ID: 950718767

View in Genome Browser
Species Human (GRCh38)
Location 3:14867895-14867917
Sequence GTCACCCTGTGGGCCCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950718758_950718767 17 Left 950718758 3:14867855-14867877 CCTCAGAAGAGCAGACCAGGGAA 0: 1
1: 0
2: 1
3: 32
4: 281
Right 950718767 3:14867895-14867917 GTCACCCTGTGGGCCCCGGGAGG 0: 1
1: 0
2: 2
3: 11
4: 152
950718755_950718767 20 Left 950718755 3:14867852-14867874 CCACCTCAGAAGAGCAGACCAGG 0: 1
1: 0
2: 0
3: 14
4: 213
Right 950718767 3:14867895-14867917 GTCACCCTGTGGGCCCCGGGAGG 0: 1
1: 0
2: 2
3: 11
4: 152
950718761_950718767 2 Left 950718761 3:14867870-14867892 CCAGGGAAGGTGTGATTGAGGAG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 950718767 3:14867895-14867917 GTCACCCTGTGGGCCCCGGGAGG 0: 1
1: 0
2: 2
3: 11
4: 152
950718754_950718767 23 Left 950718754 3:14867849-14867871 CCACCACCTCAGAAGAGCAGACC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 950718767 3:14867895-14867917 GTCACCCTGTGGGCCCCGGGAGG 0: 1
1: 0
2: 2
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950718767 Original CRISPR GTCACCCTGTGGGCCCCGGG AGG Intronic
900138590 1:1129164-1129186 GTCACCCTGTGGCCCCCTCCAGG - Intergenic
900410464 1:2510317-2510339 GCCACTCTGTGGCCCCTGGGAGG + Intronic
901201838 1:7471614-7471636 GTCACCCAGTGGGTCAGGGGAGG + Intronic
901236749 1:7671352-7671374 GTCACCCTTTGGGCTGAGGGTGG - Intronic
903334915 1:22618445-22618467 GTCAACCTGTGAGCTCCAGGGGG + Intergenic
903575580 1:24337730-24337752 GTCACCCTGCGGACCCCAGCAGG + Exonic
903860282 1:26360591-26360613 GTCACACTTTGGGCCCCGCGCGG - Intergenic
904068389 1:27773231-27773253 GTCAGCCTGCGGGTCCCGGCTGG + Exonic
905422807 1:37859791-37859813 GACACCCTCCGGGCCCCGCGTGG - Intergenic
905670049 1:39785522-39785544 GGCAGCCTGTGGGACCCAGGGGG - Intronic
906479102 1:46188801-46188823 GTCAGCATGTGGGCCCCAGCTGG + Exonic
906511444 1:46412350-46412372 GCCAGACTGTGGGCCCCGAGAGG - Intronic
906960493 1:50416850-50416872 GTCACCCTGCGGGGAGCGGGAGG + Intergenic
907316748 1:53577217-53577239 GTCAGCCAGAGGGCCCCAGGGGG - Intronic
912340418 1:108908940-108908962 GTCTCCCTGTGTGCCCAGGTCGG - Intronic
912555090 1:110510224-110510246 GTCAGCCTTTGTGCCCCTGGAGG - Intergenic
912569153 1:110608625-110608647 GTCATCCTTTGGGCCCACGGAGG - Intronic
915270200 1:154748264-154748286 GGCAGACTGAGGGCCCCGGGCGG - Intronic
916247656 1:162705055-162705077 GTCTCCCTCTGGGTCCTGGGAGG - Exonic
920032372 1:203045198-203045220 GCCTCCCTCTGGGCCCCAGGAGG - Intronic
922175605 1:223194947-223194969 GTCACACTGAGGGCCCAGTGAGG + Intergenic
