ID: 950722912

View in Genome Browser
Species Human (GRCh38)
Location 3:14897637-14897659
Sequence GCCTTTCCTCCAGCTCCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 522}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950722912_950722914 2 Left 950722912 3:14897637-14897659 CCTGGAGGAGCTGGAGGAAAGGC 0: 1
1: 0
2: 7
3: 58
4: 522
Right 950722914 3:14897662-14897684 TCAAATTGGTGAGCAGTCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 70
950722912_950722915 10 Left 950722912 3:14897637-14897659 CCTGGAGGAGCTGGAGGAAAGGC 0: 1
1: 0
2: 7
3: 58
4: 522
Right 950722915 3:14897670-14897692 GTGAGCAGTCCCTGGACCCCCGG 0: 1
1: 0
2: 0
3: 18
4: 231
950722912_950722916 11 Left 950722912 3:14897637-14897659 CCTGGAGGAGCTGGAGGAAAGGC 0: 1
1: 0
2: 7
3: 58
4: 522
Right 950722916 3:14897671-14897693 TGAGCAGTCCCTGGACCCCCGGG 0: 1
1: 0
2: 1
3: 27
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950722912 Original CRISPR GCCTTTCCTCCAGCTCCTCC AGG (reversed) Exonic
900089170 1:912109-912131 GCGCCTCCTCCAGGTCCTCCTGG + Intergenic
900157017 1:1207170-1207192 GTCTCCCCACCAGCTCCTCCTGG - Intergenic
900195629 1:1374308-1374330 GCATCTCCTCCAGCTCCAGCTGG + Exonic
900600811 1:3501978-3502000 GCCTTTCCCCCAGGGGCTCCTGG + Intronic
900652129 1:3734885-3734907 CCCTTCCTTCCAGCTCCTTCCGG + Exonic
900905138 1:5551817-5551839 CCTCTTCCTCCAGCCCCTCCTGG - Intergenic
901002464 1:6155448-6155470 CCCCTCCCTCCAGCTCCCCCAGG + Intronic
901534387 1:9872836-9872858 TCCTCTCCTCCAGCTCCTCCTGG - Intronic
901731193 1:11281020-11281042 TCCTTTCTTCCTGCTCATCCTGG + Intronic
902132365 1:14273737-14273759 TCCTTTCCTTCATCTCCTCTTGG + Intergenic
902295235 1:15462720-15462742 CCCTTTCTCCCAGCTCCTCCAGG + Exonic
902298087 1:15482252-15482274 CCCTTTCTCCCAGCTCCTCCGGG + Exonic
902467215 1:16625825-16625847 GCTGTTGCTCCAGCGCCTCCTGG + Intergenic
902556088 1:17247623-17247645 GCCCTTGCTCCTGCTCTTCCAGG + Intergenic
902650545 1:17834517-17834539 GCCTCTCCTCCAGCTTCTGGAGG + Intergenic
902975512 1:20085407-20085429 ACCAGGCCTCCAGCTCCTCCTGG - Intronic
903142765 1:21349209-21349231 CCCTTACCTCCAACTCCTCCAGG + Intergenic
904163187 1:28536249-28536271 GCCTTTCCCCCAGGAACTCCGGG + Exonic
904627279 1:31814232-31814254 CCTTGGCCTCCAGCTCCTCCTGG + Exonic
905399169 1:37689607-37689629 GCCTTTCCCCTAGCTTGTCCAGG + Exonic
906495299 1:46301413-46301435 GCCTTTCCTCCTGTTCCCCATGG + Intronic
906821970 1:48939516-48939538 GCCTTTCCTCCCCCTCCTGGAGG - Intronic
907408504 1:54268689-54268711 GCCATTCCCCAAGCTCCTCAGGG - Intronic
907667886 1:56449290-56449312 GCCTCTCCTTCAGCTGCCCCAGG - Intergenic
908699082 1:66878919-66878941 CCCTTTCCTCCCACTCCTTCTGG + Intronic
911260249 1:95677393-95677415 GCCTTTCCTGCAACACCTTCTGG - Intergenic
912810611 1:112791413-112791435 GCCTTCACTCCACCCCCTCCTGG + Intergenic
913123886 1:115767585-115767607 ACTATTCCTGCAGCTCCTCCTGG - Intronic
913608615 1:120489683-120489705 GCCTTTCTCCCAGCTCCACCAGG + Intergenic
914243953 1:145872392-145872414 GCTCTTCCTCCAGCTTCCCCAGG + Exonic
914370357 1:147019461-147019483 GCCTTTCTGCCAGCTCCACCAGG + Intergenic
914484337 1:148093949-148093971 GCCTTTCTGCCAGCTCCACCAGG - Intergenic
914582587 1:149032155-149032177 GCCTTTCTCCCAGCTCCACCAGG - Exonic
914846650 1:151287247-151287269 CCCCTGCCTCCAGCTCCTCTAGG + Exonic
915399518 1:155612043-155612065 GCCTGTCCTCCAGCTCTTCCTGG - Exonic
915416631 1:155747623-155747645 GCCTGTCCTCCAGCTCTTCCTGG - Intergenic
915541056 1:156566488-156566510 GGCTCTCCTCCAGCTCCACCGGG + Exonic
915553130 1:156646621-156646643 GCCCTACCTCTAGGTCCTCCAGG - Intronic
915585409 1:156841404-156841426 GACAGCCCTCCAGCTCCTCCAGG + Exonic
915788566 1:158642873-158642895 TCCATTCTTCCAGCTCCTCAAGG + Exonic
916087231 1:161280271-161280293 GCCTTCCCTCCAGTTCCTGTGGG + Intronic
917453543 1:175166846-175166868 GCCTTCCCTCAACCTTCTCCAGG - Intronic
917515804 1:175706902-175706924 GCCTTATCTCCAGGACCTCCAGG - Intronic
917524983 1:175780549-175780571 CCCTTTCCTCCTTCTCTTCCTGG - Intergenic
917536374 1:175877364-175877386 CCCTGACCTCCAGCCCCTCCTGG - Intergenic
919881704 1:201905292-201905314 TCCTTGCCCCCATCTCCTCCAGG + Intronic
919927568 1:202200191-202200213 GGCTTAGCCCCAGCTCCTCCGGG - Intronic
919980247 1:202638425-202638447 GCCTTTCTTGCAGCTTCTGCAGG + Intronic
920036259 1:203067743-203067765 GCCTCTTCTCCAGCTCCTTCCGG - Exonic
920048550 1:203149483-203149505 GCCTGTCCTCCTCCTCCTCTGGG - Intronic
920251471 1:204624982-204625004 ACCTGGCCTCCAGCTCCTCCTGG + Intronic
920676686 1:208043054-208043076 GCATTACCTCCAGCTCCCGCAGG + Exonic
921162485 1:212483120-212483142 TCATTTTCTCCTGCTCCTCCAGG + Intergenic
922193280 1:223338623-223338645 GCCTCTCTTCCAGCTACTCCTGG - Intronic
922209706 1:223478203-223478225 GTCTTGCCTCCTGCTCCCCCCGG + Intergenic
923084799 1:230695077-230695099 GCAACTCCTCCAGCTCCTGCTGG - Intergenic
923085984 1:230703918-230703940 GCCTTGCCTCAGGGTCCTCCAGG - Intronic
923332174 1:232935338-232935360 GCTCCTCCTTCAGCTCCTCCAGG + Intergenic
923565601 1:235073810-235073832 GCTGTGCCTCCTGCTCCTCCGGG - Intergenic
923738066 1:236630654-236630676 GCCCTTCCTCCAGCTTCCCATGG - Intergenic
1064628688 10:17286920-17286942 GACTTTCCTGCGGATCCTCCGGG - Intergenic
1064642389 10:17427839-17427861 GCCATTGCTCCTGCTCCTTCAGG - Intronic
