ID: 950719926

View in Genome Browser
Species Human (GRCh38)
Location 3:14875510-14875532
Sequence TGGCATGGAGGAGTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 675
Summary {0: 1, 1: 1, 2: 3, 3: 46, 4: 624}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950719912_950719926 29 Left 950719912 3:14875458-14875480 CCAGAGGTAGGAAAAAATAGAGT 0: 1
1: 0
2: 0
3: 23
4: 255
Right 950719926 3:14875510-14875532 TGGCATGGAGGAGTGGTGGAGGG 0: 1
1: 1
2: 3
3: 46
4: 624
950719911_950719926 30 Left 950719911 3:14875457-14875479 CCCAGAGGTAGGAAAAAATAGAG 0: 1
1: 1
2: 3
3: 54
4: 345
Right 950719926 3:14875510-14875532 TGGCATGGAGGAGTGGTGGAGGG 0: 1
1: 1
2: 3
3: 46
4: 624
950719920_950719926 -9 Left 950719920 3:14875496-14875518 CCTGGAGCTCCATGTGGCATGGA 0: 1
1: 0
2: 2
3: 31
4: 223
Right 950719926 3:14875510-14875532 TGGCATGGAGGAGTGGTGGAGGG 0: 1
1: 1
2: 3
3: 46
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950719926 Original CRISPR TGGCATGGAGGAGTGGTGGA GGG Intronic
900396032 1:2453624-2453646 TGGAAGGAAGGGGTGGTGGAGGG - Intronic
900428569 1:2591677-2591699 TGGCCAGGAGGGGTGGGGGAGGG + Intronic
900493383 1:2964516-2964538 TGGATGGGAAGAGTGGTGGATGG - Intergenic
900569023 1:3349277-3349299 TGTCAGGGAGGAGGTGTGGACGG + Intronic
900742235 1:4337693-4337715 AGGCAGGGAGGAGAGATGGAAGG + Intergenic
900918415 1:5654643-5654665 TGGGGTGGGGGAGTGGGGGAGGG + Intergenic
900991842 1:6101711-6101733 GGCCAGGGAGGAGTGGTGGGGGG - Intergenic
900993429 1:6108135-6108157 AGGGATGGAGGAATGATGGAGGG + Intronic
900993610 1:6108875-6108897 AGGCATGGAGGGATGATGGAGGG + Intronic
901156124 1:7140405-7140427 GGGCTTGGGGGAGGGGTGGAGGG - Intronic
901282776 1:8052149-8052171 GGGCATGGTGGCGTGGTGGCGGG - Intergenic
901527711 1:9834567-9834589 TGGGATGGAGCAGTGGCGGGAGG + Intergenic
902195210 1:14793138-14793160 TGGCATGGAGGAGGCAAGGATGG + Intronic
902263432 1:15244500-15244522 AAGCATGGAGGGGTGGTGGTAGG + Intergenic
902388679 1:16090342-16090364 TGGCATGCAGGAGAGGCTGACGG - Intergenic
902668914 1:17958569-17958591 GGGCATGGAAGATTGGAGGAGGG - Intergenic
902944531 1:19825340-19825362 TGGCAGGGAGGGGTGGGGAAGGG - Intergenic
903996261 1:27307092-27307114 TGGCATGGATGGGTGGGGTAAGG - Exonic
904325875 1:29727290-29727312 TGGGCTGGGGGAGGGGTGGAGGG + Intergenic
904325925 1:29727402-29727424 TGGGCTGGGGGAGGGGTGGAGGG + Intergenic
904433417 1:30479469-30479491 TGGGCTGGGGGAGGGGTGGAGGG - Intergenic
904936043 1:34130463-34130485 AAGCATGCAGGAGTGGTGGGAGG + Intronic
905300679 1:36984606-36984628 TAGCAGGGAGGAGTGGGGCATGG + Intronic
905364103 1:37439402-37439424 TGGCATTGAGGAGTTGCAGAGGG - Intergenic
905885522 1:41489769-41489791 TGGGTTGGAGGAAAGGTGGATGG - Intergenic
906139682 1:43526602-43526624 TGGCATGGAAGAGAGGGGCAGGG + Intronic
907193798 1:52669958-52669980 TGGCATGGAGGAATGTTGGTGGG - Intergenic
907747258 1:57225463-57225485 TGGCATGGGTGGGTGGTGAAAGG - Intronic
908450185 1:64246954-64246976 TGGCCTTGGGGATTGGTGGAAGG + Intronic
910219417 1:84875535-84875557 TCCCATGGTGGAGGGGTGGAAGG - Intronic
912337409 1:108876005-108876027 TGACATGGAGGAGAGGTGAATGG + Intronic
912373285 1:109190162-109190184 TGGCAGTGTGGTGTGGTGGAAGG + Intronic
913018361 1:114762599-114762621 TGGGATGGGGGAGGGGGGGAAGG + Intergenic
913041859 1:115034656-115034678 TGGCATGGAGGTGGGGAGTAAGG + Intergenic
914428748 1:147600656-147600678 TGGGATGCAGGAGTGTTGGAGGG + Intronic
915444634 1:155967697-155967719 TGGCAAGGTGGGGTGGAGGATGG - Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917194720 1:172453096-172453118 GGGCATTGAAGAGTCGTGGAAGG - Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917739945 1:177952395-177952417 TGGCGTGGAGGAGGGCTGCAGGG - Intronic
918418183 1:184334221-184334243 TGGCCAGGAGGAGTGGGGAATGG + Intergenic
918923188 1:190743202-190743224 TGGAATGGAGGAAGGGAGGAAGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919762352 1:201106149-201106171 GGGGATGGAGGTGTGGGGGAGGG - Intronic
920300824 1:204987643-204987665 TGGCATTGTGGAGGGATGGAGGG + Intronic
920427192 1:205887813-205887835 GGTTATGGAGGAGTTGTGGAGGG + Intergenic
920564618 1:206963625-206963647 TGTCATGGAGGAGGGGGGCATGG + Intronic
922788938 1:228299248-228299270 TGGCAGGCAGGGCTGGTGGAGGG - Exonic
922987572 1:229877825-229877847 GGTCATGGAGGAGTGGAGGATGG - Intergenic
924294960 1:242577292-242577314 TCTCATGGAGGATGGGTGGAAGG - Intergenic
924382893 1:243480439-243480461 TGGGATGGATGAATGGGGGATGG + Intronic
924382984 1:243480722-243480744 TGGGATGGATGAATGGGGGATGG + Intronic
924831691 1:247602631-247602653 TGGGATGGGGGACTGGGGGAGGG + Intergenic
1064333837 10:14419799-14419821 TGGCATGGGGGGATGGGGGAGGG + Intronic
1064778850 10:18810772-18810794 AGGAATGGAGGAATGGAGGAAGG - Intergenic
1065434798 10:25695108-25695130 TAGCAAGGAGGGGTGGTGGGTGG - Intergenic
1065473267 10:26105344-26105366 TGGCAGGAATGAGTGGGGGAAGG - Intronic
1065960879 10:30732975-30732997 TGGCATTCAGGACTGGTGGCGGG + Intergenic
1068054245 10:51991521-51991543 TGGGCTGGGGGAGTGGGGGAGGG - Intronic
1069590422 10:69638220-69638242 TGGAGTGGAGGAGGGATGGATGG - Intergenic
1069957243 10:72059748-72059770 TGGAAGGGAGGGGTGGTGGGTGG - Exonic
1070673322 10:78393458-78393480 TGTCATGGAGAAGTCTTGGATGG + Intergenic
1070758521 10:79008638-79008660 GGGCATGTAGGGGTGGTGAAAGG + Intergenic
1071450242 10:85786859-85786881 GGGCGTGGAGGAGGGGTGGTGGG + Intronic
1071530589 10:86388178-86388200 TGGCTTGGATGTGGGGTGGAAGG - Intergenic
1071988690 10:91077650-91077672 AGGCATGGAGGAGTTGAGAAAGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072523386 10:96249889-96249911 TGGCATGGAAGGGTGGAGGGAGG + Intronic
1072740616 10:97906947-97906969 TGGCCTGCAGGAGTGGTGAGTGG - Intronic
1072760081 10:98049350-98049372 TGCCATGGGGCAGTGGTGCACGG + Intergenic
1073449823 10:103602720-103602742 GGACATGGGGGAGTGGTGGCTGG + Exonic