924539959 1:244970949-244970971 TCCAGGCTGTGGGCCCCGGGGGG + Exonic
1064167789 10:13001578-13001600 GCCGCCCCGTGCGCCCCGGGAGG - Exonic
1066200237 10:33137343-33137365 GCCAGGCTGTGGGCCCCTGGGGG + Intergenic
1066372433 10:34828728-34828750 TTCACCATGTTGGCCCCGGCTGG - Intergenic
1069834938 10:71302431-71302453 CTGACCCTGTGGGCTCAGGGAGG - Exonic
1070781181 10:79138233-79138255 CTGACCCTGTGGGCTCCTGGGGG - Intronic
1074852207 10:117448021-117448043 GTCTCCCTGTGGGCACCTGAGGG + Intergenic
1076433660 10:130424894-130424916 GTCAGCCTGTGGGCCCAGGCAGG + Intergenic
1076443352 10:130495515-130495537 GGAACCCTGTGGGCACAGGGTGG + Intergenic
1076849589 10:133086442-133086464 GTCAGCCTGTGTCTCCCGGGAGG - Intronic
1077286251 11:1767314-1767336 TTCACCCTTGGGGCCCCGAGAGG - Intergenic
1077645026 11:3916026-3916048 ATCACCCTGTGGGCCCAGGCTGG - Intronic
1078060420 11:8039450-8039472 CTCACTCTGTGGGCCCCGGATGG - Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1081418804 11:42847431-42847453 GTCACCCTGTGGAACTGGGGGGG - Intergenic
1083459199 11:62799586-62799608 GTCACCCTGTTTGGCCCCGGTGG - Intronic
1084497824 11:69515308-69515330 GTCACCATGTGGGGAGCGGGAGG - Intergenic
1085350217 11:75793425-75793447 GTCACCCAGTGGGCCCCAGGTGG - Intronic
1092887806 12:12940689-12940711 GTGACTCTGTGGGCCCCCGTGGG + Intergenic
1102489872 12:113283867-113283889 GTCTCCCTGTGTGCCCAGGCTGG + Intronic
1102772879 12:115493880-115493902 GACCCCCTCTTGGCCCCGGGGGG - Intergenic
1103059446 12:117847140-117847162 GAGACCCTGTGGGCTCCGGGAGG + Intronic
1104667210 12:130656126-130656148 GTTTCTGTGTGGGCCCCGGGAGG + Intronic
1104752515 12:131248645-131248667 GTCAGCCTGTGGGCACAGTGAGG + Intergenic
1104791009 12:131482221-131482243 CTCACTCTGCTGGCCCCGGGAGG + Intergenic
1104927530 12:132321516-132321538 GACAGCCTGTTGGCCCCGGAAGG - Intronic
1105449677 13:20488070-20488092 GTCACTCTGTTGGCCCAGGCTGG - Intronic
1105815948 13:24036560-24036582 GTCTCCCTGTGGGCCCCAGGTGG - Intronic
1106463598 13:29993783-29993805 GCCACCCTGAGGGCACCAGGAGG + Intergenic
1107990875 13:45818127-45818149 GTCTCCCTGGGGACCCTGGGAGG - Intronic
1113788510 13:113015421-113015443 GGCACCCTGATGGCCCAGGGTGG - Intronic
1113944337 13:114035415-114035437 GTCACCCATGGGGCCCTGGGCGG + Intronic
1116287790 14:42994580-42994602 GTCTCCCTGTGCTCCCCTGGTGG - Intergenic
1116793881 14:49368319-49368341 GTCACCCTTTGGGACCAAGGTGG - Intergenic
1117377599 14:55129844-55129866 GCCAAGCTGTGGGTCCCGGGAGG - Intronic
1118765089 14:68904268-68904290 CTCACCCTCTGAGCCCTGGGTGG - Intronic