1067368395 10:45658330-45658352 GCCTTTCACCCAGCTCCTGGGGG - Intronic
1067720250 10:48722757-48722779 GCTTTGCCTGCAGCTCCACCAGG - Intronic
1067728310 10:48790369-48790391 GCCTGTCCTCTAGATCCTGCTGG - Intronic
1067945660 10:50686651-50686673 GCCTGGGCCCCAGCTCCTCCGGG - Intergenic
1069324759 10:67219600-67219622 GACTTACCTCCAGCTCATCAAGG + Exonic
1069593365 10:69655366-69655388 GCCCTTCCTCCCTCACCTCCTGG - Intergenic
1069602631 10:69717786-69717808 CTGTTTCCTCCAGCTCCCCCAGG + Intergenic
1069664560 10:70145986-70146008 GCTCCTCCTCCACCTCCTCCTGG + Exonic
1069826108 10:71256278-71256300 GCCCTGGCCCCAGCTCCTCCAGG + Intronic
1070407747 10:76112151-76112173 GCCCTCCCGCCAGCTCCTCCAGG - Intronic
1070867173 10:79713524-79713546 GCCTGGGCCCCAGCTCCTCCGGG - Intronic
1070880965 10:79851648-79851670 GCCTGGGCCCCAGCTCCTCCGGG - Intergenic
1070913277 10:80136315-80136337 TCCTTTCCTCCCGCTCTCCCAGG - Intronic
1071431552 10:85610876-85610898 GCCTGTCCTCCAACCCCTTCTGG - Intronic
1071634088 10:87235748-87235770 GCCTGGGCCCCAGCTCCTCCGGG - Intronic
1071647536 10:87367965-87367987 GCCTGGGCCCCAGCTCCTCCGGG - Intronic
1071709778 10:88038785-88038807 GCCTCTCTTCCAGCTTCTCGTGG + Intergenic
1072195719 10:93115992-93116014 TGCTTTCCTCTAGCTCCCCCTGG - Intergenic
1072608582 10:97002369-97002391 GCCTTTTCTCTGTCTCCTCCAGG - Exonic
1072680585 10:97503407-97503429 GCCTCTCCCCCAGCCACTCCAGG + Intronic
1073130493 10:101185769-101185791 GCCTGTCCTCCAGATGCTACAGG - Intergenic
1074157715 10:110812733-110812755 GTCTTTCCTCCTGGACCTCCCGG - Exonic
1074426718 10:113358090-113358112 GCCTCTCCTCCAGCTGCTCCTGG - Intergenic
1074549157 10:114427138-114427160 GCCCTGCCTCCAGCCCCTTCGGG + Intergenic
1075083499 10:119399074-119399096 GCCTTGCCTCCATCTCCTGGAGG + Intronic
1075129440 10:119725900-119725922 CCCTTTCCTCCGCCTTCTCCCGG - Intergenic
1077329318 11:1977038-1977060 GCCTGACCTCCAAGTCCTCCTGG + Intronic
1077551037 11:3200476-3200498 GACTCTCCGCCACCTCCTCCAGG + Intergenic
1077551073 11:3200581-3200603 GACTCTCCACCACCTCCTCCAGG + Intergenic
1077551084 11:3200614-3200636 GACTCTCCACCAACTCCTCCAGG + Intergenic
1077610964 11:3642796-3642818 GCCTTTCCCCCACCTCCTCTGGG + Intergenic
1079171637 11:18101980-18102002 TCCATTCCTCCATCCCCTCCAGG - Intronic
1080447754 11:32352965-32352987 GCCTTTACTCCAGCCCCAGCAGG - Intergenic
1080450827 11:32377565-32377587 GCCTCTGCCCCAGCCCCTCCAGG + Intergenic
1081670708 11:44940926-44940948 GCCCTTCTACGAGCTCCTCCTGG + Intronic
1081712606 11:45226965-45226987 GGTTGTTCTCCAGCTCCTCCAGG - Intronic
1081781530 11:45716454-45716476 CCCTTTCCTCCAGCACCCCACGG + Intergenic
1081827336 11:46069153-46069175 GCCTTTCCTTCATCTCATCTTGG + Intronic
1082042105 11:47694663-47694685 GTCTTTCCTCTGGCTCCTCAAGG + Intronic
1083159797 11:60848023-60848045 GCCTCTCCTTCTCCTCCTCCAGG - Exonic
1083204293 11:61138784-61138806 GCAACTCCTCCAGCTCCTGCAGG + Exonic
1083274049 11:61587117-61587139 GCCTTTCAGCCACCTCCCCCGGG + Intergenic
1083757135 11:64797624-64797646 ACCTTTCCTCCAGGGCCTCCTGG + Exonic
1083853323 11:65380023-65380045 GCCTTTCCTGCCTCTCCTGCTGG - Intronic
1084049698 11:66591812-66591834 ACATCTTCTCCAGCTCCTCCAGG + Exonic
1084703516 11:70802696-70802718 TCCTTTTCTGAAGCTCCTCCAGG - Intronic
1086438048 11:86800705-86800727 GCCCTTTGTCCCGCTCCTCCCGG - Intronic
1087132017 11:94676866-94676888 GCCTTACCTCCAGGTCCCTCAGG + Intergenic
1088578816 11:111297821-111297843 CCCTTTCATCCCGCTCTTCCTGG - Intergenic
1088734867 11:112720385-112720407 GCCTTTCCTCTTGCTTCCCCTGG + Intergenic
1088925602 11:114298066-114298088 GCCACTTCTCCAGCTCCTGCAGG - Exonic
1089697609 11:120225687-120225709 GCCCCTTCTCCAGCTCCCCCAGG - Exonic
1090110258 11:123899968-123899990 GCCTTTGCTGCTGCTCCTCCAGG - Intergenic
1202812297 11_KI270721v1_random:32217-32239 GCCTGACCTCCAAGTCCTCCTGG + Intergenic
1091467585 12:698773-698795 CCCATTCCTCCAGCTCTCCCTGG - Intergenic
1091557387 12:1584585-1584607 GCCAATCCTCCATCTACTCCAGG + Intronic
1091724179 12:2834292-2834314 GCCAGTCCTCCAGGCCCTCCTGG + Intronic
1092761446 12:11814861-11814883 GCCTTGCATCCAGCCCTTCCCGG + Intronic
1094470374 12:30796593-30796615 GGCTCTCCTCCCGCCCCTCCCGG + Intergenic
1096665406 12:53160844-53160866 GCCTTTGCTCCACCCCATCCAGG - Exonic
1096843067 12:54390874-54390896 ACCTTTCCCCCAACTCCACCAGG + Intronic
1097288633 12:57896387-57896409 GGCTCTCCTCCAGCTGCTCTGGG - Intergenic
1098741540 12:74179048-74179070 GCCTCTTCTCCAGCTCCACTAGG + Intergenic
1099823469 12:87745328-87745350 GCCTTCCCTTGAGCTCCTACTGG + Intergenic
1099949565 12:89286250-89286272 ACCTTGACTCCAGCTCCTCTGGG + Intergenic
1101210815 12:102533750-102533772 GCATTTTCTGCAACTCCTCCAGG - Intergenic
1101285489 12:103307589-103307611 GTCTTATCTCCATCTCCTCCAGG - Intronic
1102199549 12:111047967-111047989 GCCTTTGCACAGGCTCCTCCTGG - Intronic
1102466388 12:113133125-113133147 GCCTGACCTCCAGGCCCTCCTGG + Intronic
1102768793 12:115455292-115455314 GCCCCTCCTGCGGCTCCTCCAGG - Intergenic
1102986105 12:117279948-117279970 TCCTTTGCTCAAGCCCCTCCCGG - Intronic
1103052369 12:117791224-117791246 GCTCTTCCTCCAGATCCTTCAGG + Intronic
1103362385 12:120361784-120361806 GCCTATTCTCCGGCTCCCCCTGG + Intronic
1103485049 12:121277047-121277069 GCCTCTCAGCCAGATCCTCCAGG - Intronic
1104072175 12:125355350-125355372 ATCCTGCCTCCAGCTCCTCCAGG - Intronic