1074888735 10:117717231-117717253 TGACATGGAAGAGGAGTGGAGGG - Intergenic
1074905345 10:117857819-117857841 TGGAAGTGAGGAGTGGAGGAGGG + Intergenic
1075602158 10:123777688-123777710 TGGCAGGCAGGGGTGGTGGGAGG - Intronic
1076235421 10:128860626-128860648 TGTCATGGAAGCGTGGTGGAGGG + Intergenic
1076298703 10:129407278-129407300 GGGCCTGGAGGAGAGGTGGAAGG - Intergenic
1076619520 10:131778348-131778370 GGGCAGGGAGGAGAGATGGAGGG + Intergenic
1076729156 10:132429676-132429698 TGCCAGGGAGGAGGGGTGGATGG - Intergenic
1076786564 10:132752587-132752609 TGGCATGGAGGGGTGTGGCATGG + Intronic
1076845165 10:133066170-133066192 TGGAGGGGAGGAGGGGTGGAGGG + Intergenic
1076879825 10:133234722-133234744 GGGCATGGAGGTGTCGGGGAGGG + Intergenic
1076892795 10:133292999-133293021 GGGCATGGGGCAGTGGTGGGTGG - Intronic
1077310328 11:1885914-1885936 TTGCATGGAGGAGTACTGGTTGG - Intronic
1077481669 11:2817730-2817752 TGCCATGGAGGAGAGGAGGTGGG - Intronic
1077606608 11:3616746-3616768 TGGCATCCAGGAGTGGAGGTGGG - Intergenic
1077828387 11:5835703-5835725 TGGCATGGGGGGCTGGGGGAGGG - Intronic
1078428273 11:11268635-11268657 GGGCAAGAAGGGGTGGTGGAGGG + Intergenic
1078493510 11:11792276-11792298 TGGTATGGAGCAGTGGTGTGAGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081551801 11:44120484-44120506 GGGCAGGGAGGGGTGGTGGTAGG - Intronic
1082011569 11:47453115-47453137 TGGCAGGAAGGAATGGAGGAAGG + Intergenic
1083737111 11:64687644-64687666 TGGCAAGGAGGAGGGAAGGAGGG + Intronic
1083779878 11:64912290-64912312 TGGCATGGGGGTGGGGTGGCTGG - Intronic
1083792383 11:64994375-64994397 TGGGATGGAGAAGAGGTGGCTGG + Intronic
1084097303 11:66920147-66920169 TGGCACAGAGGAGGGGAGGAGGG + Intronic
1085306045 11:75486660-75486682 AGGCATTGAGGATAGGTGGAGGG - Intronic
1085575402 11:77598598-77598620 AGGCATGGAGGCATGGAGGATGG - Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086143564 11:83525680-83525702 ATCCATGGAGGAGAGGTGGAAGG - Intronic
1087158933 11:94930354-94930376 GAGAATGAAGGAGTGGTGGAAGG + Intergenic
1088901060 11:114117580-114117602 TGGCTTGGATAACTGGTGGATGG + Intronic
1088994851 11:114987388-114987410 TTGCATGGAGGAGTGGTTCAAGG + Intergenic
1089367623 11:117930985-117931007 TGTCATGGTGGGCTGGTGGATGG - Intergenic
1089490915 11:118883488-118883510 TGGCTTGGAGGAGAGGTTGCTGG + Intergenic
1089559716 11:119337754-119337776 TGGCATGGGGGTCTGGTGCAGGG + Intergenic
1089760990 11:120723286-120723308 AGGCCTGGAAGAGTGGTGGGTGG - Intronic
1089859064 11:121572688-121572710 TGCCAGGGAGCAGTGGAGGAGGG + Intronic
1090253805 11:125268956-125268978 TGCCATGGGGGTGGGGTGGAGGG + Intronic
1090410141 11:126502350-126502372 TTGCCAGGAGGAGTGGAGGAGGG - Intronic
1090541885 11:127715677-127715699 TGGCATGGTGGCATGGTGGCAGG - Intergenic
1091752334 12:3030801-3030823 TAGCAGGGAGGAGTGCTGGGTGG + Intronic
1091837390 12:3595342-3595364 GGGCAGGGAGGGGTGGTGGTGGG - Intergenic
1092953155 12:13526368-13526390 TGGAATGCAGGAGTGGGAGATGG + Intergenic
1092953173 12:13526470-13526492 TGGAATGCAGGAGTGGGAGATGG + Intergenic
1092953193 12:13526591-13526613 TGGAATGCAGGAGTGGGAGATGG + Intergenic
1092953216 12:13526732-13526754 TGGAATGCAGGAGTGGGAGATGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093123986 12:15306738-15306760 TGGCCTGGGGCAGTGGTGGCGGG - Intronic
1094406823 12:30125165-30125187 TGGAATGGAAGAATGCTGGAAGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094763449 12:33561915-33561937 TGGCAATGATGAGTGCTGGATGG - Intergenic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098204950 12:68098758-68098780 TGGGATGGTGGAGTGGGGCAGGG + Intergenic
1099612918 12:84897763-84897785 TGGGATGAAGGAGTGGGGTATGG + Intronic
1099698650 12:86056375-86056397 GGGGGTGGAGGAGTGGAGGAGGG - Intronic
1100221214 12:92506230-92506252 TGGGAGGGTGGAGTGGGGGATGG + Intergenic
1101183109 12:102241242-102241264 TGGGGTGGAGGGATGGTGGAGGG + Intergenic
1101254829 12:102966515-102966537 TGGGGTGGTGGAGTGGAGGAGGG - Intergenic
1102510111 12:113409495-113409517 TGGCATGAAGGGGTGGGGGGGGG + Intronic
1102810028 12:115816086-115816108 TGGGCTGGGGGCGTGGTGGAGGG + Intergenic
1103615417 12:122148701-122148723 GGGCTTGGGTGAGTGGTGGATGG - Intergenic
1103744613 12:123113848-123113870 GGGCAGGGAGGAGGGGAGGATGG - Intronic
1103879173 12:124152844-124152866 TGTAATGGAGGAGTGGGGGCAGG - Intronic
1104169470 12:126266149-126266171 TGCCATAGAGGAATTGTGGAAGG - Intergenic
1104411393 12:128561076-128561098 TGGCAGGGAGGTCTGGGGGAAGG - Intronic
1104485537 12:129148749-129148771 TGGCATGCAGCTGTGGAGGAGGG - Intronic
1104555784 12:129798743-129798765 TGGCTTAGAGAAGGGGTGGAGGG + Intronic
1104672291 12:130689106-130689128 TGGCATGGAGGGGTGTGGGTGGG - Intronic
1104704830 12:130935368-130935390 TGGGATGGAGGAGGGAGGGAAGG - Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1105021279 12:132818103-132818125 GAGCATGGAGGAGTGGAGGGGGG - Intronic
1105021289 12:132818136-132818158 GAGCATGGAGGAGTGGAGGGTGG - Intronic
1105415908 13:20211225-20211247 TGGCATGGGTGAGTGGTAGCAGG - Intergenic
1105798867 13:23885309-23885331 TGGCATGGGGGAGGTGGGGATGG + Intronic
1105877755 13:24574177-24574199 TGGCAGGGAAAAGTGGTGGTTGG - Intergenic
1106286633 13:28323709-28323731 TGGCATGGAAAAGTGGTTAAGGG - Intronic
1106640405 13:31578802-31578824 TGGGGTGGAGGAATGGGGGAGGG - Intergenic
1107085227 13:36420602-36420624 TGGCATGTAGGAGTGTAGGTGGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1110557190 13:76873181-76873203 GGGCCTGGAGCAGTGGGGGATGG + Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1112124875 13:96454049-96454071 AGGGGTGGGGGAGTGGTGGAGGG - Intronic
1112343979 13:98576204-98576226 AGGCAGGGTGGAGTGGAGGAAGG - Intronic
1112387040 13:98949459-98949481 TGCCATGGAGGAATGGAGGAGGG - Intronic
1112880539 13:104101587-104101609 GGGCATGGAGGTGAGGTAGAAGG + Intergenic
