAGG + Intergenic
1018268971 6:162055594-162055616 GAGGAGGGAGGGTGGCATCAAGG + Intronic
1018908377 6:168088155-168088177 GAAGCTGGTGGGGGACGTCAGGG + Intergenic
1019437301 7:1028679-1028701 GAGGCAGATGGGGGAGATGAGGG - Intronic
1019631367 7:2051619-2051641 GGGGGAGGTGGGGGACAGCAAGG - Intronic
1021898118 7:25256816-25256838 GAGGAGAATGGGAGACATCAAGG + Intergenic
1021928276 7:25554104-25554126 GAGGAGGATGGGGGACACGAGGG - Intergenic
1023411656 7:39894301-39894323 GAGGCAGGTGGGGGAGGTCCAGG - Intergenic
1024331443 7:48159556-48159578 GAGGCAGGTGGCTGACATCAGGG + Intergenic
1024432181 7:49301758-49301780 GGGGCTGGTGAGTGACATCAGGG + Intergenic
1024574722 7:50754424-50754446 GTGGCAGGTGGGGGAGGTCACGG + Intronic
1025143422 7:56484169-56484191 GAGTCGGGAGGGGGACAGGAGGG + Intergenic
1027128279 7:75572823-75572845 GGGGCGGGTGCGGGGCAGCAGGG - Intronic
1028985084 7:97003232-97003254 GTGGGGGGTGGGGGACAGAAGGG - Intergenic
1030982970 7:116208505-116208527 GGGGCTGGTGGTGGACATAAAGG - Intergenic
1032077860 7:128844583-128844605 GAGTTGGGTGGGGGCCATGAAGG + Intronic
1032178007 7:129648752-129648774 GAGGCGGGAGAGGGACAGAAAGG - Intronic
1033605981 7:142928909-142928931 GAGTGGGGATGGGGACATCAGGG - Intronic
1033657045 7:143381468-143381490 GGGGCGAGTGGGGGTCACCAAGG + Intronic
1034274833 7:149819518-149819540 GAGGCGGCTGGGGGAGACCAGGG + Intergenic
1034678972 7:152913590-152913612 GGGGAGGGGAGGGGACATCATGG + Intergenic
1035323605 7:158050724-158050746 GAGTCGTGTGGGGGACAGAATGG - Intronic
1035483807 7:159206854-159206876 GAGAGAGGTGGGGGACAGCATGG + Intergenic
1035483830 7:159206979-159207001 GAGAGAGGTGGGGGACAGCATGG + Intergenic
1035604325 8:919736-919758 GAGGCGGGTGGTGGCGAGCACGG - Intergenic
1036226236 8:6960141-6960163 GAGGAGGGTGAGGGTCCTCATGG + Intergenic
1036234827 8:7029469-7029491 GAGGAGGGTGAGGGTCCTCATGG + Intergenic
1036648592 8:10627451-10627473 AAGTAGGATGGGGGACATCAGGG + Intronic
1037831427 8:22191962-22191984 AAGGCGGGCGGTGGTCATCATGG + Intronic
1039198841 8:35063592-35063614 GAGGCGGGTGGGTCACTTGAGGG + Intergenic
1041063868 8:54062087-54062109 GAGGCGGGTGGGTCACCTGAAGG - Intronic
1044616750 8:94150291-94150313 GAGTGGGGTGGGGGACGGCAGGG + Intronic
1045556775 8:103222028-103222050 GTGGCGGGTGGGGGGCTTCCAGG + Intronic
1048046436 8:130777587-130777609 GAGTCCGGAGGGGGACATGAAGG - Intergenic
1053131609 9:35618667-35618689 GAGGAGGGTGGGGCAGATCAGGG - Intronic
1056513520 9:87328464-87328486 GAAGGGGGTGGGGCAGATCAGGG + Intergenic
1057059610 9:91991784-91991806 GAGGCGGGTGGGGGGCAGGCTGG - Intergenic
1057587901 9:96346037-96346059 CAGGTGGGTGGGCCACATCATGG - Intronic
1060109190 9:120894514-120894536 GAGGCGGGTGGGAGGCGTCGTGG - Intronic
1061301698 9:129709360-129709382 GAGGTTTGTGGGGGACATGAGGG + Intronic
1061768215 9:132896306-132896328 GAGACGGGTGAGGGCCATCTAGG + Exonic
1062627759 9:137450886-137450908 GAGGCGTGGGGGGGAGATCAAGG - Intronic
1189315562 X:40053678-40053700 GTGGGGGGTGGGGCACAGCATGG - Intronic
1189379071 X:40488965-40488987 GAGGAGGGTGGGGGTGATCCAGG - Intergenic
1190340455 X:49291839-49291861 GATGCGGGTGGGTGATAGCAGGG - Intronic
1190626882 X:52345384-52345406 GATGTGGGTGGGTGACAGCAGGG - Intergenic
1190701108 X:52990423-52990445 GATGTGGGTGGGTGACAGCAGGG + Intronic
1190929163 X:54933801-54933823 GAGGTAGGTGGGGGACTCCATGG - Exonic
1197684832 X:129427886-129427908 GAAGGGGGTGGGGCACAGCAAGG + Intergenic
1199927192 X:152480080-152480102 GGGGCTGGTGGAGGACTTCAAGG + Intergenic