1104832677 12:131764661-131764683 GCTTTGCTTCTAGCTCCTCCTGG - Exonic
1104927887 12:132322997-132323019 CCCCCTCCTCCAGCGCCTCCCGG + Intronic
1106168637 13:27270708-27270730 GCCTCTGCTCCCGCCCCTCCCGG + Exonic
1106275111 13:28197199-28197221 GCCTCTCCTCCAGCATCCCCAGG - Exonic
1106517678 13:30469307-30469329 GCCCTTCCTCCATCCCCTCTAGG + Intronic
1106976615 13:35225339-35225361 TCCTTTCCTCCAGCTGCAACAGG + Intronic
1107804004 13:44137167-44137189 GCCCCTCCTCCAGCTTCTCCTGG - Intergenic
1108385132 13:49892739-49892761 CCTTTCCCTCCACCTCCTCCAGG + Intergenic
1108590488 13:51908457-51908479 CCTTTCCCTCCACCTCCTCCAGG - Intergenic
1109127051 13:58530768-58530790 CCTTTTCCTCCACCTCCTCCAGG + Intergenic
1109562506 13:64070888-64070910 TCCACTCCTCCAGCTCCTCCTGG - Intergenic
1110565968 13:76957781-76957803 ACTTTTCCTCTAGGTCCTCCTGG - Exonic
1112489605 13:99849724-99849746 GCCCTTTTTCCATCTCCTCCTGG - Intronic
1113467727 13:110524087-110524109 ACCGGTCCTCCAGCTCCACCAGG + Exonic
1114360611 14:21968242-21968264 GCCTTTCCCCCATCTCAACCTGG - Intergenic
1114629773 14:24151601-24151623 GCCCTTCCGCCAGCGCCTCTGGG + Exonic
1114657711 14:24325987-24326009 GTCTTCCCTCCAGCCCCTCAGGG + Intronic
1118327805 14:64793277-64793299 GGCTCTCCTCCAGCTCCTCCAGG + Exonic
1118736665 14:68705954-68705976 ACCTTTCCTCCAGGTCACCCTGG + Intronic
1118768273 14:68924656-68924678 GCCTTTACCCCAGCTCTTCCTGG - Intronic
1119601618 14:75980644-75980666 GCATCTCCTCCAGCAGCTCCCGG + Exonic
1119712372 14:76831404-76831426 GCCAACCCTCCACCTCCTCCAGG - Intronic
1120468626 14:84894349-84894371 GGATTTTCTCCAGCTCCTACAGG - Intergenic
1121427068 14:93859948-93859970 TCCTTCACTCCAGCTCCTCCTGG - Intergenic
1121501615 14:94442665-94442687 GCCTTTCCTCTTGCTCCTTTGGG - Exonic
1121828978 14:97033630-97033652 GCCGCGCGTCCAGCTCCTCCCGG + Intergenic
1121865509 14:97359123-97359145 GCCTTTCCCCCAGGTCCTTCTGG + Intergenic
1122010651 14:98743764-98743786 GCTTTATCTCCAGCTCCTGCTGG - Intergenic
1122068107 14:99187774-99187796 GGCCTTCCTCCTCCTCCTCCTGG + Intronic
1122094329 14:99360372-99360394 GCCTGTCTTCCAGCTCCTATGGG - Intergenic
1123059460 14:105587942-105587964 GCCTGTCCACCACCACCTCCTGG + Intergenic
1123083795 14:105708212-105708234 GCCTGTCCACCACCACCTCCTGG + Intergenic
1124023684 15:25945586-25945608 GCCTGGCCTCCAGCTCCTTCAGG - Intergenic
1124429666 15:29595540-29595562 GCGTCTCCTACAGCTCCTCGTGG + Intergenic
1124609836 15:31200936-31200958 GCCTTCCCTCCAGGGCCTGCTGG + Intergenic
1125448829 15:39786615-39786637 GCCTGCCCTCCATCTCCTCAGGG + Intergenic
1125510364 15:40289313-40289335 GCTTCTCCTCCAGCTTCTCCTGG + Exonic
1125933215 15:43614520-43614542 GTCTCTCCTGCAGCTCCCCCAGG + Intronic
1125946313 15:43713982-43714004 GTCTCTCCTGCAGCTCCCCCAGG + Intergenic
1128528009 15:68425553-68425575 GCCCTTGCCCCACCTCCTCCAGG - Intronic
1129737670 15:77975094-77975116 AACCTTCCTCCAGTTCCTCCAGG + Intergenic
1129848410 15:78778525-78778547 AACCTTCCTCCAGTTCCTCCAGG - Intronic
1129974985 15:79814788-79814810 TCCTTTCCTCCTGTTCCTACTGG + Intergenic
1130281290 15:82522189-82522211 CTCTTACCTCCAGATCCTCCAGG - Intergenic
1130472665 15:84238372-84238394 CTCTTACCTCCAGATCCTCCAGG - Exonic
1130480156 15:84352943-84352965 CTCTTACCTCCAGATCCTCCAGG - Intergenic
1130484386 15:84390514-84390536 CTCTTACCTCCAGATCCTCCAGG - Intergenic
1130491613 15:84435186-84435208 CTCTTACCTCCAGATCCTCCAGG + Intergenic
1130503228 15:84514226-84514248 CTCTTACCTCCAGATCCTCCAGG + Intergenic
1130512348 15:84600402-84600424 CCCATTCTTCCAGCTTCTCCTGG - Intergenic
1130594960 15:85243006-85243028 CTCTTACCTCCAGATCCTCCAGG - Intergenic
1130904941 15:88233695-88233717 TCCTCTCCTCCCTCTCCTCCTGG + Intronic
1130948877 15:88570162-88570184 GCCTGTCCTCCCACTGCTCCTGG - Intergenic
1131413343 15:92229774-92229796 CCCTTTCATCCAGCCCCTGCTGG - Intergenic
1131981682 15:98000376-98000398 GACTTTCCTCATGCTCCTACTGG - Intergenic
1132318013 15:100904422-100904444 GCCCTCTCTCCTGCTCCTCCAGG + Intronic
1132342549 15:101087568-101087590 GCACTCCCTCCAGCACCTCCTGG + Intergenic
1132657038 16:1045747-1045769 GCCTGCCCTCCAGGTGCTCCCGG + Intergenic
1132697203 16:1207315-1207337 GCATGGCCTCCACCTCCTCCTGG + Exonic
1133342525 16:5045897-5045919 GCCTTTCCTGGAACACCTCCAGG - Intronic
1133735297 16:8610421-8610443 GCCTTTCTTCCAGCTCCTGGTGG - Intergenic
1134077634 16:11303206-11303228 GCCTTTCCTCCTGCCTCTCTTGG + Intronic
1134904054 16:17964138-17964160 GCACTTCCTCTAGCGCCTCCAGG + Intergenic
1135599483 16:23769780-23769802 GTGGTACCTCCAGCTCCTCCAGG - Intergenic
1136122670 16:28149310-28149332 GCCCTGCCGCCAGCGCCTCCAGG - Intronic
1136151977 16:28356827-28356849 CCCCCTCCTCCACCTCCTCCAGG - Intronic
1136157382 16:28392218-28392240 TCTTTTCCTCCAGCAGCTCCTGG + Intronic
1136205705 16:28723066-28723088 TCTTTTCCTCCAGCAGCTCCTGG - Intronic
1136396230 16:29993963-29993985 GCCTTTCCTGGAGCTCTTCTTGG + Exonic
1136471511 16:30483839-30483861 GCCGGGCCCCCAGCTCCTCCCGG - Exonic
1136591338 16:31219477-31219499 GCTTGTCCGCCACCTCCTCCAGG - Exonic
1137624601 16:49899873-49899895 GGGCTTTCTCCAGCTCCTCCTGG + Intergenic
1137698162 16:50476642-50476664 GCTTTTCCTCCAGCTCACCCAGG - Intergenic
1137977198 16:53041953-53041975 CCCATCCCTCCTGCTCCTCCAGG + Intergenic