1113585111 13:111459586-111459608 GGGAAAGGAGGAGTGGAGGAGGG + Intergenic
1113804768 13:113106516-113106538 GGGCATGGAGGTGTGGGGGATGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114547329 14:23512547-23512569 TGCCAGGGAGGAGGGGTGGCTGG - Intergenic
1115104046 14:29738354-29738376 TGGCAGGGAGTGGTGGTGGTTGG - Intronic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117497902 14:56323862-56323884 TGTCGGGGAGGGGTGGTGGAAGG + Intergenic
1117725501 14:58669077-58669099 TGATATGGAGTAGTGGAGGAAGG + Intergenic
1117870331 14:60193973-60193995 GGGAATGGGGGAGTGCTGGAGGG + Intergenic
1118051196 14:62030045-62030067 TGGGAGGGATGGGTGGTGGAGGG - Intronic
1118479677 14:66151951-66151973 TGTCACGGAGGTTTGGTGGAAGG - Intergenic
1118842682 14:69524865-69524887 GGGCATGGAGGAGCAGTGAAGGG - Intronic
1119275015 14:73347447-73347469 AAGGATGGGGGAGTGGTGGAAGG - Intronic
1119719299 14:76880379-76880401 TAGCTTGGAGGAGAGGTGTAGGG + Intergenic
1120003513 14:79330593-79330615 TGGCATAGAGGAGTGGAGTGAGG + Intronic
1120608767 14:86612684-86612706 TGGCAGGGAGGACTGGAGTAGGG + Intergenic
1120642636 14:87033497-87033519 AGGCATGCAGGAGTGGTGCTGGG + Intergenic
1120762525 14:88298466-88298488 AGGCGTGGAGCAGTGGAGGATGG - Intronic
1121289688 14:92763813-92763835 AGGCATGCAGGTGTGCTGGAGGG + Intergenic
1121833521 14:97072133-97072155 TGACATGGAAGAATGGTTGAGGG - Intergenic
1121936475 14:98023881-98023903 TGGCAGGGAGGCGTGATGAAAGG + Intergenic
1122129816 14:99598531-99598553 TGGCATGGAGGAGTGGGGGAAGG - Intronic
1122340263 14:101023462-101023484 TGTCATGGAGAAGTGGTGGTGGG - Intergenic
1122369759 14:101222986-101223008 TGTCAGGGAGGAGAGTTGGAGGG - Intergenic
1123126066 14:105947088-105947110 ATGCATGGATAAGTGGTGGACGG - Intergenic
1123627925 15:22240017-22240039 AGGGATGGAGGTGAGGTGGAAGG - Intergenic
1123790172 15:23711821-23711843 AGGCAAGGAGGAGTGGTGGAAGG + Intergenic
1124466081 15:29941218-29941240 TGGAAGGGAGGAGTGGTCCACGG - Intronic
1125111343 15:36038432-36038454 TGGCCTGGTGAACTGGTGGAGGG + Intergenic
1125182150 15:36888994-36889016 TGGAAGAGAGGAGGGGTGGACGG + Intergenic
1125711561 15:41791182-41791204 TGGGATTGAGAAGTGGGGGAAGG + Intronic
1126441183 15:48690784-48690806 GGCCATTGAGGAGTGGTGGGAGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127210709 15:56771823-56771845 GGGCTTGGATGAGTGGTGTAGGG - Intronic
1127716351 15:61652966-61652988 GGGCGTGGAGGCGGGGTGGAGGG + Intergenic
1127851218 15:62913557-62913579 AGGTATGGAGGAGAGATGGATGG + Intergenic
1128292182 15:66486374-66486396 AGGCAGGGGGGAGTGGGGGATGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128625322 15:69196020-69196042 GGGGATGGGGGAGTGTTGGAAGG + Intronic
1129034335 15:72640545-72640567 TGGCATGGAGGACAGGAGGCTGG + Intergenic
1129063225 15:72878270-72878292 TCACATGGAGGAAGGGTGGAGGG + Intergenic
1129215547 15:74096671-74096693 TGGCATGGAGGACAGGAGGCTGG - Intergenic
1130834453 15:87635545-87635567 GGGCAGGGAGGAGTGGGGGAAGG - Intergenic
1132378018 15:101344584-101344606 TGGGGTGGAGGAGTGGAGAATGG + Intronic
1132714477 16:1283949-1283971 TGGCCTGCAGGAGTGGGGAAGGG + Intergenic
1132804244 16:1768399-1768421 TGGCATGCAGGGGATGTGGATGG - Intronic
1133073426 16:3262041-3262063 AGGCACGGAGGAGGAGTGGATGG + Intergenic
1133098922 16:3467307-3467329 TGGCAGGGAGGAGCTGTGGGCGG + Intronic
1133128530 16:3662388-3662410 TGGCATGGAGCAGAGGACGATGG - Exonic
1133275309 16:4634655-4634677 TGACCTGGAGCAGTGTTGGAGGG + Intronic
1133359174 16:5160308-5160330 TGGCTTGGAGGAGTAGGTGATGG + Intergenic
1134094725 16:11411799-11411821 TGGCCTGGAGGAGTGAGGGGAGG - Intronic
1134251722 16:12578770-12578792 TGGCATGGAGCAGGGGTGGTAGG - Intergenic
1134666614 16:16023616-16023638 TGCCCTGGAGGAGAGATGGAAGG + Intronic
1134892435 16:17853037-17853059 TGGCAAGGAAGAATGTTGGAAGG + Intergenic
1135155482 16:20049197-20049219 TGGGATGAAAGAGTGATGGATGG + Intronic
1135206624 16:20490475-20490497 AGGCATTGAGGAATGTTGGAAGG - Intergenic
1135212262 16:20533157-20533179 AGGCATTGAGGAATGTTGGAAGG + Intergenic
1135631096 16:24036018-24036040 TGGGAAGGAGGAGGGTTGGAGGG + Intronic
1135702403 16:24643699-24643721 CGGCGGGGAGGGGTGGTGGAAGG - Intergenic
1136077630 16:27827914-27827936 ATGGATGGATGAGTGGTGGATGG - Intronic
1136091705 16:27925390-27925412 TGGGAGGGAGGAGGGGTGGAAGG + Intronic
1136732347 16:32427327-32427349 GGGCATGGTGGCGTGGTGGTGGG + Intergenic
1137502646 16:49023322-49023344 TGGCAGAGTGGAGTGGTGCAGGG - Intergenic
1137704804 16:50527104-50527126 TGGCATGGAAGACTGGTGTTTGG - Intergenic
1138265648 16:55657688-55657710 TTGCAGGGAGGAGTGGGAGAGGG + Intronic
1139513497 16:67440394-67440416 TGGCATGGAGAGGTGTTGGGAGG - Intronic
1139523238 16:67497340-67497362 TGACATGGGGAAGTGGTGGGTGG - Intergenic
1139600504 16:67983666-67983688 GGGCATGGAGGAGTGGAGAGGGG + Intergenic
1139837272 16:69849218-69849240 TAGCAGGGAGGAGGGGTGGAGGG + Intronic
1140966764 16:79973940-79973962 TTGCATGGAGGAGTTGTTGAGGG + Intergenic
1141388957 16:83648474-83648496 TGGGAGGGAGGAGGGGTGGCAGG - Intronic
1141773534 16:86106299-86106321 TGGCTTGGCGGATGGGTGGATGG + Intergenic
1141812329 16:86383750-86383772 AGGAAGGGAGGAGTGGGGGAGGG + Intergenic
1141976030 16:87517322-87517344 AGGGATGGAGGCGGGGTGGAAGG + Intergenic
1141997121 16:87642580-87642602 TGAGTTGGAAGAGTGGTGGACGG + Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142290929 16:89193295-89193317 TGGCATGGAGGAGCCGGGGTTGG - Intronic
1203020734 16_KI270728v1_random:402257-402279 GGGCATGGTGGCGTGGTGGTGGG - Intergenic
1203039069 16_KI270728v1_random:675415-675437 GGGCATGGTGGCGTGGTGGTGGG - Intergenic
1142804763 17:2365541-2365563 TGGCGTGGAGAAGTGGGGAAGGG - Intronic
1143319648 17:6059834-6059856 TGATATGGAGGAGAGGGGGATGG - Intronic
1143448089 17:7020352-7020374 TGGCAAGGAGGGGTGCTGGTGGG - Intergenic
1143780478 17:9226312-9226334 TCACATGGAGGTGTAGTGGAGGG + Intronic
