ID: 950718944

View in Genome Browser
Species Human (GRCh38)
Location 3:14868820-14868842
Sequence TGCCTGGCTCATTGTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950718939_950718944 30 Left 950718939 3:14868767-14868789 CCTCTTCTTCCACAGAAACTTAT 0: 1
1: 0
2: 2
3: 58
4: 454
Right 950718944 3:14868820-14868842 TGCCTGGCTCATTGTCAGGGAGG 0: 1
1: 0
2: 0
3: 22
4: 163
950718940_950718944 21 Left 950718940 3:14868776-14868798 CCACAGAAACTTATTTATTAAAT 0: 1
1: 0
2: 6
3: 78
4: 1458
Right 950718944 3:14868820-14868842 TGCCTGGCTCATTGTCAGGGAGG 0: 1
1: 0
2: 0
3: 22
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950718944 Original CRISPR TGCCTGGCTCATTGTCAGGG AGG Intronic
900409668 1:2506960-2506982 TGCCTGGCTCATAGGCTGGGTGG + Intergenic
901144768 1:7057435-7057457 GGCTTGGCTGATTCTCAGGGCGG + Intronic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
904679697 1:32220803-32220825 TGACTTGCTCATGGTCAGGTAGG + Intronic
905050167 1:35043722-35043744 AGCCTGGGACATTGGCAGGGAGG - Intergenic
905304561 1:37008532-37008554 TGTCTGGGCCAATGTCAGGGAGG - Intronic
906859295 1:49341838-49341860 TGCCTGTCGCAGGGTCAGGGAGG - Intronic
907584572 1:55605673-55605695 GCCCTGGCTTTTTGTCAGGGAGG + Intergenic
907714699 1:56916096-56916118 TGCCAGGCTCAGTGGCAGGCAGG + Intronic
907797946 1:57736393-57736415 TATCTGGCTCATTGTCAGGAAGG + Intronic
911891099 1:103373039-103373061 AGACTGGCTCATTGTCACAGTGG + Intergenic
912795665 1:112691966-112691988 GGCCTGGCTCATTTTAATGGGGG + Intronic
912807712 1:112771025-112771047 TGACTGGCTCTTTTCCAGGGTGG + Intergenic
913551980 1:119925126-119925148 TTCCTGGCCCATTGTCAGCAAGG + Intronic
914991363 1:152502133-152502155 TGCCAGGCGCCTTGACAGGGAGG + Intergenic
915072968 1:153287624-153287646 TGCCTGGTTCAGTATTAGGGTGG + Intergenic
915073316 1:153289916-153289938 TGCCTGGTTCAGTATTAGGGTGG + Intergenic
917000095 1:170348128-170348150 TGCCTGGATCATTATCTGAGAGG - Intergenic
917980958 1:180268772-180268794 TGCCTTGCTCACAGCCAGGGTGG - Intronic
919931225 1:202222613-202222635 CCCCTGGCTCATTCTCAGTGAGG - Intronic
920646572 1:207808077-207808099 TGCCCTTCTCCTTGTCAGGGAGG + Intergenic
922727340 1:227928536-227928558 TGCCTCCTTCATTGTCAGGGTGG + Intronic
924822041 1:247502568-247502590 TATCTGGCTCATGGTAAGGGTGG - Intergenic
1062879644 10:967649-967671 CGCCTGGCCCAGTGTCAGGCTGG - Intergenic
1063461044 10:6215282-6215304 TGGCTTCCTCATTGTCGGGGCGG - Exonic
1064364866 10:14698665-14698687 TGCCAGGCTGAATGTCAGGCAGG - Intronic
1070335125 10:75448422-75448444 TGCCTTCCACATTGTCAGGGTGG + Intronic
1072716548 10:97756261-97756283 TCCCTGGCTGACTGACAGGGTGG + Intronic
1075317042 10:121461047-121461069 TGCCTGTCTCAGTGGCAGAGCGG + Intergenic