1138017334 16:53441082-53441104 GCCTTTATCCCAGCTACTCCGGG - Intronic
1138336660 16:56258774-56258796 GAGTTTCCTGCAGCTCCTCTGGG + Intronic
1139139248 16:64241244-64241266 GGCTTGTCTACAGCTCCTCCAGG - Intergenic
1139182309 16:64762593-64762615 GCTTTTCCTCCTACTACTCCTGG + Intergenic
1139845067 16:69915000-69915022 GCCTTCCCTTCTCCTCCTCCTGG - Intronic
1140094090 16:71860368-71860390 GCCTCACCTCCCGCTCCTCGGGG + Exonic
1141639028 16:85330357-85330379 TCCTTTCTTCCAGCTTCTCCAGG - Intergenic
1141741213 16:85894314-85894336 TCCTTCCCTCCAGGGCCTCCTGG - Intergenic
1141804674 16:86334860-86334882 GCTTTCCCACCAGCTCTTCCAGG + Intergenic
1141913792 16:87078842-87078864 GCCTTTCCAGCAACACCTCCAGG - Intergenic
1142270492 16:89086605-89086627 CCCTTAACTCCAGCACCTCCTGG + Intergenic
1142711710 17:1727149-1727171 CCGTTTTCTCCAGCTCCTCCAGG - Exonic
1142965286 17:3577232-3577254 GCCCTTCCCTCAGCTCCTCCTGG - Intronic
1143370296 17:6435199-6435221 GCCCTTCCCCCCACTCCTCCTGG - Intronic
1143371849 17:6445167-6445189 TGCTGTCCTCCAGCTGCTCCTGG - Exonic
1143518174 17:7430288-7430310 ACCTCTGCCCCAGCTCCTCCCGG + Intergenic
1143936970 17:10496096-10496118 GCTGTTCCTTCAGGTCCTCCTGG + Exonic
1143939427 17:10524612-10524634 GCTGTTCCTTCAGGTCCTCCTGG + Exonic
1144676307 17:17164393-17164415 GCCGCTCCTCCAGCTGCTCGCGG - Intronic
1144749023 17:17635390-17635412 GCCATTCCATCACCTCCTCCAGG + Intergenic
1145272267 17:21411119-21411141 GCCTTGCCCTGAGCTCCTCCCGG + Intronic
1145278895 17:21454304-21454326 TCCCTTCCCCCAGCTCCCCCAGG - Intergenic
1145734676 17:27219534-27219556 CCCTTACCCCTAGCTCCTCCTGG + Intergenic
1145798396 17:27668724-27668746 GCCACTGCTCCAGCCCCTCCTGG + Intergenic
1146176637 17:30669357-30669379 GCCCTGCCTCCCGCTCCCCCAGG - Intergenic
1146225290 17:31060700-31060722 CTCTTACCCCCAGCTCCTCCTGG - Intergenic
1146350098 17:32085472-32085494 GCCCTGCCTCCCGCTCCCCCAGG - Intergenic
1146889682 17:36498340-36498362 GGCTTGCCTCCAGCTCCCCAGGG - Exonic
1147446537 17:40478389-40478411 GCCAGTCCTGCTGCTCCTCCAGG - Intronic
1147553395 17:41460980-41461002 GACCTTCTTCCAGCTCCTGCAGG + Intronic
1147598758 17:41733380-41733402 CCCTTACCTCAGGCTCCTCCAGG - Intronic
1147645768 17:42033021-42033043 GCCTCTCCTCCATCTCTTGCAGG + Intronic
1147741196 17:42671857-42671879 GCTTTTCCTCCAGCTGATGCAGG - Intronic
1148204914 17:45774203-45774225 GCTTTTCCTCAAGCTCTGCCTGG - Intergenic
1148605931 17:48928766-48928788 TCCATTCCTCGAGCTACTCCAGG + Exonic
1149666072 17:58365391-58365413 GCCCTTCCTCATGCTCTTCCAGG - Intronic
1149930172 17:60744085-60744107 GCCTCTCCAACAGCTCCTCATGG - Intronic
1149990597 17:61381253-61381275 GCCTTTCCATTTGCTCCTCCAGG - Intronic
1151272977 17:73011251-73011273 GCCTTTGCGCCAGCTCTGCCTGG - Intronic
1151555166 17:74842995-74843017 CCCCTTCCTCCCGCTCTTCCCGG - Exonic
1151669476 17:75564188-75564210 ACCTTACCTCCAAGTCCTCCTGG + Intronic
1151768799 17:76146361-76146383 GCCTGTGCTCAGGCTCCTCCAGG + Intronic
1151831035 17:76551029-76551051 GACTTTCCTCCAAGTCCTCCTGG + Intronic
1151847597 17:76668215-76668237 CCCTTTCCTCCTCCTCCTGCAGG + Intergenic
1152113824 17:78372661-78372683 GCCTTAACTCCAGCTCTCCCTGG - Intergenic
1152154259 17:78622638-78622660 GGCCTCCCTGCAGCTCCTCCCGG - Intergenic
1152233354 17:79125799-79125821 GCCATTTCTCCAGCACCTCTGGG + Intronic
1152385427 17:79971431-79971453 GCCTGTCCCCCAGGTCATCCTGG + Intronic
1152571626 17:81123661-81123683 GCCCGCCCTCCAGCTCCCCCAGG - Intronic
1152620841 17:81364085-81364107 GCCTCTCCCCCAGCTCCTGGTGG + Intergenic
1152825880 17:82464470-82464492 GCCTCACCTCCACTTCCTCCAGG - Intronic
1152917692 17:83050690-83050712 GCCTTTGCTCCAGCCTCTGCCGG + Intronic
1153756413 18:8288112-8288134 CCCTTTGGTCCAGCTTCTCCAGG + Intronic
1153895124 18:9551740-9551762 GGACTTCCTACAGCTCCTCCTGG - Intronic
1154028209 18:10726567-10726589 GTCCTTCCGCCAGCTCTTCCAGG + Intronic
1154110873 18:11567483-11567505 CCTCTTCCTCCACCTCCTCCAGG - Intergenic
1154348990 18:13567320-13567342 GCCTTCAGTCCAGCTACTCCAGG - Intronic
1155226295 18:23732331-23732353 GCTTTGCCTCCTCCTCCTCCTGG - Intronic
1155784925 18:29884154-29884176 GCCTTTCCTCCAACCCCAACAGG + Intergenic
1156526609 18:37774116-37774138 TCCCTTCCTCCAGCTCCTTGAGG - Intergenic
1157043635 18:44068828-44068850 CCATCTCCTCCAGGTCCTCCAGG + Intergenic
1157961177 18:52154968-52154990 GCCTTTCTTCCAGCTTCGGCTGG + Intergenic
1158374502 18:56847986-56848008 CCCTTTCCTACAGCTCCACTAGG - Intronic
1159877383 18:73827614-73827636 CCTTTTCCTCCATCTCCTCTTGG - Intergenic
1160025485 18:75211954-75211976 CCCCCTCCTCCTGCTCCTCCCGG - Intronic
1160776700 19:859814-859836 GACGGTCCTCCAGCCCCTCCAGG + Intronic
1161266653 19:3367385-3367407 GCCGGGCCTCCCGCTCCTCCCGG - Intronic
1161454522 19:4363380-4363402 GCTTCTCCGCCAGCTCGTCCAGG + Exonic
1161985354 19:7650452-7650474 CCCTCCCCTCCAGCTCCTCAGGG - Intergenic
1162061929 19:8101382-8101404 CCCATTCCTGCAGCTCCTCCTGG + Intronic
1162447026 19:10729736-10729758 TCCCTTCCTCCAGCTCTACCTGG + Intronic
1162464449 19:10831667-10831689 TCCTCTCCTCCTCCTCCTCCTGG + Exonic
1162982183 19:14247530-14247552 GCCCTGCCTCCCGCTCCCCCTGG + Intergenic
1163663016 19:18589650-18589672 GCGTCTGCTCCAGCTCCTGCAGG - Exonic
1164904878 19:31959249-31959271 CTATTTCCTCCGGCTCCTCCTGG - Intergenic
1164981828 19:32619918-32619940 GCCTTTCCTCTAGCACCCACAGG + Intronic