1143786185 17:9257453-9257475 TGACATGGAGGAGGAGGGGAAGG + Intronic
1143872749 17:9969445-9969467 TGGTTTGGAGGAGGGGTTGACGG - Intronic
1144217583 17:13069973-13069995 TCGCAGGAAGAAGTGGTGGAGGG + Intergenic
1144762630 17:17715916-17715938 AGGAGTGGAGGAGTGCTGGAAGG + Intronic
1145037829 17:19553498-19553520 TGGCATGGAGGATTGGGAGGAGG - Intronic
1146624932 17:34428006-34428028 AGGGAGGGAGGAGAGGTGGAGGG - Intergenic
1146687138 17:34848817-34848839 TGTGATGGAGGGGTGGTGTATGG - Intergenic
1146821171 17:35984528-35984550 GGGCATGGAGGAGGGAAGGAAGG + Intronic
1147613079 17:41812848-41812870 TGGCCGGGAGGAGCGGGGGAGGG - Intronic
1148049176 17:44760735-44760757 TGGCAGCGGGGAGTGGTGGGAGG + Intronic
1148153995 17:45412306-45412328 AGGCATGAGGGTGTGGTGGAGGG - Intronic
1148253556 17:46107784-46107806 TGGCATATAGGAGTTGGGGAGGG - Intronic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148492003 17:48029226-48029248 TGGCAAGGAGAAGGGGCGGAGGG - Intronic
1150170799 17:62991882-62991904 TGGATGGGTGGAGTGGTGGAGGG + Intergenic
1150294552 17:64001008-64001030 GGGAATGGAGGAGTGGCGGTGGG + Intronic
1150330469 17:64290175-64290197 GGGCATGGTGGAGAGGGGGAAGG + Intergenic
1150433747 17:65138955-65138977 TGGGGTGGAGGAGGGGTGGCTGG - Intronic
1151186062 17:72364681-72364703 TTGCAGGGAAGAGTGGTGGCAGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151391491 17:73790423-73790445 TGGGGAGGAGGAGTGATGGAGGG - Intergenic
1151524266 17:74653233-74653255 TGGGATGTAGGGGTGGTGGTGGG - Intergenic
1152025236 17:77804726-77804748 AGGCATGGAGGGGTGGTTGGGGG - Intergenic
1152108450 17:78343754-78343776 TGGCCCGGAAGAGTGGTGGATGG + Intergenic
1152187099 17:78864346-78864368 AGGCATGGAGGAAGGGAGGAAGG - Intronic
1152637419 17:81435805-81435827 TGCCACTGAGGAGTGGGGGAAGG - Intronic
1152775909 17:82201878-82201900 TCGCAAGGAGGAGGAGTGGAGGG - Exonic
1154177513 18:12094622-12094644 TGGGGTGGAGGACTGGTGGGGGG + Intronic
1154499874 18:14990653-14990675 TGGCAGGGACCAGTGCTGGAGGG + Intergenic
1155402894 18:25458223-25458245 TGGCATTGAGGAGGGGGAGATGG + Intergenic
1155621676 18:27786634-27786656 TAGCATGAAGGATTGGTGGGAGG + Intergenic
1155981440 18:32184450-32184472 TGTCATGGGGAAGGGGTGGAGGG - Intronic
1156220728 18:35049306-35049328 TGGCGTGAGGGAGTGGGGGAAGG - Intronic
1156465705 18:37346892-37346914 CAGCATTGGGGAGTGGTGGACGG + Intronic
1157118167 18:44881929-44881951 TGGCATGTTGGAGTGTCGGACGG + Intronic
1157139533 18:45091885-45091907 TGGCCTAGAGAAGTGGAGGAGGG - Intergenic
1157322735 18:46646920-46646942 GGGCTTCGAGGAGTGATGGAGGG - Intronic
1157332916 18:46716525-46716547 TGGCAAAGAGGAGGTGTGGAAGG - Intronic
1157563130 18:48662511-48662533 GAGCCTGGAGGAGAGGTGGAGGG - Intronic
1157804089 18:50645089-50645111 TGGCAGGGAGAACTGGTGGAAGG + Intronic
1159844299 18:73440186-73440208 TGGGATGGAGGAGTGGAGTGTGG + Intergenic
1161013962 19:1974293-1974315 TGGCAAGAAGGCATGGTGGAAGG + Intronic
1161030719 19:2056672-2056694 TGGAAGGGAGGAGAGGAGGAAGG - Intergenic
1161151316 19:2711539-2711561 TGGCTGGGAGGAGTGGAGGGAGG - Intergenic
1161329070 19:3677891-3677913 AGGGATGGAGGAGGGATGGAGGG + Intronic
1161329199 19:3678350-3678372 AGGGATGGAGGAATGGAGGATGG + Intronic
1161329373 19:3678918-3678940 AGGGATGGAGGAGTGGAGGGAGG + Intronic
1161720543 19:5899940-5899962 TGGCATGTGGGGGTGGTGTAAGG - Intronic
1161767620 19:6216097-6216119 TGGCAGGGAGGGGTGCAGGAGGG - Intronic
1161802391 19:6423739-6423761 TGGCCTGGAGGGGTGGGGGTCGG - Intronic
1162555139 19:11381896-11381918 GGGAATGGAGGAGTGGTCGGAGG - Intronic
1162988399 19:14286660-14286682 GGGGATGGAGGAGAGGTAGAAGG + Intergenic
1163666795 19:18607169-18607191 GGGAATGGAGGAGTGGGGCAGGG - Intronic
1164921498 19:32092005-32092027 TGGCCAGAAGGAGAGGTGGAAGG - Intergenic
1164966017 19:32484714-32484736 TTGCATGGAGGAGTTTGGGACGG - Exonic
1165690248 19:37857317-37857339 TGGAATGGAGCAGTGGTTGATGG - Intergenic
1165992916 19:39826294-39826316 TGCCAGGGAGGAGAGGTGAAGGG + Intronic
1166530283 19:43538585-43538607 TGACATGGATGAGTGGAGGATGG + Intergenic
1167670311 19:50848805-50848827 TGGTATGGAATAATGGTGGAAGG - Intergenic
1167682692 19:50934366-50934388 AGGCATGCAGGCGTGGTGGCGGG - Intergenic
1167769075 19:51502504-51502526 TGGAAGGGAGGAATGTTGGATGG + Intergenic
1167828908 19:52001688-52001710 TGGGAAGAAGGAGTGATGGAGGG + Intronic
1168427865 19:56253320-56253342 GGGCAGGGAGGAGGGGTGGAGGG + Intronic
1168700358 19:58435184-58435206 TGGCATGGAGTAGAGGGTGAGGG - Exonic
925851678 2:8088049-8088071 TGACCTGGAGGTGGGGTGGAGGG + Intergenic
926157720 2:10466858-10466880 TGGCCTGGAGGAATGGGGTAGGG - Intergenic
926280054 2:11438725-11438747 TGGCATCTAGGAGTGGAGGACGG - Intergenic
926729483 2:16025462-16025484 GGGCATGGAGAAGTGGAGCATGG + Intergenic
926766251 2:16325134-16325156 TGGCACTGAGGACTGGGGGAGGG + Intergenic
927558770 2:24054084-24054106 TGGCTGGGAGGAGTAGAGGATGG - Intronic
927596673 2:24403243-24403265 GGGGGTGGTGGAGTGGTGGAGGG - Intergenic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
929564799 2:42977561-42977583 TGGTGTGGGGGAGTGGTGGGCGG + Intergenic
930091534 2:47534683-47534705 TGGGAGGGAGGAGTGAGGGACGG - Intronic
931265805 2:60659252-60659274 AGACATGGAGGAGGGGAGGAGGG + Intergenic
931360412 2:61573178-61573200 GGGCATGGTGGCGTGGTGGCGGG - Intergenic
931481493 2:62645854-62645876 TGGGATGGGGGAATGGGGGAGGG - Intergenic
932022788 2:68104698-68104720 TGGCAGGGAGGAGAGGTGTCAGG + Intronic
932361736 2:71114181-71114203 AGGGGTGGAGGAGTGGGGGAAGG + Intronic
933220588 2:79683177-79683199 TGGCATGTAGGGGTAGGGGATGG - Intronic
934313364 2:91891904-91891926 GGGCATGGTGGCGTGGTGGTGGG - Intergenic
934708982 2:96503097-96503119 GGGCAAGGAGGGGTGGAGGACGG + Intronic
935147723 2:100407532-100407554 TGCCATGCAGAAGTGATGGATGG - Intronic
936141434 2:109945439-109945461 TGGCCTGGAGAAGTTGAGGAAGG + Intergenic
