ID: 950723990 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:14904126-14904148 |
Sequence | GGCTGAAGTCACCTGGTGGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 308 | |||
Summary | {0: 2, 1: 0, 2: 5, 3: 30, 4: 271} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
950723984_950723990 | 5 | Left | 950723984 | 3:14904098-14904120 | CCACTGTTGATGTTGACCTTGGT | 0: 1 1: 9 2: 22 3: 63 4: 448 |
||
Right | 950723990 | 3:14904126-14904148 | GGCTGAAGTCACCTGGTGGCAGG | 0: 2 1: 0 2: 5 3: 30 4: 271 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
950723990 | Original CRISPR | GGCTGAAGTCACCTGGTGGC AGG | Intronic | ||