1165217083 19:34282800-34282822 GGCATTTATCCAGCTCCTCCAGG + Intronic
1165898270 19:39156169-39156191 CCCTTTCCTCCAGCCCATGCTGG + Intronic
1166689629 19:44814600-44814622 GCACTTCCTCCTGCTCATCCTGG - Exonic
1166700316 19:44878360-44878382 GCTCCTCCTCCTGCTCCTCCAGG - Intronic
925046465 2:776696-776718 GAGCTTCCTCAAGCTCCTCCAGG - Intergenic
926244746 2:11114227-11114249 CCCTGTGCTCCAGCTTCTCCAGG - Intergenic
926419796 2:12685445-12685467 GCCTCTCCCCCAGCTCCTGGGGG - Intergenic
927369093 2:22333737-22333759 GCCTTTCTGACAGCTCCTCCAGG - Intergenic
928215498 2:29357797-29357819 TCCTTTCCTCCTACCCCTCCAGG - Intronic
928311840 2:30217718-30217740 GCCCCTCCTCCACCTCCTGCTGG - Intergenic
928368871 2:30724423-30724445 GCCACCCCTCCAGCTCCTCTCGG + Intronic
928450274 2:31372192-31372214 AGCATTCCACCAGCTCCTCCTGG + Intronic
929960239 2:46490768-46490790 GCATTTCCTCCCTCTGCTCCTGG + Intronic
932180649 2:69643509-69643531 GCACTGCCTCCCGCTCCTCCCGG + Intronic
932971927 2:76554184-76554206 GGCATTCCTCCCTCTCCTCCAGG - Intergenic
934543685 2:95196901-95196923 GCCTATCCTCCTCCTCATCCTGG - Intergenic
935067697 2:99665067-99665089 GCCCTTCTCCCAGCTCCTGCAGG - Intronic
935244115 2:101203467-101203489 CGCTTTCCTCCGACTCCTCCTGG + Intronic
935351475 2:102154902-102154924 CCCTCCCCTCCACCTCCTCCAGG + Intronic
935548794 2:104430138-104430160 GCATCCTCTCCAGCTCCTCCAGG + Intergenic
936253634 2:110888737-110888759 GCTTTTCCTCCCTGTCCTCCAGG - Intronic
936514785 2:113174635-113174657 ACCTCTCCTCGAGCTTCTCCAGG - Intronic
938076071 2:128339053-128339075 GCTTTTCCTCCTGCTATTCCTGG - Intergenic
938317801 2:130342044-130342066 GTTTCCCCTCCAGCTCCTCCAGG + Exonic
938767287 2:134468803-134468825 GCCCTTCCTCCAGCTCCTAAAGG + Intronic
940800869 2:158131183-158131205 GCCTTTCTTCTACCTCTTCCTGG - Intronic
941077222 2:161019696-161019718 GCCTTACCCCCTGCTCTTCCAGG - Intergenic
941284594 2:163593739-163593761 GCCTTTCCTCCATCAGCTTCTGG + Intronic
942209670 2:173658007-173658029 GCCTTACTTCCGGTTCCTCCTGG - Intergenic
944540056 2:200746064-200746086 GCCTTTCCCCTAGCTCCTGCTGG + Intergenic
945197567 2:207251498-207251520 ACCTTTCCTCCACCTCCCTCCGG + Intergenic
945892773 2:215447767-215447789 GCCTCTCCTCCAGCTTCTGGTGG - Intergenic
946381967 2:219354977-219354999 CCCTTTCCTCCAGCCCTCCCAGG + Intergenic
946386137 2:219385660-219385682 TCCCCTTCTCCAGCTCCTCCTGG + Exonic
948205997 2:236163287-236163309 GCCCTCCCTCCTGCTCCTCGGGG - Intergenic
948379416 2:237542264-237542286 GCCCCTCCTCCAGCCCCTCATGG + Intronic
948432647 2:237929872-237929894 GCCATGCCTCCCACTCCTCCAGG + Intergenic
948538419 2:238666134-238666156 GCCCTTCTTCCACCTGCTCCTGG + Intergenic
948582820 2:238999497-238999519 GGCTTTCCTCCTGCCCCTCCTGG + Intergenic
948922916 2:241074188-241074210 GCCTTGCCCCCAGCTTCTCAAGG + Intronic
1168977743 20:1980760-1980782 TGCTTTTCTCCAGCTCCTTCAGG + Exonic
1169354686 20:4896908-4896930 GCCTTTGCTCCTGCCCCTGCTGG + Intronic
1169501228 20:6162812-6162834 GCTTTTCCTGCAGGCCCTCCTGG + Intergenic
1170734774 20:19005291-19005313 GGCTACCCTCCAGCTCCTCCAGG - Intergenic
1171293139 20:23994023-23994045 GCCTTTCCACCACCTCCACATGG - Intergenic
1172274523 20:33672528-33672550 GCCTTTCCTCCCGCCCAGCCTGG + Intronic
1172309701 20:33908177-33908199 GCCCTGCCCCCAGCTCCTGCAGG - Intergenic
1172353217 20:34260229-34260251 GCTAATCCTCCAGCTCCACCAGG + Intronic
1172790506 20:37502097-37502119 TCCTTCTCTCCAGCTCCACCTGG + Intronic
1173229476 20:41182973-41182995 GCCTCACCTCCAGATCCTGCTGG - Exonic
1173402169 20:42735342-42735364 CCTTTTCCTCCAATTCCTCCTGG - Intronic
1173626952 20:44480128-44480150 GCTTTTCCTGCAGCTCTTCCCGG - Exonic
1173837133 20:46133341-46133363 GCCCTTTCTCCAGCCCCTGCGGG - Intergenic
1174302977 20:49595565-49595587 TCCGTTCCTCCAGCTTCTCAAGG + Intergenic
1175798619 20:61788060-61788082 GCCTTTACTCCTGCTCTGCCTGG - Intronic
1175953592 20:62596645-62596667 ACGTTTCCTCCAGATCCTCTCGG - Intergenic
1176170568 20:63694650-63694672 GCCCTTCCTCCAGGAACTCCTGG - Intronic
1176177820 20:63737032-63737054 ACCCAGCCTCCAGCTCCTCCGGG + Intronic
1177630600 21:23722351-23722373 GCTTTTCCTGAACCTCCTCCAGG - Intergenic
1178237450 21:30859031-30859053 CCCTTACCTCCAGCTCTACCTGG - Intergenic
1178409145 21:32349441-32349463 GCCCCTCCTGCAGCTCTTCCTGG - Exonic
1179010193 21:37550771-37550793 GCTTTTTCTCCAGCTGCTCTGGG - Intergenic
1179085104 21:38209181-38209203 CCCTTTGCTCCTGCTGCTCCAGG - Intronic
1179154361 21:38836947-38836969 TCCTTTGCTCCTGCTTCTCCAGG + Intergenic
1180758259 22:18178281-18178303 GGCTCTCCTCCAGAGCCTCCAGG - Intergenic
1180768547 22:18362073-18362095 GGCTCTCCTCCAGAGCCTCCAGG - Intergenic
1180777763 22:18500318-18500340 GGCTCTCCTCCAGAGCCTCCAGG + Intergenic
1180810489 22:18757629-18757651 GGCTCTCCTCCAGAGCCTCCAGG + Intergenic
1180824199 22:18851739-18851761 GCCTTTCCACCACCTCCGCATGG - Exonic
1180826422 22:18865297-18865319 GGCTCTCCTCCAGAGCCTCCAGG - Intergenic
1180832683 22:18913926-18913948 TCCCTTCCTCAAGCCCCTCCAGG + Intronic
1181067179 22:20312468-20312490 TCCCTTCCTCAAGCCCCTCCAGG - Intergenic
1181188538 22:21122809-21122831 GCCTTTCCACCACCTCCGCATGG + Intergenic
1181196633 22:21191884-21191906 GGCTCTCCTCCAGAGCCTCCAGG + Intergenic
1181210662 22:21287684-21287706 GCCTTTCCACCACCTCCGCATGG - Intergenic