1119494107 14:75063926-75063948 CACACCCTGGGGGCCCCTGGCGG + Intronic
1119786662 14:77319683-77319705 GTCACCCTGTGGGACTTGGATGG + Intronic
1121912019 14:97800332-97800354 GGCCCCCTGTGGCCCCCTGGAGG + Intergenic
1122692116 14:103536365-103536387 GTCACACTGTGGGTCACCGGGGG + Exonic
1124367318 15:29081286-29081308 GTCACCCTGTGGGACCAGAGGGG + Intronic
1126042785 15:44609159-44609181 CTCACTCTGTGGGCCCAGGCTGG + Intronic
1129606797 15:77028902-77028924 ATCACCCTGTGGGCCTCAGTGGG - Intronic
1130363270 15:83209486-83209508 GCCTCCCTGTGGGCACGGGGTGG + Intergenic
1132567100 16:628592-628614 GTCCACCTGGGGGCCTCGGGAGG + Exonic
1132634461 16:936499-936521 GGCACCCTGTGGGCTCAGGAAGG + Intronic
1132665216 16:1078407-1078429 CTCTCCCTGTGTGTCCCGGGAGG + Intergenic
1132873448 16:2125518-2125540 GCCTGCCTGTGGGTCCCGGGAGG - Intronic
1134552535 16:15144697-15144719 GCCTGCCTGTGGGTCCCGGGAGG - Intergenic
1139434060 16:66926125-66926147 GTCACCCCATGAGCCCCTGGGGG + Intergenic
1139597742 16:67968189-67968211 CCTCCCCTGTGGGCCCCGGGCGG - Intronic
1141702432 16:85648656-85648678 GGCACGCTGTGGCCCCCAGGGGG - Exonic
1142610609 17:1107710-1107732 GTCTCCCCGTGGGCTCAGGGAGG - Intronic
1143181684 17:4987592-4987614 GTCACCCGCGGGACCCCGGGAGG - Intronic
1145273634 17:21417639-21417661 CTCACACTGTGGGCCCAGTGGGG - Exonic
1145311829 17:21705081-21705103 CTCACACTGTGGGCCCAGTGGGG - Intergenic
1152335954 17:79700381-79700403 GGCTCCCTGTTGTCCCCGGGCGG - Intergenic
1152377689 17:79927226-79927248 GTCACCATGGTGGGCCCGGGGGG - Intergenic
1152642831 17:81456342-81456364 GCCACCCTGTGGGCCACGGAGGG - Exonic
1153781195 18:8496239-8496261 GCCTCCCTGTGTGCCCTGGGCGG + Intergenic
1154132978 18:11751923-11751945 GTCGCCCTCTGGGACCCCGGTGG + Intronic
1155655318 18:28185345-28185367 GTCACACTGTGCTCCGCGGGGGG + Intergenic
1155928964 18:31685627-31685649 GTCACCGCGGGGTCCCCGGGCGG - Intronic
1157623010 18:49026915-49026937 GGGACACTGTGGGCCCAGGGAGG + Intergenic
1160453765 18:78981284-78981306 GGCGCCCTGGGGGCCCCGCGGGG - Intronic
1160760348 19:781078-781100 GCCGCCCTGTGGGGCCCCGGAGG + Intergenic
1161995831 19:7710683-7710705 GCCAGACTGTGGGCCCCAGGAGG + Intergenic
1162464458 19:10831682-10831704 GCCACCCTGGGGGACCCAGGAGG - Exonic
1162948018 19:14055143-14055165 GTCCCCCTCTGAGCCCAGGGAGG - Exonic
1163720716 19:18896908-18896930 GTGACCCTGGGGAACCCGGGGGG + Intergenic
1165153973 19:33776686-33776708 GTCCCCCTGTGGGCCCCTCCGGG + Intergenic
1166099924 19:40565803-40565825 GTCACCCTCTGGGCCTTGGCTGG - Intronic