936178123 2:110243387-110243409 TGGCCTGGAGAAGTTGAGGAAGG + Intergenic
936203259 2:110426044-110426066 TGGCCTGGAGAAGTTGAGGAAGG - Intronic
936461685 2:112718936-112718958 TCGGATGGAGGAATGGAGGATGG - Intergenic
937541913 2:122966140-122966162 TGGCCTGAAGCAGTGGGGGAAGG - Intergenic
937792630 2:125978675-125978697 TGGCAAGGGGCAGGGGTGGATGG + Intergenic
937929262 2:127192031-127192053 TGGCTGGGAGGAGGGGTAGAGGG - Intronic
938236397 2:129709882-129709904 TGTGCTGGAGGAGTGGTGGCTGG + Intergenic
938727999 2:134123570-134123592 AGGCATGGAGGAGGAGTGGTTGG + Intronic
938930936 2:136086446-136086468 TGGCAGGAAGGGGTTGTGGAGGG + Intergenic
938979646 2:136514183-136514205 TGGCATGAAGTAATGGTGGAAGG - Intergenic
940027364 2:149222456-149222478 TTGAATGGAGGAAGGGTGGATGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941539274 2:166761925-166761947 TGACATGGAGTAGAAGTGGATGG - Intergenic
942568003 2:177285572-177285594 TGGGATGAAGGTTTGGTGGAGGG - Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942983793 2:182114444-182114466 TGGGATGCAGGAGAGGTGTAGGG + Intronic
943304511 2:186243096-186243118 GGGCAAGGTGGTGTGGTGGAAGG - Intergenic
943419695 2:187655148-187655170 TGGCGGTGGGGAGTGGTGGAGGG - Intergenic
943764160 2:191642481-191642503 AGGGGTGGAGGAGTAGTGGAAGG - Intergenic
944393044 2:199239750-199239772 TGGGGTGGAGGAATGGGGGAGGG - Intergenic
944553886 2:200869264-200869286 AGGCATGCGGGAGTGGTGCAGGG - Intergenic
944913583 2:204334303-204334325 TGGCAAGGAGGAGTGGGCCAGGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945592191 2:211747343-211747365 TATCATGGAGGAGGGGTGGGAGG - Intronic
946414194 2:219531411-219531433 TTGGATGCAGGAGTGATGGAAGG + Intronic
946635382 2:221719326-221719348 TGGCATGGGGAAGCGGTAGATGG - Intergenic
947448018 2:230179485-230179507 GGGCAGGGAGGAGTGGGGGTGGG + Intronic
947909155 2:233790383-233790405 TGGGATGGAGGAAGGGAGGAAGG - Intronic
947967293 2:234291881-234291903 TGGCAGGCATGTGTGGTGGAGGG + Intergenic
948248201 2:236504101-236504123 GGGCAGGGAGGAGTGGGGAATGG - Intronic
948579301 2:238973199-238973221 TGGCAGGGAGGAGCAGTGGAAGG + Intergenic
948757105 2:240166281-240166303 TGACATGGAGGATTTCTGGAGGG + Intergenic
948777408 2:240296868-240296890 TGGCAAGGGAGAGAGGTGGATGG - Intergenic
1169732461 20:8801322-8801344 AGGGATGGGAGAGTGGTGGAGGG - Intronic
1169782695 20:9326280-9326302 TGGCTTGGAAGAGTGGATGAAGG - Intronic
1170967173 20:21083960-21083982 GGGCACTGAGGAATGGTGGATGG + Intergenic
1172244184 20:33434320-33434342 AGGGGAGGAGGAGTGGTGGAAGG - Intronic
1172637546 20:36420158-36420180 TTGAATGAAAGAGTGGTGGAAGG - Intronic
1172796606 20:37544155-37544177 TGGCAGTGGGGAGTGGTGGCAGG - Intergenic
1172872260 20:38143119-38143141 TGGGATGAAGGAGTGGAGGAAGG + Intronic
1173147505 20:40537517-40537539 TGGCATGGAGGAGAGATGTGAGG - Intergenic
1173222947 20:41144440-41144462 TGGCAAGGATGAGTGCAGGACGG - Intronic
1173570521 20:44072918-44072940 TGGCTTGGAGGAGGCTTGGAGGG - Intergenic
1173845563 20:46186386-46186408 TGGGTTGGTGGAGTGGAGGAGGG - Intronic
1173849334 20:46208067-46208089 GGGCATTGAGGAGAGGGGGAGGG - Intronic
1173952331 20:47003139-47003161 TGGCATAGTGGAGGGGTTGAGGG + Intronic
1174387910 20:50197992-50198014 TGGAATGGGGGAGGGGAGGATGG + Intergenic
1174390308 20:50214807-50214829 TGAGATGGAGGAGAGATGGATGG + Intergenic
1175147042 20:56904829-56904851 TGGCCTTGAGGATTGGTGGCTGG + Intergenic
1175380307 20:58558142-58558164 TGGCACGGAGGGGTTGTGGGAGG + Intergenic
1175486920 20:59353447-59353469 TGTCCTGGAGGAGAGGGGGAGGG + Intergenic
1175863193 20:62161047-62161069 TGGCACGGAGGGGTCGTGGTTGG + Intronic
1175935145 20:62510682-62510704 TGGAAGGGCGGAGGGGTGGATGG - Intergenic
1176211872 20:63928165-63928187 TGGCATGGAGAAGTGTGAGACGG - Intronic
1176961398 21:15163179-15163201 TGGCACAGGGGAGTGCTGGATGG - Intergenic
1177101867 21:16907928-16907950 TGGAAAGGAGGAGTGGTGGGGGG + Intergenic
1178275856 21:31236317-31236339 TGGCATGGATTAGTTGTGAAGGG - Intronic
1178386142 21:32152067-32152089 TGGCATGGGGGAGGGGAGGTGGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179380478 21:40894687-40894709 TGGCTGGTGGGAGTGGTGGAGGG - Intergenic
1179487986 21:41722900-41722922 TGGCCTGGAGGAAGGATGGATGG + Intergenic
1179495584 21:41769430-41769452 TGGGAAGGAGGAGTTGGGGAAGG + Intergenic
1179714688 21:43280770-43280792 TGGCGGGGAGGGGAGGTGGAGGG + Intergenic
1179912830 21:44459491-44459513 TGGCATGGAGAAGGGGTGGCAGG - Exonic
1180081648 21:45490107-45490129 AGGGATGGAGGAGTGGGGGAGGG - Intronic
1180257420 21:46641780-46641802 GGGCATGGTGGAGGTGTGGAAGG + Intronic
1181565540 22:23734893-23734915 TAGCATGGAGGAGGAGTGCAGGG + Intergenic
1183094260 22:35542659-35542681 AGGCATGGGGGTGTGGAGGAGGG + Intronic
1183106455 22:35618581-35618603 TTGGATGGATGGGTGGTGGATGG - Intronic
1183517675 22:38276576-38276598 TTGCATGGAGGAGGGGTGAGAGG - Intergenic
1183701787 22:39455092-39455114 TGGCATGGGGAATTGGGGGAGGG + Intergenic
1184099883 22:42336472-42336494 TGGCATGGGGAGGTGGGGGAGGG - Intronic
1184744747 22:46449745-46449767 TGGCATGGAGGTGGAGGGGAGGG + Intronic
1185289202 22:50015453-50015475 TGGGCTGGAGGAGCGGTGGCGGG - Intronic
1203305246 22_KI270736v1_random:104624-104646 TGGAATGGAGTAGTGTTGAATGG + Intergenic
949598402 3:5572562-5572584 TGGAAGGGAGCAGTAGTGGATGG + Intergenic
949847130 3:8383169-8383191 TTGCAGGGAGGATTGGGGGATGG - Intergenic
950185970 3:10945776-10945798 TGGGATGGAGGGGTGGGGGTGGG - Intergenic
950474340 3:13206045-13206067 TGGGTGGGAGGAGTGATGGATGG - Intergenic
950677524 3:14563631-14563653 AGGCAGGGAGGAGGGGTGTAGGG + Intergenic
950719926 3:14875510-14875532 TGGCATGGAGGAGTGGTGGAGGG + Intronic
951278350 3:20716777-20716799 GGGGATGGAGGACTAGTGGAGGG + Intergenic
952722043 3:36543764-36543786 AGGCATGGAGTAATGGTGTAAGG + Intronic
952743310 3:36755688-36755710 TAGGATGGAGAAGTGGAGGATGG + Intergenic