1181212894 22:21301240-21301262 GGCTCTCCTCCAGAGCCTCCAGG - Intergenic
1181501581 22:23318556-23318578 GCCTTTCCACCACCTCCGCATGG + Intergenic
1181616808 22:24060547-24060569 CCCTTTCCTCCAGCTTCTCCTGG - Intronic
1182670757 22:31993828-31993850 GCCTCTCCTCCAGCTTCTGAGGG + Intergenic
1182880287 22:33727109-33727131 AACTGTCTTCCAGCTCCTCCTGG - Intronic
1183295869 22:37029274-37029296 GGCTCTTCTCCAGCCCCTCCTGG - Exonic
1183295950 22:37029677-37029699 GCCTTTCCTCCCGCCCCTACTGG - Exonic
1183342182 22:37287550-37287572 GCCTCCCCGCCAGCTCCTGCCGG + Intronic
1183346794 22:37312506-37312528 CCCTTCCCTCCACCTCCACCAGG - Intronic
1183500103 22:38173650-38173672 TCCCGTCCTTCAGCTCCTCCAGG - Intronic
1183604928 22:38862749-38862771 GGCTCTCCTCCAGGACCTCCTGG + Exonic
1183733755 22:39632222-39632244 GCCTCTTCTCCAGCTGCTACCGG + Intronic
1183950031 22:41347661-41347683 GCCCTTCCCCTAGCTCTTCCAGG + Intronic
1184409971 22:44320738-44320760 GCCCTTCCTCCATCACCTGCAGG - Intergenic
1184487959 22:44792516-44792538 CCCTGCCCTCCTGCTCCTCCAGG + Intronic
1184724108 22:46333097-46333119 TCCTGTCTTGCAGCTCCTCCTGG + Intronic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
1184975318 22:48057632-48057654 CCCTCTCCTCCATCTCCTGCCGG - Intergenic
1185016569 22:48346649-48346671 GACTTTGCTCCAGGTCCTGCCGG + Intergenic
1185254608 22:49825422-49825444 CCCATACCTCCAGCTCCTCGTGG + Intronic
1185272529 22:49935688-49935710 GCCTCCACTCCTGCTCCTCCCGG - Intergenic
1185338977 22:50283283-50283305 GCCCCTCCTCCCGGTCCTCCCGG + Intronic
1185384336 22:50525010-50525032 GGCTTCCCAGCAGCTCCTCCGGG + Intronic
1185394914 22:50581965-50581987 GCCTGTGCTCCAGAGCCTCCAGG - Intronic
1185408189 22:50668301-50668323 TCCTTTCCTCCAGCTCCCATTGG - Intergenic
1203216285 22_KI270731v1_random:7746-7768 GCCTTTCCACCACCTCCGCATGG + Intergenic
1203230165 22_KI270731v1_random:102961-102983 GGCTCTCCTCCAGAGCCTCCAGG - Intergenic
1203274336 22_KI270734v1_random:77643-77665 GCCTTTCCACCACCTCCGCATGG - Intergenic
1203276565 22_KI270734v1_random:91203-91225 GGCTCTCCTCCAGAGCCTCCAGG - Intergenic
1203282768 22_KI270734v1_random:139231-139253 TCCCTTCCTCAAGCCCCTCCAGG + Intergenic
950693774 3:14682365-14682387 TCCATTCCTCCAGCCCCCCCAGG + Intronic
950697483 3:14714485-14714507 GCCTCTCCTTCACCTACTCCTGG - Intronic
950722912 3:14897637-14897659 GCCTTTCCTCCAGCTCCTCCAGG - Exonic
951903217 3:27677888-27677910 CCCTTTCTTCCAGCTTCTCTGGG + Intergenic
952415859 3:33091322-33091344 TCCTTTCCTCCTTGTCCTCCTGG - Exonic
954325776 3:49862518-49862540 GCCTATCCTCTAGCCCCTCCTGG - Intronic
954397588 3:50301059-50301081 GGCTGTGCTCCAGCTCATCCTGG + Exonic
954663348 3:52237701-52237723 GCCTGCCCGCCAGCTCCTCCTGG + Intronic
954673597 3:52303661-52303683 GCCTTTCCTCCACCTTATACAGG + Intergenic
954683148 3:52356610-52356632 GCCACTCCTCCAGAACCTCCTGG - Exonic
955317662 3:57952303-57952325 GCCTCTCCCCCAGCTCCTGATGG + Intergenic
956210593 3:66798081-66798103 GCGTGTCCCCCACCTCCTCCTGG - Intergenic
956735098 3:72232285-72232307 GCCTGTCCTCCAGGCTCTCCCGG + Intergenic
957273689 3:78063231-78063253 TCCTCTCCTCCATTTCCTCCTGG + Intergenic
957425540 3:80034483-80034505 GCCTCTCCTTCAGCTCCTTATGG - Intergenic
957445187 3:80307691-80307713 GCCTTTCCTGGAGATCCTCCTGG - Intergenic
959420943 3:106127604-106127626 GCCTTTCCACCTTTTCCTCCAGG + Intergenic
960974086 3:123158639-123158661 GCCTTACGTCCAGCTCCTTGAGG + Intronic
961210246 3:125120002-125120024 GCCTCCCCTCCAGCTCCCCCAGG - Intronic
961376861 3:126472996-126473018 GTCTTTGCTGCAGCTCCTCTTGG + Intronic
961796256 3:129411193-129411215 CCACTTCCTCCATCTCCTCCAGG + Exonic
961819459 3:129567880-129567902 GCCTCCGCTCCAGCTCCTCTGGG + Intronic
963238194 3:142975737-142975759 TCCTCTGCTCCAGCTTCTCCAGG - Intronic
963558838 3:146834129-146834151 GCCTCTCTTCCAGCTCCTGGTGG + Intergenic
963970343 3:151422403-151422425 GCCTCTCCTCCAGCTTCTGGTGG + Intronic
964222977 3:154367815-154367837 GCCTTTCCTGGAGATCCTCCTGG - Intronic
964295737 3:155231094-155231116 GCATTACCACCAGCACCTCCAGG - Intergenic
965921920 3:173927505-173927527 GTCTCTCCTCCTGCTCTTCCTGG + Intronic
966306015 3:178535614-178535636 TCCTTTCTTCCTGCTACTCCAGG - Intronic
966879391 3:184341450-184341472 GCCCTGCCTCCATCTCCTCTGGG + Intronic
966946886 3:184783176-184783198 TCCCTTCCTCCAGCACCTCCTGG - Intergenic
967186602 3:186949534-186949556 GCCTTTGGTTCATCTCCTCCTGG - Intronic
968078451 3:195830022-195830044 GCCCGCCCTCCAGCTCCTCTGGG + Intergenic
968486806 4:866824-866846 GCCCTTCCCCCACCTCCCCCAGG - Intronic
968533940 4:1112603-1112625 GCTTCTCCCCCAGGTCCTCCAGG + Intronic
968728628 4:2259666-2259688 GCCCCTCTTGCAGCTCCTCCTGG + Intronic
968759490 4:2434692-2434714 GCCTTTTCTTCAGCTCCCCAGGG - Intronic
968864312 4:3198029-3198051 GCCTTGTCTCTGGCTCCTCCAGG - Intronic
969203323 4:5622856-5622878 GACGCTCCTGCAGCTCCTCCAGG + Exonic
969318560 4:6396483-6396505 TCCTTTCCTCCAGTTTTTCCTGG + Intronic
969538393 4:7770554-7770576 GCCTGGCCTCCTGCTCCCCCTGG - Intronic
970157705 4:13158245-13158267 GAACTTCCTCCAGTTCCTCCAGG + Intergenic
972082676 4:35173097-35173119 GCCTTGCCTCAAGCTGGTCCAGG + Intergenic
972306067 4:37831264-37831286 GTCTTTCCTCCAGCATCTCAGGG - Intronic
972793808 4:42397605-42397627 TCTTTTCCTCCGGCTCCTCTCGG + Intergenic