1080049809 11:27847928-27847950 TGCCTGTTTCCTTTTCAGGGGGG - Intergenic
1080354724 11:31429861-31429883 TACCTGTCTCACTGTTAGGGAGG - Intronic
1081815737 11:45939829-45939851 TGCCTAGCTCATTCTCTGGATGG + Intronic
1082645243 11:55715580-55715602 TTCGTGGCTCATGGTCAAGGTGG + Intergenic
1082646058 11:55727011-55727033 TTCATGGCTCATGGTCAAGGTGG + Intergenic
1084945860 11:72638037-72638059 TTCCTGTCTCCTTGCCAGGGGGG + Intronic
1086389100 11:86342814-86342836 TGCCTGTCTCTTTGCCAGTGGGG + Intronic
1087514348 11:99139107-99139129 TGCCTGGCTAATTTTTGGGGGGG - Intronic
1087572579 11:99948739-99948761 TGCCTGGCACATTCTAAGTGTGG + Intronic
1088222808 11:107587768-107587790 TGCCTGGATCATTTTGTGGGTGG - Intergenic
1088702040 11:112422053-112422075 TTCCTGACTCATGGTCAGGTTGG + Intergenic
1089333224 11:117704551-117704573 AGCCTGGCTGATTGGCAGGGAGG + Intronic
1089648410 11:119895324-119895346 TGGCTGGCTCATCGACAGGTGGG - Intergenic
1090224598 11:125062691-125062713 TGACTGCCACATTGTCATGGCGG + Intergenic
1090830982 11:130420677-130420699 TACCTGGCTCATTGCCTGTGAGG - Intronic
1090834065 11:130441042-130441064 TGCCTGGGTGTTTGTCAGGGAGG + Intergenic
1092349739 12:7746459-7746481 TTCCTGGCTCTTTGGCAGTGGGG - Intronic
1092985080 12:13837446-13837468 TGCCTGGCCCATTTGCAGGCTGG + Intronic
1093016200 12:14156851-14156873 TTCCTGACTCAGTCTCAGGGAGG + Intergenic
1096532246 12:52249362-52249384 TGCCAGGCTCATGGTCAGCCAGG + Intronic
1102255460 12:111412227-111412249 TGCCTGGGCCAGGGTCAGGGAGG + Intronic
1102544228 12:113642988-113643010 TGCTTGGCACATAGTAAGGGTGG + Intergenic
1106221102 13:27747044-27747066 TGCCTGGCTGTTTGTCTGAGTGG + Intergenic
1107321293 13:39191481-39191503 TGCCAGGCTTGATGTCAGGGGGG - Intergenic
1110354465 13:74551243-74551265 TGCCTCGCACATTATCAGAGGGG - Intergenic
1111943145 13:94635276-94635298 TAACTGGCTCTTTGTCAAGGGGG + Intergenic
1112366459 13:98759845-98759867 TTTCTGCCTCATTGACAGGGAGG - Intergenic
1112412992 13:99179779-99179801 TGCATTTCTCATTGTTAGGGAGG - Intergenic
1114694809 14:24616729-24616751 TGCCTGGCTCACTTTTTGGGAGG - Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1117674962 14:58146129-58146151 TGCCAGGCACATTGCCAGGAAGG - Intronic
1118711246 14:68521313-68521335 TGCCTGGCTCATGAGAAGGGAGG - Intronic
1119372358 14:74157792-74157814 AGCCTGGATCAGTGTCAGGAAGG - Intronic
1119933656 14:78570927-78570949 AGCCAGGCTCAGTGTCTGGGAGG + Intronic
1122156735 14:99754469-99754491 TGCCTGGCTCCCTGTGTGGGAGG + Intronic
1122751602 14:103938024-103938046 TGGCTTGCTCATTGGCAGAGAGG - Intronic
1126143368 15:45455208-45455230 AGCCTGGCTCACTTACAGGGTGG - Intergenic
1133267148 16:4592038-4592060 TGCCTGGGGCACTGTCTGGGTGG - Intronic
1134679277 16:16112798-16112820 TGCCAGGCACATTGCCAGGTGGG + Intronic