953075514 3:39566504-39566526 TGGCATGGAAGAGAGGAGAAGGG - Intergenic
953229484 3:41051987-41052009 AGGTATGGAGGAGTGATGGGAGG - Intergenic
953255505 3:41286788-41286810 AGGCAGGGAGGAATGGTGCATGG - Intronic
953558385 3:43965024-43965046 TGTCATGGAGGAGGAGTAGATGG + Intergenic
953701364 3:45198416-45198438 TGGCCAGGAGGAGGGGTGGCTGG + Intergenic
953818468 3:46183146-46183168 TGGCATGAAGGAGAGCTGGTAGG - Intronic
953902739 3:46852430-46852452 TGGCATGGAGTAGCGGTGCCAGG - Intergenic
953905567 3:46866815-46866837 GGGCATGGGGAAGTGGTGGGTGG - Intronic
954459226 3:50617084-50617106 TGGAGTGGGGGAGTGGGGGAGGG + Intronic
954592453 3:51794470-51794492 TGGGGTGGGGGAGTGGTGGCGGG - Intergenic
954850031 3:53592374-53592396 TGGAATGGAGTAGGGGTGAAAGG + Intronic
955156166 3:56418796-56418818 TGGGATGGGGGAGTTGGGGAAGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956462608 3:69486366-69486388 TTGCAGGGAGGAGTGGGAGAGGG - Intronic
959178915 3:102953892-102953914 TCGCTTGGTGGAGGGGTGGATGG - Intergenic
960164720 3:114388492-114388514 TGGCTTAGAGATGTGGTGGAAGG + Intronic
960786211 3:121374766-121374788 TGGTATGGGGGTGTTGTGGAGGG + Intronic
960835493 3:121902500-121902522 TGGGGTGGAGGGCTGGTGGAGGG - Intronic
961014060 3:123454004-123454026 TGGCATGGGGGAGGGGTGGAGGG - Intergenic
961086115 3:124068796-124068818 GAGCTTGGAGGAGTTGTGGAGGG + Intergenic
961378381 3:126481887-126481909 TGGCCTGGAGGAGTTCGGGAAGG - Exonic
961388149 3:126536111-126536133 GGGCTTGGTGGAGTGGGGGATGG - Intronic
961498776 3:127315663-127315685 TGGCATGGTGGAGGAGTGGAAGG - Intergenic
962007703 3:131363911-131363933 AGGCATGGAGGACTGTGGGAAGG - Intergenic
962146182 3:132842537-132842559 TGGGATGGGGGACTGGGGGAGGG - Intergenic
962300990 3:134243062-134243084 TGGTGGGGAGGAGGGGTGGAGGG - Intronic
962679983 3:137789034-137789056 TGGAATGGAGGGATAGTGGAAGG - Intergenic
962806135 3:138929106-138929128 TCGCAGGGAGGAATGGTGGGTGG - Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963068306 3:141281363-141281385 TGGGCTGGAGCAGTGATGGAGGG + Intronic
963797990 3:149650211-149650233 TGTGGTGGTGGAGTGGTGGATGG - Intronic
964086760 3:152827974-152827996 TGGCCTGGAGGAGAAGGGGATGG - Intergenic
964299697 3:155274620-155274642 TGGCAGGCAGGAGTAGTGGGTGG + Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
965774128 3:172210208-172210230 CTGCATGGAGGAGTGGGGGGCGG - Intronic
966248747 3:177838098-177838120 TGCCAGGGAGGCGTGGGGGAGGG + Intergenic
966931895 3:184680830-184680852 TGGGCTGCAGGAGTGGTGGGGGG + Intronic
967106218 3:186256821-186256843 TGGCATGGAGATCTGGAGGAGGG - Intronic
967171267 3:186825246-186825268 TGGGATGGGTGAGGGGTGGAGGG - Intergenic
967679134 3:192339311-192339333 TGGCTTTGAGGAGTAGTGAAAGG - Intronic
967680858 3:192362378-192362400 TGGGGTGGAGGGGTGGGGGAGGG - Intronic
967805645 3:193712489-193712511 TGGGATGGGGGAGTGTTCGAGGG - Intergenic
967852373 3:194091934-194091956 TGGCTGGGAGGGGTGGTGGGAGG - Intergenic
968279365 3:197464485-197464507 GGGCATGGTGTAGTGGTGCAAGG - Intergenic
969370437 4:6727878-6727900 AGGCAAGGAGGAGAGGGGGAGGG - Intergenic
969370618 4:6728970-6728992 TTGCATGAATGAGTGGAGGACGG - Intergenic
970401743 4:15723830-15723852 TAGCGTGGAGGAGTGGAGAATGG - Intronic
970641322 4:18069491-18069513 TGGCAGGGAAGAGAGGTGGAGGG - Intergenic
970738579 4:19204317-19204339 AGGCAGGGAGGGGTGGTAGAGGG + Intergenic
971193922 4:24453822-24453844 TGGGGTGGAGGAGGGGTGAAGGG - Intergenic
971248211 4:24949433-24949455 TGGCAGGGAGGGGGGGTGGTGGG + Intronic
971494248 4:27247168-27247190 TGGCATTGAGGACGTGTGGAAGG + Intergenic
971568570 4:28178797-28178819 TGGAGTGGGGGAGTGGGGGAGGG + Intergenic
972089135 4:35258034-35258056 TGGCATGTAGTAGTCCTGGAGGG + Intergenic
972710241 4:41588333-41588355 AGGCATGGCAGAGAGGTGGAAGG + Intronic
973189644 4:47372564-47372586 AGGTGAGGAGGAGTGGTGGATGG - Intronic
973333149 4:48930354-48930376 TGGGATAAAGGAGTGTTGGATGG + Intergenic
975980888 4:80157961-80157983 TGGCAGTCAGGAGTGGTGGGAGG - Intergenic
976783252 4:88785905-88785927 TGACCAGGAGGAGTGGTGAAGGG + Intronic
976953249 4:90860848-90860870 GGGAATGGAGGAGTGGGGAATGG + Intronic
977945563 4:102909953-102909975 GGGCATGGTGGTGTGGTGGTGGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980013043 4:127617767-127617789 TTGTATGGAGTAGTGGTGGTGGG - Intergenic
980079613 4:128330103-128330125 TGGGGTGGAGAAGGGGTGGATGG - Intergenic
980561582 4:134483907-134483929 TGGGATGGGGGACTGGGGGAGGG + Intergenic
981560406 4:146042402-146042424 TGGGGTGGGGGAGTGGGGGAGGG - Intergenic
981795706 4:148593109-148593131 TGGCATGGGGGGATGGAGGAGGG - Intergenic
981947581 4:150366530-150366552 CTGCATGGAGGAGTGGGGGCTGG + Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
984833802 4:184000424-184000446 TGGCTGGGAGGAGTGGGAGAAGG - Intronic
985089752 4:186350839-186350861 TGGCATGGAGGAGTGACACATGG - Intergenic
985103015 4:186476556-186476578 TGTGATCGATGAGTGGTGGAAGG - Intronic
985117433 4:186605548-186605570 AGGAATGGAGAAGAGGTGGAGGG + Intronic
985117464 4:186605641-186605663 TGGAATGGAGAAGAGGTGGAGGG + Intronic
986651845 5:9971797-9971819 TGGAAGGGTGGAGGGGTGGAGGG + Intergenic
987083617 5:14448454-14448476 TGTCATGCAGGAGAGGTGCAGGG + Intronic
987410173 5:17606963-17606985 TGGCACTGAGGAGTCATGGAAGG + Intergenic
987419242 5:17699174-17699196 TTGCTTAGAGGAGTTGTGGAGGG + Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
991525033 5:67546939-67546961 TGGCATGGAGGAGCTGAGCAGGG + Intergenic
992260784 5:74968015-74968037 CTGCATGGAGGAATGGTGAAGGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993238732 5:85351233-85351255 TGTCATGGAGGTTTGGTGTATGG + Intergenic
993442782 5:87977506-87977528 TGGCAGTGAGGTCTGGTGGAAGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995509297 5:112892281-112892303 TGGAATGGAGCAGTGCAGGAGGG + Exonic