975001193 4:69224620-69224642 GCCTTTCCTGGAGATCCTCCTGG + Intergenic
975004247 4:69267653-69267675 GCCTTTCCTGGAGATCCTCCTGG - Intergenic
975012661 4:69376623-69376645 GCCTTTCCTGGAGATCCTCCTGG - Intronic
975235582 4:71991341-71991363 ACCTTAGCTCCATCTCCTCCTGG - Intergenic
976059564 4:81110890-81110912 GCCATTCCTCCATATCCTCTAGG - Intronic
976471173 4:85430639-85430661 TCTTTTCCTCCAACTTCTCCTGG - Intergenic
976874604 4:89837493-89837515 GCCTTTCCTCTGGGTCCTCCCGG + Intronic
978587936 4:110293257-110293279 GCCCTTCCTCCTGGTCCTCCAGG - Intergenic
982117801 4:152112486-152112508 TCCTGCCCTCCAGCTCCTCAGGG + Intergenic
985015339 4:185627839-185627861 TCCCTTCCTCCCGCTCATCCTGG + Intronic
985084301 4:186297405-186297427 GCCTGTCCACCAGATGCTCCAGG + Intergenic
985381955 4:189404419-189404441 TTTTTTCCTCCTGCTCCTCCAGG - Intergenic
985519578 5:367205-367227 CTCTTCCCCCCAGCTCCTCCAGG - Intronic
985576579 5:676000-676022 GCCTCCCCTCCAGCTTCTCTGGG + Intronic
985752034 5:1686289-1686311 GCCCTGTCCCCAGCTCCTCCAGG - Intergenic
985933899 5:3080094-3080116 GCCCTCCTTCCAGCACCTCCAGG + Intergenic
986368505 5:7058485-7058507 GCCTGTCCTCCAGATGCTACAGG - Intergenic
988106466 5:26755612-26755634 ATCTTTCTTTCAGCTCCTCCTGG + Intergenic
988692028 5:33581951-33581973 GCCTTTCCCCCAGCTTCTGGTGG - Intronic
990325812 5:54674297-54674319 GCCATTTTTCCAGCTCCTCCAGG + Intergenic
991410226 5:66338462-66338484 GCCTGTTCTCCCTCTCCTCCAGG + Intergenic
992295683 5:75324323-75324345 CCCTTTGCTCCAGCATCTCCAGG + Intergenic
992488317 5:77216763-77216785 CCCTTTCATCAAGCTCCTGCTGG + Intronic
992497167 5:77305377-77305399 GGCTGCCCTCCAGCACCTCCTGG - Intronic
993311584 5:86338854-86338876 TTCTTTCCTCCAACTACTCCAGG + Intergenic
994708805 5:103240672-103240694 GCCTTTCCCCCAACCCATCCAGG - Intergenic
996646423 5:125823754-125823776 CTCTTTCCTCCAGCATCTCCTGG + Intergenic
997039390 5:130233908-130233930 GCCTTGTATCCAGCTCCTGCTGG + Intergenic
998283367 5:140834698-140834720 GCCTTTCCACGATCACCTCCAGG - Exonic
998359569 5:141573619-141573641 GGCATTCCTCCACCTCCACCCGG - Exonic
998412418 5:141921768-141921790 GCCTTTCTTCCTTCTCCACCTGG + Intergenic
1000121867 5:158205194-158205216 GTCTTTCCCCCAAGTCCTCCTGG - Intergenic
1001401467 5:171448889-171448911 CCCTTTCCTCCAGCCTCTCTTGG - Intronic
1002075548 5:176706179-176706201 GCCCTTCCCCCAGCCCATCCTGG - Intergenic
1002186728 5:177458117-177458139 GCTCTTGCTCCAGCTCCTCAAGG + Exonic
1002382578 5:178840913-178840935 GCCTTTCCTTCTCCTCCTCCAGG - Intergenic
1003534041 6:6960625-6960647 GCATTGCCTCAAACTCCTCCAGG + Intergenic
1004688192 6:17968294-17968316 CCTCTTCCTCCAGCTCCACCTGG - Intronic
1006101357 6:31688125-31688147 TCCTAACCTCCAGCCCCTCCAGG - Intronic
1006720339 6:36145907-36145929 GCCTTTCCCCCAGCTCCAGAAGG + Intergenic
1007554338 6:42753517-42753539 CCATTTCCTCCAGCTTTTCCAGG - Intronic
1007599615 6:43073701-43073723 CCCTTGCCTCCAACTCCTCTTGG + Intronic
1008226219 6:48920119-48920141 ACCTTTCCCACAGCTCCACCAGG - Intergenic
1008602838 6:53112522-53112544 CCCCACCCTCCAGCTCCTCCTGG + Intergenic
1014731002 6:125031201-125031223 CTTTTTCCTCCAGCGCCTCCAGG + Intronic
1015401669 6:132794878-132794900 GCCTGTGCCCCAGCTCCTCAGGG + Intronic
1017771167 6:157645584-157645606 GCCTTGCTTCCTGCTCTTCCGGG - Intronic
1018485560 6:164238050-164238072 GCCTGTCTTCCACCTCCTCAGGG + Intergenic
1018902522 6:168058651-168058673 GCTTCTCCTCTAGCTCCTCTGGG + Intronic
1018968076 6:168504146-168504168 GCTTCTCATCCAGCTCCTCTGGG + Intronic
1019374433 7:681847-681869 GCCTTTCCTCCTGCACCTGGAGG + Intronic
1019661306 7:2225484-2225506 GCATTTTCTCCCGCTCCACCTGG + Exonic
1019999861 7:4749563-4749585 CTCCTTCCTCCAGCCCCTCCAGG + Intronic
1020668204 7:11073625-11073647 GCCCTTCCCACAGCTCCACCAGG + Intronic
1022140828 7:27491885-27491907 GCCTCTCCTACTCCTCCTCCAGG + Intergenic
1022482634 7:30753846-30753868 GCCACTTTTCCAGCTCCTCCCGG - Exonic
1023000362 7:35801614-35801636 GCCTTTCCTCAGTCTCCTCCCGG + Intronic
1023481747 7:40642468-40642490 GCCCTTCCTCCAGCTAATACTGG - Intronic
1024042534 7:45566477-45566499 CGCTTTCTTCCAGCACCTCCTGG - Intergenic
1024360098 7:48459310-48459332 GCATATCCTACAGGTCCTCCTGG + Intronic
1024453739 7:49579742-49579764 GCCACTCCTCCAGCCCCTTCCGG + Intergenic
1026011257 7:66638349-66638371 GCATGTTCTCCAGCTGCTCCAGG - Exonic
1026738893 7:72966118-72966140 GCCAGTCCTCCAGCTCCAGCAGG + Exonic
1026948623 7:74332724-74332746 GCCCTCCCTCCCGCTCCCCCGGG + Intronic
1027104840 7:75398951-75398973 GCCGGTCCTCCAGCTCCAGCAGG - Exonic
1027222142 7:76220813-76220835 GATTTTCCTCCAGCTCCAGCAGG + Intronic
1029524776 7:101087990-101088012 GCGCTGCCTCCAGCTCCACCAGG - Exonic
1031049536 7:116931127-116931149 AACTTTCCTCCAACTCTTCCTGG + Intergenic
1031436573 7:121739337-121739359 CCCTTTCCTCCTCCTCCTCTAGG - Intergenic
1033549805 7:142436704-142436726 GCCTGTCCTCCAGGGTCTCCAGG - Intergenic
1033591634 7:142813299-142813321 GCCTTTCCTTCAGCTAGTCTGGG + Intergenic
1034200013 7:149278445-149278467 GCCCTTCTTTCAGCTCCTCCTGG - Exonic
1034519070 7:151604779-151604801 GCATCTCCTCGGGCTCCTCCTGG + Intronic
1035488505 7:159251523-159251545 GCCTTAGCTCCATCTCTTCCTGG + Intergenic
1036161130 8:6389417-6389439 GCCTCTCCTCCAGCTCCTCATGG - Intergenic
1036470488 8:9048484-9048506 TCCTTTCCTCCATCTCCCCCAGG + Intronic