1143563857 17:7709847-7709869 TGCCTGGGTCATGGTCAGAGAGG - Exonic
1143674479 17:8421888-8421910 TGCTTGGCTAGATGTCAGGGTGG + Intronic
1146533659 17:33631614-33631636 TGCCTGGCACATTGACAGAGAGG + Intronic
1148084869 17:44987958-44987980 TGCCTGGCTCATGCTCACGTGGG + Intergenic
1152401380 17:80068586-80068608 TTCCTGGCTGATGGTCAGGATGG + Intronic
1152638823 17:81441108-81441130 TGCCTGGCCCAGTGCCAGTGGGG - Intronic
1152882900 17:82830507-82830529 TGCCTGGCTTGGTCTCAGGGTGG + Exonic
1153220109 18:2853804-2853826 TGCCAGCCTCCCTGTCAGGGTGG + Intronic
1153267333 18:3284153-3284175 ATCCGGGCTCATTGTCAGGCTGG + Intergenic
1155625829 18:27833554-27833576 TGCACTGCTCATTTTCAGGGTGG + Intergenic
1156617856 18:38809226-38809248 TTGCCAGCTCATTGTCAGGGTGG - Intergenic
1157312182 18:46560609-46560631 TGCCTGGCTCTTTGTTGGGCGGG - Intronic
1157393998 18:47326736-47326758 TGCCTGACTCGGTGTTAGGGAGG - Intergenic
1157499276 18:48178668-48178690 TGCCTGTCGCATCGTCAGAGCGG + Intronic
1157523187 18:48359488-48359510 TGTCTGTCTCACTGTCATGGTGG - Intronic
1160501821 18:79405305-79405327 GGCCTGGCTCTTTGCCAAGGAGG - Intronic
1160587092 18:79918835-79918857 AGCCTGGCCCAGGGTCAGGGCGG - Intronic
1161155737 19:2731246-2731268 TGCCTGGAGCATTGCCATGGGGG - Intronic
1161235509 19:3196253-3196275 TGACTGGCTGATTGCCAGCGTGG + Exonic
1161343772 19:3757254-3757276 TGCCTGGCTAATTTTGGGGGGGG + Intronic
1162331033 19:10029982-10030004 TTCCTGTCTGATTGGCAGGGAGG + Intergenic
1162777952 19:12990893-12990915 TGCGTGTGTCAGTGTCAGGGAGG - Intergenic
1163641227 19:18463250-18463272 GGCCAGGCTGATTGACAGGGAGG + Intronic
1163761647 19:19140166-19140188 GGCCAGGATCATTGTCGGGGAGG + Intergenic
1164699857 19:30277585-30277607 TGCTGGGCTCTGTGTCAGGGTGG + Intronic
1165266796 19:34667783-34667805 GGCCCGGGTCAGTGTCAGGGTGG - Intronic
1166432917 19:42741754-42741776 TGCCTGGCTGATTCCCGGGGAGG + Intronic
1166436021 19:42766980-42767002 TGCCTGGCTGATTCCCGGGGAGG + Intronic
1166448882 19:42880968-42880990 TGCCTGGCTGATTCCCGGGGAGG + Intronic
1166455772 19:42938467-42938489 TGCCTGGCTGATTCCCGGGGAGG + Intronic
1166471703 19:43083947-43083969 TGCCTGGCTGATTCCCGGGGAGG + Intronic
1166482841 19:43187763-43187785 TGCCTGGCTTATTCCCGGGGAGG + Intronic
1166485323 19:43206897-43206919 TGCCTGGCTGATTCCCGGGGAGG + Intronic
1166492471 19:43270815-43270837 TGCCTGGCTGATTCCCGGGGAGG + Intergenic
926694711 2:15763210-15763232 TGCCTTGCCCATGGTCATGGAGG + Intergenic
926703915 2:15822971-15822993 TCCCTGGGGCATTCTCAGGGAGG - Intergenic
927135380 2:20092959-20092981 TGCCTGGCTCAGTGATGGGGAGG - Intergenic
929734202 2:44528231-44528253 TGCCTGGCTCATTCTAAGTTAGG - Intronic
930765905 2:55084891-55084913 TGGTTGGCTGAGTGTCAGGGGGG - Intronic
932601385 2:73128953-73128975 TGCCTGGGTCATTGTGAGGCTGG - Intronic