1166271854 19:41719406-41719428 GTCAGGCTGTGGGCCACAGGTGG - Intronic
925036233 2:688557-688579 GTCACCCTGTGGACTCCCTGTGG - Intergenic
925046719 2:778016-778038 CTCAGCCTGTGGGGCCCAGGAGG - Intergenic
927855494 2:26525083-26525105 TTCACCTTGGGGGCCCCTGGTGG + Intronic
936851132 2:116899570-116899592 GTCACACTGTGTGGCCAGGGTGG + Intergenic
937047263 2:118858492-118858514 GTCGCCCTGCGGGCTCCAGGTGG + Intergenic
938058295 2:128233226-128233248 GTCCCGCTGTGCTCCCCGGGAGG - Intergenic
944857659 2:203784106-203784128 GTAACCCTGTGGGCCTGAGGGGG + Intergenic
946322564 2:218962171-218962193 GTCTTTCTTTGGGCCCCGGGAGG + Intergenic
947793623 2:232881106-232881128 GTTCCCCTGGGGGCCCCGAGGGG + Intronic
948516082 2:238504686-238504708 GTCATCATGCGGGCCGCGGGGGG + Intergenic
1169193144 20:3670242-3670264 GGCACCACCTGGGCCCCGGGTGG - Intronic
1173202217 20:40962430-40962452 GTCACTCTGTGGGGCCCAGGTGG - Intergenic
1173670672 20:44796532-44796554 GTCACACTGTGAGCCCCTGCAGG - Intronic
1173927708 20:46793031-46793053 GTCACCCAGAGGGCCCCAGTGGG - Intergenic
1175329108 20:58150525-58150547 GTGACCCTGGGGGCCACTGGGGG + Intergenic
1175775686 20:61652061-61652083 GGCAGCCTGTGGTCCCAGGGAGG + Intronic
1176427985 21:6560496-6560518 GGCACCCTGGGGCTCCCGGGAGG - Intergenic
1179452644 21:41476146-41476168 ATCAGCCAGTGGGACCCGGGAGG - Intronic
1179703476 21:43168813-43168835 GGCACCCTGGGGCTCCCGGGAGG - Intergenic
1179882541 21:44299674-44299696 GGCGCCCTGAGGGCCCCTGGGGG + Intergenic
1179940900 21:44638475-44638497 CTCACCCTGTGCCCCCCCGGGGG - Intronic
1180075727 21:45460513-45460535 GTCACCATGATGGCCCCGAGGGG + Intronic
1181268183 22:21643066-21643088 GTCTCTCTGGGGGCTCCGGGAGG - Intronic
1181952134 22:26562125-26562147 GCCACCCTGTGGCCCCCGCCGGG - Intronic
1183213622 22:36465762-36465784 GACACCCAGTGAGCCCAGGGTGG - Intergenic
1183605368 22:38864610-38864632 GCCACGCTGTGGGCCCTGGCAGG + Exonic
1184294502 22:43515208-43515230 CTGACCCTGTGGGCACTGGGTGG + Intergenic
1185108896 22:48889932-48889954 GTCACCCTGATGGGCCCAGGTGG + Intergenic
950718767 3:14867895-14867917 GTCACCCTGTGGGCCCCGGGAGG + Intronic
961216404 3:125163853-125163875 CTCACCCTGTGTGCTCCAGGAGG + Intronic
961627842 3:128275964-128275986 GAGACCCTGTGGGCCCCTGGAGG - Intronic
963369232 3:144377084-144377106 GTTACTCTTTGGGCCCCGCGCGG + Intergenic
966868795 3:184276873-184276895 GTCCCCCTGTGTTCCCCAGGTGG + Exonic
967555258 3:190849353-190849375 GACTCCCTGTGGGCCAGGGGTGG + Intergenic
967984591 3:195085606-195085628 GTCATCCTGCGGGCCGCGGTGGG + Intronic
968493143 4:901256-901278 CTCTCCCTGTGTGCCCTGGGTGG - Intronic