1036920632 8:12851077-12851099 TCCCTTCCCCCAGCTCCTGCTGG + Intergenic
1037189553 8:16106198-16106220 GCCTTCCCCCTACCTCCTCCTGG - Intergenic
1037326175 8:17693571-17693593 GCCCTTCCTCAAGCCCCTCAAGG + Intronic
1037652617 8:20852757-20852779 GCCTTTCCTTCTGCCCCACCCGG + Intergenic
1037859190 8:22392730-22392752 CCCTTTGCTCCAGCTCCAGCTGG + Intronic
1037959340 8:23084364-23084386 GCCTCCCCTCCACGTCCTCCAGG - Intronic
1037988836 8:23306430-23306452 GCCTTTCTGGCAGCTCCTTCTGG - Intronic
1037996264 8:23354516-23354538 GCCTTTTCTCCAGCCCCTGATGG - Intronic
1038462845 8:27730981-27731003 GCCACTCCTCCAGGACCTCCTGG + Intergenic
1038524707 8:28262986-28263008 CCCTTTCCTTCAGGTCTTCCTGG - Intergenic
1038652785 8:29420830-29420852 CACTTTCCCCCAGCACCTCCAGG - Intergenic
1039408409 8:37331876-37331898 GCCTCTCCTCCAGCTTCACATGG + Intergenic
1041124439 8:54621248-54621270 CGCCGTCCTCCAGCTCCTCCAGG - Exonic
1042053355 8:64735021-64735043 TCCTTAGCTCCACCTCCTCCAGG - Intronic
1042868543 8:73377231-73377253 GCCTTGATTCCACCTCCTCCTGG + Intergenic
1043553491 8:81402465-81402487 GCATTTCCCCCTGCTCCTCCAGG + Intergenic
1043807597 8:84691715-84691737 CCCTTTCCTCCCTTTCCTCCAGG - Intronic
1045075286 8:98559438-98559460 GCCTTTCATGGGGCTCCTCCAGG - Intronic
1045645131 8:104290542-104290564 GCCTGTCCTCCAGATGCTACAGG + Intergenic
1046767106 8:118081664-118081686 CCCTTTTCCCCATCTCCTCCTGG - Intronic
1046801454 8:118432977-118432999 GCCTTTGCTTCAACACCTCCAGG - Intronic
1046806788 8:118487373-118487395 GCTTGTCTTCCAGCCCCTCCTGG - Intronic
1046887974 8:119389622-119389644 GCCTGGCCTGCAGCTTCTCCAGG + Intergenic
1047495379 8:125405148-125405170 GCCCCTCTGCCAGCTCCTCCCGG - Intergenic
1048268352 8:133007242-133007264 GCCTCTCCTCCCCCTTCTCCCGG - Intronic
1048725926 8:137384022-137384044 GACTTTTCTCCAGCTTCTGCTGG - Intergenic
1048972163 8:139651192-139651214 GCCTTCACTCCAGCCCCACCTGG - Intronic
1049005601 8:139853653-139853675 GCCTTTGCATCAGTTCCTCCTGG + Intronic
1049402150 8:142433247-142433269 TCCCTTCATCCAGCTCTTCCTGG + Intergenic
1049492266 8:142911733-142911755 GCCTTGTCCCCAGCTCCACCTGG - Exonic
1050279633 9:4036786-4036808 GGCTTTCCTGAAGTTCCTCCTGG - Intronic
1055278643 9:74648772-74648794 CCCTTTCCTTGAGCTGCTCCTGG - Intronic
1055321563 9:75088117-75088139 CCCTTTCCCCACGCTCCTCCTGG + Exonic
1055395885 9:75874647-75874669 GCCTTTCTTCAAGCTCCTGAAGG + Intergenic
1055500695 9:76899856-76899878 GCTTTTCCTCCAGCTCTCCTTGG - Intronic
1056179305 9:84066205-84066227 GCCTTCCCTCCTTCTCCTCTCGG + Intergenic
1056312326 9:85353017-85353039 CCCTTTCCTGCAGCTCCACCAGG + Intergenic
1056736655 9:89215506-89215528 TCATTTCCTCCAGGACCTCCTGG - Intergenic
1057179155 9:93020522-93020544 GGCTTTCCTCCTGCTACACCAGG + Intronic
1057291360 9:93809516-93809538 CCCTTGCCTCCAGCAGCTCCAGG + Intergenic
1057497365 9:95571827-95571849 CCCTCTCCTCCTCCTCCTCCTGG - Intergenic
1057745451 9:97747417-97747439 GTCTCTCATCCTGCTCCTCCAGG - Intergenic
1058115279 9:101078021-101078043 GACTTTCTCCTAGCTCCTCCAGG - Intronic
1058195386 9:101968174-101968196 GCCTTTCCTGCAGTTCCTAAAGG + Intergenic
1058217460 9:102253140-102253162 TCCTTTCCTCCACCATCTCCTGG + Intergenic
1060794438 9:126504580-126504602 CCCTTTCCTCCCGTTCCTCTGGG - Exonic
1061188858 9:129070435-129070457 GCCTCTACTGCAGCTCCCCCAGG - Exonic
1061288778 9:129639238-129639260 GCCCTGCCTGCAGCGCCTCCTGG - Exonic
1061714578 9:132510631-132510653 GGCCTGCCTGCAGCTCCTCCTGG - Intronic
1062142045 9:134964622-134964644 GCGTGGCCTCCAGCTCCTGCAGG - Intergenic
1062577883 9:137217028-137217050 TTCCTTCCTCTAGCTCCTCCCGG + Intergenic
1185501497 X:600088-600110 GCCTCTTCCCCAGCTCCTGCTGG + Intergenic
1186162514 X:6792599-6792621 GGCTTTCCTACATTTCCTCCTGG + Intergenic
1186377846 X:9026364-9026386 GTCTTTCCTCCCACTTCTCCAGG - Intronic
1186862793 X:13689618-13689640 GCCTTTCCCCCAACCACTCCGGG + Intronic
1186978785 X:14936813-14936835 GTCTTTCCTGCTTCTCCTCCTGG + Intergenic
1187126311 X:16457590-16457612 TCCTTTCCTCCTCCTCCTCTTGG - Intergenic
1188953490 X:36406338-36406360 GCCTTTGCTCACACTCCTCCAGG - Intergenic
1190102099 X:47529653-47529675 GCCTCTCCTCCAGCTGCTGGTGG + Intergenic
1192190785 X:68990063-68990085 CCCTATCGACCAGCTCCTCCTGG + Intergenic
1193462984 X:81811782-81811804 GCCTTTCCTGGAGATCCTCCTGG + Intergenic
1195883635 X:109618430-109618452 GCCTTTCCTCTAGCAAGTCCAGG - Intergenic
1195952196 X:110286734-110286756 CCCATTCCACCAGCTCCTTCCGG + Intronic
1196029076 X:111075687-111075709 CCCCTTCCTACAGCTCCACCAGG - Intronic
1197060301 X:122171296-122171318 GCGTTTTCTCCACCTCCTCATGG - Intergenic
1197699594 X:129588799-129588821 TCCTTTCCTCAAGCTCCTACAGG - Intronic
1197813357 X:130470559-130470581 GACTCTGGTCCAGCTCCTCCAGG + Intergenic
1199709519 X:150459224-150459246 GCCTTTGGTCCAGGGCCTCCTGG - Intronic
1200287169 X:154834350-154834372 GCAGGTCCTCCAGCTCCTGCTGG - Intronic
1201715226 Y:17037291-17037313 TGCTTTTCTCCAGCACCTCCAGG - Intergenic
1201750274 Y:17423796-17423818 GCCTTTCCTGGAGATCCTCCTGG + Intergenic
1202366696 Y:24170700-24170722 CTCTTACCTCCAGATCCTCCAGG - Intergenic
1202373709 Y:24214782-24214804 CTCTTACCTCCAGATCCTCCAGG + Intergenic
1202497072 Y:25455338-25455360 CTCTTACCTCCAGATCCTCCAGG - Intergenic
1202504086 Y:25499423-25499445 CTCTTACCTCCAGATCCTCCAGG + Intergenic