935198145 2:100832691-100832713 TTCCTGGGTCATTGCCAGGCAGG - Intronic
935524991 2:104154774-104154796 TGCCTGTCATATTGTGAGGGTGG - Intergenic
937336374 2:121064801-121064823 TGCCTTCTTCATTATCAGGGTGG - Intergenic
938251284 2:129817426-129817448 AGGCCGGCTCAATGTCAGGGCGG + Intergenic
938670770 2:133584373-133584395 TGCCTGGCCCTTTGTCAGTGGGG - Intergenic
939832809 2:147092857-147092879 GGCCTGGCTTATTCTCATGGTGG + Intergenic
946503318 2:220273324-220273346 AGCCTGGCTCTTTTCCAGGGTGG - Intergenic
1169998849 20:11592235-11592257 TGCCTGCAACATTGTCATGGAGG + Intergenic
1170570670 20:17630596-17630618 TTCCCGGCTCAGTGTCAGGCAGG + Intronic
1173167431 20:40695351-40695373 TGCCTGGAGCATTGTGATGGGGG - Intergenic
1174417805 20:50379146-50379168 TGCCTGGCTCAGGGTCGGGCTGG - Intergenic
1175514320 20:59559334-59559356 GGCCTGGCAGATTGTCAGGAGGG + Intergenic
1179548721 21:42129286-42129308 TGCCTGGCTCAGTGACATGGTGG - Intronic
1179873892 21:44257816-44257838 TGCCTGGCGCCTTCTGAGGGAGG - Intronic
1180935301 22:19621518-19621540 TGCCTGGCCCAGAGTCACGGAGG - Intergenic
1181021334 22:20104962-20104984 TGCCTGGCCCATGGGCAGCGAGG - Intronic
1181029449 22:20142833-20142855 CCCCTGGCCCATAGTCAGGGAGG - Exonic
1181171254 22:21011514-21011536 GGCCTGGTTCACTGTGAGGGCGG + Intronic
1181178091 22:21049005-21049027 GGCCTGGTTCACTGTGAGGGCGG - Exonic
1181486068 22:23232480-23232502 TGCCTGGCTCTTTGGGAGTGGGG + Intronic
1183331606 22:37225156-37225178 TGGCTGGTTCATTCTCAGGCAGG - Intergenic
1183921431 22:41172207-41172229 TGCCAGGATCAACGTCAGGGTGG - Intronic
949501283 3:4682436-4682458 GGCCAAGCTCATTGTCAGTGTGG + Intronic
950420700 3:12897358-12897380 TGCCAGGCTTCTTGTGAGGGAGG + Exonic
950718944 3:14868820-14868842 TGCCTGGCTCATTGTCAGGGAGG + Intronic
953070301 3:39513748-39513770 TTCATGGCTCAGGGTCAGGGTGG + Exonic
953561107 3:43994833-43994855 TGCCTCCCTTAGTGTCAGGGAGG + Intergenic
954759046 3:52860896-52860918 TGCCTGGCTTACTGTCTGTGAGG - Intronic
955278195 3:57568138-57568160 TACCTGGTTCTTTGTCATGGAGG - Intergenic
955405272 3:58621979-58622001 TGCCTAGCTCAGTGTCAGGTGGG + Intronic
956759246 3:72423759-72423781 TGCCTGGCTAATTGTTTGGGGGG - Intronic
960533536 3:118792368-118792390 TGGCTGGCTGAGTGACAGGGAGG - Intergenic
960559030 3:119062113-119062135 TGCCAGGCTGATTATCAGGTAGG - Intronic
960978412 3:123199614-123199636 TGCCTGGCCAATTTTCAGAGAGG + Intronic
963230317 3:142903022-142903044 TGCTTTGCTCAGGGTCAGGGAGG - Intergenic
972267612 4:37477922-37477944 TCCCTGGCTCCTTTTCAGGTTGG + Intronic
973840059 4:54852241-54852263 TGCATGGCTCATTGCCTGTGAGG + Intergenic
973981440 4:56311381-56311403 TGGCTTCCTCATTGTCTGGGCGG - Intronic
975580271 4:75900824-75900846 TGCCTTGTTCTTTGTCATGGTGG - Intronic
