ID: 950718767

View in Genome Browser
Species Human (GRCh38)
Location 3:14867895-14867917
Sequence GTCACCCTGTGGGCCCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950718754_950718767 23 Left 950718754 3:14867849-14867871 CCACCACCTCAGAAGAGCAGACC 0: 1
1: 0
2: 0
3: 16
4: 174
Right 950718767 3:14867895-14867917 GTCACCCTGTGGGCCCCGGGAGG 0: 1
1: 0
2: 2
3: 11
4: 152
950718761_950718767 2 Left 950718761 3:14867870-14867892 CCAGGGAAGGTGTGATTGAGGAG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 950718767 3:14867895-14867917 GTCACCCTGTGGGCCCCGGGAGG 0: 1
1: 0
2: 2
3: 11
4: 152
950718758_950718767 17 Left 950718758 3:14867855-14867877 CCTCAGAAGAGCAGACCAGGGAA 0: 1
1: 0
2: 1
3: 32
4: 281
Right 950718767 3:14867895-14867917 GTCACCCTGTGGGCCCCGGGAGG 0: 1
1: 0
2: 2
3: 11
4: 152
950718755_950718767 20 Left 950718755 3:14867852-14867874 CCACCTCAGAAGAGCAGACCAGG 0: 1
1: 0
2: 0
3: 14
4: 213
Right 950718767 3:14867895-14867917 GTCACCCTGTGGGCCCCGGGAGG 0: 1
1: 0
2: 2
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950718767 Original CRISPR GTCACCCTGTGGGCCCCGGG AGG Intronic