969241494 4:5901652-5901674 GACACCCTGTGGGCCAGGTGTGG - Intronic
972336519 4:38111725-38111747 GTCAGCCTGAGGACCCCTGGAGG - Intronic
985037899 4:185859728-185859750 GTCACCCATTGTGCCCTGGGCGG - Intronic
985702032 5:1379248-1379270 GGCCCCCTGTGGGCACCTGGCGG + Intergenic
985725632 5:1514513-1514535 GACCACCTGTGGGCCCCGTGTGG - Intronic
997609716 5:135207075-135207097 TCCACCCTCTGGGCCCCAGGAGG - Intronic
1000765824 5:165287084-165287106 GTCAGTCTTTGGGCCCCAGGTGG - Intergenic
1001478188 5:172065792-172065814 GTCACCTTGTCAGCCCCTGGAGG + Intronic
1007402947 6:41614907-41614929 GTCCCCTGGTGGGCCCCAGGTGG - Intergenic
1008065937 6:47048202-47048224 GGCACCCTGTGGGCCCCATCTGG + Intergenic
1013007286 6:106085696-106085718 GTCAGCCTGTGGGTTCTGGGAGG + Intergenic
1019617348 7:1971052-1971074 GGCTGGCTGTGGGCCCCGGGTGG - Intronic
1019922967 7:4174509-4174531 TGCACCCTGTGTGCCCCTGGTGG - Intronic
1020278775 7:6639460-6639482 GTCACCCACTGGGGCCCAGGGGG + Intronic
1022515609 7:30973434-30973456 GTCACCCAGTGGCACACGGGTGG + Intronic
1032443495 7:131960441-131960463 TGCACACTGTGGGCCCCTGGGGG + Intergenic
1034197747 7:149261558-149261580 TTCACCAGGCGGGCCCCGGGAGG + Intergenic
1034977817 7:155458294-155458316 GTCTCCGTGTGCGCCGCGGGAGG + Exonic
1035212804 7:157341015-157341037 ATCACCCTGTGTGCCCAGGCTGG + Intronic
1035308992 7:157952978-157953000 CTCACCCTGTGGGCCAATGGAGG - Intronic
1036802567 8:11803079-11803101 TTCCCCCTGTAGGGCCCGGGTGG + Intronic
1042192734 8:66204289-66204311 GTCAGCCTGTGGGGCCAAGGAGG + Intergenic
1049552586 8:143267381-143267403 GGGACGCTCTGGGCCCCGGGAGG - Intronic
1049646485 8:143738106-143738128 TTCACCCTGAGGGCCCCCTGGGG + Intergenic
1053182330 9:35983843-35983865 GTCACCCTTAGGGCCTCTGGAGG - Intergenic
1053463487 9:38288560-38288582 TGCACCCTGTGGGCCTGGGGAGG - Intergenic
1055757272 9:79570825-79570847 GTAACCGTGGGGGCTCCGGGTGG - Intergenic
1055785518 9:79865468-79865490 CTCACACTGTGGGCCCCTGATGG + Intergenic
1059176775 9:112175270-112175292 TGCACCCTGAGGGCCCCGGGAGG - Intronic
1060962074 9:127688114-127688136 GGGACCCTGTGGCCCCTGGGAGG - Intronic
1060990015 9:127843196-127843218 TTCAGCCTGTGGGCCCCGAGAGG - Exonic
1061261440 9:129482820-129482842 GTCACCCCGCGGGGCCCGGCGGG + Intergenic
1062399197 9:136365091-136365113 GTCACCCTGAGGCCCACGGCTGG + Intronic
1062710668 9:137973516-137973538 GCCATCCTGTGAGCCCCTGGGGG + Intronic
1185615512 X:1419416-1419438 TTCACCCTGGAGGCTCCGGGTGG + Intronic
1189915585 X:45851866-45851888 GGCACCCTCTGGGCCACGGAAGG - Intergenic