978577557 4:110201649-110201671 TGGCTGGCTCTTTGCCAGCGGGG - Intergenic
988589623 5:32537553-32537575 AGCCTGGCTGATTGTGAGAGAGG + Intronic
996483040 5:123997260-123997282 TGCCTGGCTCAAAGCCAAGGGGG - Intergenic
997194111 5:131966304-131966326 TGAATGACTCATTGTCAGGGGGG + Intronic
999428563 5:151507184-151507206 TGACAGGCTCATTGTCAGAGTGG + Exonic
1005439450 6:25850123-25850145 TGCCTGGGTCATAGGCATGGTGG - Exonic
1008696694 6:54046721-54046743 TCCCTGGCTCATTGGCAATGAGG - Intronic
1009751323 6:67882290-67882312 TGCCTGTCCAATTGGCAGGGAGG + Intergenic
1019704042 7:2488970-2488992 TGCATGGGTCAGTGTCAGGGCGG + Intergenic
1019748735 7:2715440-2715462 TGCCTGGCTCATGCTGAGGGTGG + Exonic
1021215194 7:17907620-17907642 TTCATGGCTTATTTTCAGGGGGG - Intronic
1021435742 7:20613171-20613193 TGCCAAGATCAATGTCAGGGAGG - Intergenic
1024061886 7:45704227-45704249 TGCCTGGCTGGCTGTCGGGGTGG - Intronic
1024534180 7:50416499-50416521 TGCCTGGCACAAGGTGAGGGGGG + Intergenic
1026326455 7:69314819-69314841 TGCCTGGCTAATTTTGGGGGTGG + Intergenic
1029873055 7:103715939-103715961 TGCCTGGCCCATTTTCTAGGAGG + Intronic
1032801519 7:135320687-135320709 CGCCTTGCTCCTGGTCAGGGTGG - Intergenic
1034744140 7:153507395-153507417 TTCCTGGCTGATTGTCAGTGGGG - Intergenic
1037974275 8:23199108-23199130 TGCCTGTCCCCTTGTGAGGGTGG + Intronic
1038446914 8:27610895-27610917 TGCCTCGCTGATTGTCGGGGAGG - Intronic
1039573849 8:38607915-38607937 TGCCTAGCTCAGTGTCTGGCAGG + Intergenic
1040489237 8:47904544-47904566 TGCCTGGCTCACTGCCAAGGTGG + Intronic
1040834467 8:51717887-51717909 TCCCTGGCTAATTATAAGGGGGG + Intronic
1041693556 8:60713853-60713875 TTCCTGGCTCATATTCAGGCAGG - Intronic
1048386967 8:133921149-133921171 TGCCTGGCTAAATTTCAGAGTGG - Intergenic
1049367363 8:142246864-142246886 TGCCTCGCACATTCTCAGGGTGG - Intronic
1049776414 8:144407886-144407908 TGGGTGTCTCATTGTGAGGGAGG + Intronic
1051545402 9:18268694-18268716 AGACTGGCTCATTCTCAGTGTGG + Intergenic
1051813528 9:21077362-21077384 TGCCTGGACCATAGTCAGAGTGG - Exonic
1053397028 9:37784768-37784790 TGCCGGGCTCCTTGTGACGGAGG + Exonic
1056985626 9:91361761-91361783 TGCCCGGCTCGTTGGCAGGCCGG - Exonic
1061495519 9:130971619-130971641 TGACTTTCTCATTGTCTGGGAGG + Intergenic
1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG + Exonic
1190173667 X:48131266-48131288 TGCATGGCTCATTATGAGAGTGG + Exonic
1190444968 X:50515028-50515050 TGCCTGGCTCATGGAGCGGGAGG + Intergenic
1196720968 X:118853437-118853459 TTCCTGCCTGATTGTTAGGGTGG - Intergenic
1199671630 X:150152611-150152633 AGCCTTGCTCATTGCCTGGGAGG - Intergenic
1200148847 X:153941747-153941769 AGCCTCGCTCATTGTTAGGGAGG - Intronic
1201367981 Y:13229259-13229281 TGCCAGGCTAATTTTCATGGAGG - Intergenic