996214157 5:120847663-120847685 TGGAAGGGAGGATGGGTGGAAGG - Intergenic
998667458 5:144314598-144314620 AGGCAGGGAGGACTGGAGGATGG + Intronic
998772832 5:145565795-145565817 TGGCATGGAGGCTTGGAGAATGG - Intronic
999653772 5:153793313-153793335 TGGCAAGGAGCACTGATGGAAGG - Intronic
999958044 5:156723700-156723722 TGGCATGTATGAGAGGTGAAAGG + Intronic
1000230850 5:159313911-159313933 TGGCCTGGAGGAATGGTGGGTGG - Intergenic
1000477771 5:161732602-161732624 TTGCAGGGCGGAGTGGGGGAGGG + Intergenic
1000808841 5:165835154-165835176 TGGGAGGTAGGAGTGGTGGGTGG + Intergenic
1001155358 5:169268206-169268228 TGCGAAGGAGGAGTGGCGGAGGG + Intronic
1001848776 5:174944549-174944571 AGACATGGAGGATGGGTGGAGGG + Intergenic
1002419795 5:179139593-179139615 GGGCATGGAGGAGAGGAGGGAGG - Intronic
1002641356 5:180632083-180632105 TGGCATGAAGGAGCGGGGGAGGG + Intronic
1003128297 6:3373552-3373574 AGGCCTGGGGGAGAGGTGGAGGG + Intronic
1004428423 6:15522348-15522370 TGGGCTGGAGGAGTGATGGCAGG + Intergenic
1004523727 6:16386212-16386234 TGGCAAGGAGGAGTGATTGATGG - Intronic
1004822040 6:19377846-19377868 TGGCAGGGGTGAGTTGTGGAGGG - Intergenic
1005382519 6:25251238-25251260 TGGTGAGGAGGAGTGGTGGTTGG + Intergenic
1005771633 6:29078905-29078927 AGGGATGGAGGACTGGGGGAGGG + Intergenic
1005873484 6:29994603-29994625 TGGTGAGGGGGAGTGGTGGAGGG + Intergenic
1006234228 6:32614516-32614538 TGGCATGCAGGAGAGAGGGAGGG - Intergenic
1006299390 6:33185610-33185632 CGGCATGGGGGAGGGGAGGAAGG + Intronic
1006634176 6:35450426-35450448 GGACATGGAGGAATGGGGGAGGG + Intergenic
1006984377 6:38167309-38167331 CGGCATGGGGGGGTGGTGGGGGG + Intergenic
1007239294 6:40413631-40413653 CAGCATGGAGAAGGGGTGGAAGG + Intronic
1007652933 6:43434327-43434349 TTCCTAGGAGGAGTGGTGGAAGG - Intronic
1008334108 6:50279571-50279593 TGGCAAGGAGGAGGGGAAGAGGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1010421589 6:75682546-75682568 TGGGATGGAGGGCTGGGGGAGGG - Intronic
1010426592 6:75734750-75734772 GGGGAAGGAGGAGAGGTGGAGGG + Intergenic
1011707844 6:90020785-90020807 CTGCATGGAGGAGTGGGGGGCGG - Intronic
1012427667 6:99131874-99131896 TGGGATGGAGGAGTGGTCTGTGG - Intergenic
1012446747 6:99314717-99314739 TGGCATGAGGCAGTGGTGGCAGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013418764 6:109947645-109947667 GGGCAGGGAGGAGTGGAGGCTGG - Intergenic
1013752577 6:113424217-113424239 TGGCATATAGGCCTGGTGGAAGG - Intergenic
1014642854 6:123934417-123934439 TGGGCTGGAGTAGTGGGGGAAGG - Intronic
1014788827 6:125647761-125647783 TGGCAAGGAGGAGTTGGGGAAGG + Intergenic
1015052767 6:128862641-128862663 GGGAAGGGAGGAGTGGGGGAAGG - Intergenic
1015611803 6:135030129-135030151 TTACATGGAAGAGGGGTGGAGGG + Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018030172 6:159835453-159835475 AGGCCTGGAGGAGAGGAGGAGGG + Intergenic
1019911888 7:4105801-4105823 TTGCAGAGAGGAGGGGTGGAAGG + Intronic
1021307721 7:19051727-19051749 TGGGGTGGGGGAGTGGCGGAGGG + Intronic
1022243568 7:28535353-28535375 TGGAAGGGAGGAAAGGTGGAAGG + Intronic
1023127348 7:36967797-36967819 GGGCATGAATGAGAGGTGGAGGG - Intronic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024605069 7:51016092-51016114 GGGAATGGAGGAGTGCAGGAGGG + Intergenic
1025120113 7:56294674-56294696 ATGAATGGATGAGTGGTGGATGG + Intergenic
1025120117 7:56294697-56294719 ATGAATGGATGAGTGGTGGATGG + Intergenic
1025940587 7:66073978-66074000 AGGTAGGGAGGAGAGGTGGAAGG - Intergenic
1025940645 7:66074287-66074309 TAGCATGGAGGAGGTGTGCAGGG - Intergenic
1026275186 7:68870202-68870224 TGAGATGGAGGAGGGATGGATGG + Intergenic
1026275399 7:68871803-68871825 TGGGATGGATGAGGGATGGATGG - Intergenic
1026885646 7:73942310-73942332 TGAGCTGGAGGAGTGGAGGATGG + Intergenic
1026903385 7:74049223-74049245 CTGCATGGAGGAATGGAGGATGG - Intronic
1027452505 7:78348514-78348536 TGGCTGGGAGGAGTGAGGGAAGG - Intronic
1027634323 7:80651317-80651339 TGTCATGGAGGTTTGGTGTACGG - Intronic
1027880839 7:83833858-83833880 TGGCAGGCAGGAGTGGGGGGGGG + Intergenic
1028041392 7:86058715-86058737 TGGCAAGGAGCAGTGGGGGTGGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1029225234 7:99022251-99022273 TGCCAGGGAGGAATGGGGGAAGG - Intergenic
1030206633 7:106957964-106957986 TGGCAAGGAGAAGTGGTGACTGG + Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030711746 7:112757878-112757900 AGGGATGGAAGAGAGGTGGAGGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031461758 7:122059751-122059773 AGGCATGGAGGAGTGACGGCAGG + Exonic
1031828572 7:126598067-126598089 AGGCAGGGAGGAGTGGGGGAGGG - Intronic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032724708 7:134580146-134580168 AGGCAAGGAGGAGAGGTGGCAGG - Intergenic
1032851447 7:135799001-135799023 TGGTATGGAGGCAGGGTGGATGG - Intergenic
1033756277 7:144400161-144400183 TGGCAGGGTGGAGTGGCGGAGGG - Exonic
1034375020 7:150634787-150634809 TGGAATGGGGGACTGGGGGAGGG - Intergenic
1034422333 7:150996320-150996342 GGGCAGGGAGGAGGGGTGCAGGG - Intronic
1035017383 7:155778593-155778615 TGGCCTGGAGGAGTGGGGGAGGG + Exonic
1035247891 7:157576781-157576803 TGGCAGGGAGGAGCGGAGGGAGG + Intronic
1035278893 7:157765181-157765203 ATGCATGGAGGAATGATGGATGG - Intronic
1035323607 7:158050734-158050756 TGGCATGGAAGAGTCGTGTGGGG - Intronic
1035330297 7:158092307-158092329 TGGGAGGGAGGATGGGTGGATGG + Intronic
1036201753 8:6776141-6776163 TGGAATGGAGGAGTCTGGGAAGG + Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037817979 8:22121704-22121726 TGGATTGGGGGGGTGGTGGATGG - Intronic
1037830996 8:22188928-22188950 CCACGTGGAGGAGTGGTGGAGGG + Intronic
1039203464 8:35123008-35123030 AGACATGCAGGAGTGGTGCAGGG + Intergenic
1039803674 8:40981257-40981279 GGGCAGGGAGGAGGGATGGATGG + Intergenic
1039816239 8:41096997-41097019 TGAGATGGAGGAGGGATGGAAGG - Intergenic
