ID: 950723990

View in Genome Browser
Species Human (GRCh38)
Location 3:14904126-14904148
Sequence GGCTGAAGTCACCTGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 2, 1: 0, 2: 5, 3: 30, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950723984_950723990 5 Left 950723984 3:14904098-14904120 CCACTGTTGATGTTGACCTTGGT 0: 1
1: 9
2: 22
3: 63
4: 448
Right 950723990 3:14904126-14904148 GGCTGAAGTCACCTGGTGGCAGG 0: 2
1: 0
2: 5
3: 30
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950723990 Original CRISPR GGCTGAAGTCACCTGGTGGC AGG Intronic