1040389838 8:46940501-46940523 TGGGGTGGAGGTGTGGTGAAGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042296823 8:67228446-67228468 TCACATGGAGTAGAGGTGGAGGG - Intronic
1042454007 8:68978564-68978586 TGGCAGGCAGGAGTGGGGGTTGG - Intergenic
1042713833 8:71749709-71749731 TGCTATGAAGGAGTGGTGGCAGG - Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1047320700 8:123778715-123778737 TGCCATAGAGGCGTGGTGGGTGG + Exonic
1048375050 8:133815988-133816010 AGTAATGGAGGTGTGGTGGAAGG + Intergenic
1049102770 8:140590958-140590980 AGCCAGGGAGCAGTGGTGGATGG - Intronic
1049255553 8:141611874-141611896 TGGTGTGGAGGTGTCGTGGAAGG + Intergenic
1049464290 8:142744020-142744042 TGGAATGGATGAGGGATGGATGG + Intergenic
1049582394 8:143418537-143418559 AGGCATGGGGGAATGGGGGATGG - Intergenic
1050163992 9:2745668-2745690 TGGGAGTGAGGAGTGGAGGAGGG - Intronic
1050371800 9:4929667-4929689 AGGAATGGAGGGGTGGTGGGGGG - Intergenic
1051338644 9:16091176-16091198 TGGGATGGAGGAGGGGTTCAAGG - Intergenic
1052339123 9:27348028-27348050 TGGAGTGGTGGAGTGGTGGAGGG + Intronic
1052365093 9:27603336-27603358 AGGCATGCAGGAGGGGTGCAGGG - Intergenic
1052760047 9:32580993-32581015 GGGCATGCAGGAGTGGTGATAGG + Intergenic
1052972366 9:34384948-34384970 AGGGATGCAGGAGAGGTGGAGGG + Intronic
1053118470 9:35526279-35526301 TGGGATTGAGGAGTGGGGAAAGG + Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1054762495 9:69015584-69015606 TGGCCTGGGGGAGTGATGGAAGG - Intergenic
1057810021 9:98250541-98250563 TGGAATTGAGGAAGGGTGGAGGG + Intronic
1058456076 9:105139378-105139400 TTGCCTGGAGGATGGGTGGAGGG - Intergenic
1059160410 9:112029316-112029338 TGGCTGGAAAGAGTGGTGGAAGG + Intergenic
1059707194 9:116836314-116836336 TGTCATGGATTAGGGGTGGAAGG + Intronic
1059766021 9:117384851-117384873 TGGAAGGGAGGATAGGTGGATGG + Intronic
1059863647 9:118490185-118490207 AGACATGGAGAAGGGGTGGAGGG + Intergenic
1060184960 9:121558639-121558661 TGGCAGGGAGGTGTGGAGGTGGG - Intergenic
1060629658 9:125143854-125143876 TGGCGTGGTGCAGAGGTGGAGGG - Intergenic
1060949510 9:127592679-127592701 TCGCATGGAGGAGGGGTGAAGGG - Intergenic
1061041714 9:128144562-128144584 TGCCAAGGAGGAGTGGGGGCTGG + Intergenic
1061237058 9:129349370-129349392 TGGCAGGGGTGAGTGGTGGAGGG + Intergenic
1061478896 9:130886668-130886690 TGTCTTAGAGGAGTGGGGGAGGG - Intronic
1061491035 9:130944478-130944500 TGGAAGGGTGGAGGGGTGGAAGG + Intergenic
1061491042 9:130944494-130944516 TGGAAGGGTGGAGGGGTGGAAGG + Intergenic
1061491049 9:130944510-130944532 TGGAAGGGTGGAGGGGTGGAAGG + Intergenic
1061491057 9:130944526-130944548 TGGAAGGGTGGAGGGGTGGAGGG + Intergenic
1061491075 9:130944566-130944588 TGGAAGGGTGGAGGGGTGGAAGG + Intergenic
1061491083 9:130944582-130944604 TGGAAGGGTGGAGGGGTGGAGGG + Intergenic
1061964049 9:134003313-134003335 TGGAATGGTGGATGGGTGGATGG - Intergenic
1062217119 9:135395196-135395218 ATGCATGGATGGGTGGTGGATGG + Intergenic
1062217139 9:135395296-135395318 TGGGATGGAGAAGGGGTGAATGG + Intergenic
1062246697 9:135572256-135572278 AGGGATGGATGAATGGTGGATGG - Intergenic
1062637221 9:137498050-137498072 TGGCATGCAGGAGCTGGGGATGG - Intronic
1203771857 EBV:53653-53675 TGGCATGGAGGAGCTGAGGTTGG - Intergenic
1185451711 X:284291-284313 TGGGATGGAGAGGTGGTGGAGGG - Exonic
1185467327 X:362645-362667 TGCCATGGAGGAGGGGTCCAGGG + Intronic
1185517164 X:708869-708891 TGGGATGGAGGACGCGTGGATGG + Intergenic
1186261306 X:7782776-7782798 TGGGAGGGACGTGTGGTGGAGGG - Intergenic
1186819157 X:13269029-13269051 TGGCCTTGAGGGGAGGTGGAAGG + Intergenic
1187064061 X:15815746-15815768 TGGAATGGAGCAGTGCAGGAGGG + Exonic
1187223481 X:17353402-17353424 TCTCATGGGGGAGTGGTGGTGGG - Intergenic
1187258549 X:17663197-17663219 TGGCATGGAGGGGAGAGGGAAGG + Intronic
1187486369 X:19707958-19707980 TGGCATGAAGGAATGGTGTGAGG - Intronic
1189468549 X:41296796-41296818 GGACATGGAGGAGTGGGTGAAGG + Intergenic
1189678339 X:43487082-43487104 TGGCATGGTTGAGTCGGGGATGG - Intergenic
1190396920 X:49994336-49994358 GGGCAAGGTGGAGTGGTGGTGGG + Intronic
1190930226 X:54942243-54942265 TGGGGTGGAGGAATGGGGGAGGG + Intronic
1192109382 X:68348923-68348945 TGGCAAGTAGGAGGTGTGGAGGG + Intronic
1192170879 X:68854010-68854032 ATGCAAGGAGGAGGGGTGGAAGG - Intergenic
1192197076 X:69035577-69035599 TGCCATGGAGGAGAGGTCCATGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192953582 X:76044189-76044211 TGGCAGGGAGTAGTGGAGGTGGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193328354 X:80207807-80207829 TGGCAAGGAGCAGTGGAGGTAGG + Intergenic
1193443972 X:81577346-81577368 TGGCAAGGAGCAGTGGGGGTAGG - Intergenic
1194010421 X:88554254-88554276 TGGCAAGGTGTAGTGGTGGTAGG + Intergenic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1196457279 X:115899400-115899422 TGCTATGGGGGAGTGGTAGATGG + Intergenic
1196457690 X:115901637-115901659 TGCTATGGGGGAGTGGTAGATGG + Intergenic
1196458203 X:115904440-115904462 TGCCATTGTGGAGTGGTAGATGG + Intergenic
1197156374 X:123274366-123274388 TAGCATGGAACACTGGTGGAGGG + Intronic
1197654586 X:129102817-129102839 TGGCAAGGAAGATTGGGGGAAGG - Intergenic
1197764615 X:130051757-130051779 GGGCATGGAGGGGTGGTGGTTGG - Intronic
1198128542 X:133671796-133671818 TGGGATGGGGGAATGGGGGAAGG - Intronic
1198526516 X:137506866-137506888 GGGCTTGGAGGAGTGGAAGAGGG - Intergenic
1199463028 X:148104566-148104588 AGGGATGGAGGTGTGGGGGAAGG + Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1199720431 X:150539589-150539611 GGCCATGGAGGAGAGGAGGAAGG + Intergenic
1200097940 X:153672828-153672850 TGGCATGTGTGAGTGGTGGTGGG - Intronic
1200249675 X:154546299-154546321 GGGCATTGGGGAGTGGTTGATGG + Intronic
1200851945 Y:7892248-7892270 TAGCATTCAGTAGTGGTGGATGG + Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic
1202050856 Y:20779185-20779207 TGGCATGGAAGAGTACTGGGTGG - Intronic
1202195413 Y:22295280-22295302 TGGCATGCAGGAATGGTAGAGGG - Intergenic