ID: 950723990

View in Genome Browser
Species Human (GRCh38)
Location 3:14904126-14904148
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 2, 1: 0, 2: 5, 3: 30, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950723984_950723990 5 Left 950723984 3:14904098-14904120 CCACTGTTGATGTTGACCTTGGT 0: 1
1: 9
2: 22
3: 63
4: 448
Right 950723990 3:14904126-14904148 GGCTGAAGTCACCTGGTGGCAGG 0: 2
1: 0
2: 5
3: 30
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900421788 1:2558907-2558929 GGAAGAGGTCACCTGGAGGCTGG + Intronic
900636418 1:3668166-3668188 GGCTGCAGTGACCTCCTGGCAGG - Intronic
901228382 1:7628260-7628282 GGTTGGAGTCACTTGGAGGCAGG - Intronic
901627352 1:10631640-10631662 GGCTGAACCCACCTGCTGGAGGG + Intergenic
901734549 1:11304211-11304233 GGCTGCAGTTGGCTGGTGGCTGG + Intergenic
901735287 1:11308498-11308520 GGCTGCAGTTGGCTGGTGGCTGG - Intergenic
903555355 1:24188911-24188933 GGCTGAGGTCACCTGAGGTCAGG - Intergenic
903733341 1:25514262-25514284 GGGTGAAGTCAGCTGGGGGAGGG - Intergenic
904011496 1:27392807-27392829 GGCGGAAGGCTCCTAGTGGCCGG + Intronic
905654526 1:39677491-39677513 GGCTGTATTCACCTGGAGGAAGG + Intergenic
906068554 1:43000439-43000461 CGCTGCAGTCATCTGGGGGCTGG - Intergenic
907270849 1:53290229-53290251 GGCTGTAGGCACCGGGGGGCAGG - Intronic
907438790 1:54465694-54465716 GGCTGCAGTCACATAGAGGCAGG + Intergenic
908395875 1:63725281-63725303 GTCTGAAGTCACCTGGGGGATGG - Intergenic
908428919 1:64036845-64036867 GGTTGCAGTCAGATGGTGGCTGG + Intronic
909683606 1:78320763-78320785 GGCTTAATTCACCTGGTAGCTGG + Intronic
912333520 1:108841796-108841818 GGCTGAAGTCACCTCAGGACAGG - Intronic
913030099 1:114892866-114892888 GGATGTAGTCTCCTGGGGGCTGG + Intronic
913182917 1:116339948-116339970 GGCTGCAGTCATCTGAAGGCTGG + Intergenic
914880129 1:151540509-151540531 GGCTGACATCACCTGGTGCCCGG + Intronic
916037082 1:160931954-160931976 GGTTGCAGTCACATGGTGGCTGG + Intergenic
916106106 1:161433568-161433590 TGCTGAGGTCACCTGTTGGTGGG + Intergenic
922284972 1:224162917-224162939 GTCTAAAGTCACCTTCTGGCCGG + Intergenic
922329112 1:224558128-224558150 GGCTGTAGCCATCTGATGGCTGG + Intronic
922552984 1:226510740-226510762 TGCTGCAGTCAAATGGTGGCTGG - Intergenic
922745188 1:228039325-228039347 GGCTGCTGGCAGCTGGTGGCTGG - Intronic
923076398 1:230612766-230612788 GGCTGAAGTCATCTGAAGGCTGG + Intergenic
923215535 1:231845031-231845053 AGCTGAAGCCTCCAGGTGGCAGG + Intronic
923737994 1:236630114-236630136 GACTGAATTCAGCAGGTGGCTGG - Intergenic
1063913971 10:10862309-10862331 AGCTGCAGTCACATGTTGGCTGG + Intergenic
1064857820 10:19791262-19791284 GACTGAAGTCACCTGATAACTGG + Intergenic
1064886105 10:20114247-20114269 GGCTGAGGTCAGATGGTGGAAGG - Intronic
1070150735 10:73803297-73803319 GGCTGAAATCACCTGATAGAAGG + Exonic
1070642644 10:78180623-78180645 GGCTGCAGTAACCGGGTGGAGGG - Intergenic
1072626231 10:97113997-97114019 GGCTTCAGGCACCTGGTAGCGGG - Intronic
1074543617 10:114385878-114385900 GGCTGCAGGTACCTGGTGGAGGG + Intronic
1075594364 10:123717468-123717490 GGCTGGGGCCACTTGGTGGCTGG - Intronic
1075685053 10:124357885-124357907 GGCTGGCGTCACCTTCTGGCAGG + Intergenic
1076849033 10:133083976-133083998 GGCTGAAGGCTCCTGGCGGGAGG + Intronic
1077025732 11:439090-439112 CGCTGAGGTGACCTGGGGGCTGG - Intronic
1077434602 11:2532763-2532785 GGCAGAAGTCACCTGACAGCAGG + Intronic
1078489268 11:11754292-11754314 GACTGAAGTCACCTCGTGGAGGG - Intergenic
1079190162 11:18270326-18270348 GGCTGTAGCCACTGGGTGGCAGG - Intergenic
1080764240 11:35280892-35280914 GGCTGATGTCCTCTGTTGGCAGG + Exonic
1080861595 11:36154830-36154852 GCCTGGGGTCACCTGGTGGTTGG - Intronic
1081591364 11:44425475-44425497 GGCCAAAGCCACCTGTTGGCAGG - Intergenic
1081740456 11:45435902-45435924 GGCTGGATTCAGCTGGTGGTTGG - Intergenic
1081811669 11:45917699-45917721 GGCTTCAGTTACCTGCTGGCAGG - Exonic
1083129216 11:60607900-60607922 GGCTGATGTGACCTGGGGGTAGG - Intergenic
1084453923 11:69256576-69256598 GGCTGCAGTCACAGGGTGCCTGG - Intergenic
1085730725 11:78996435-78996457 GGCTTTAGTCGCATGGTGGCTGG - Intronic
1085751744 11:79168091-79168113 TGCTGAAGTCTGCTGCTGGCAGG + Intronic
1085968590 11:81559192-81559214 AGATGAAGTCACATGGTGCCAGG - Intergenic
1089078230 11:115756077-115756099 AGCTGTAGTCCCATGGTGGCAGG + Intergenic
1090010896 11:123045216-123045238 AGATGCAGTCAGCTGGTGGCTGG + Intergenic
1090194702 11:124804774-124804796 GGTTGTCGTCAGCTGGTGGCTGG - Intergenic
1090493118 11:127183383-127183405 GGCAAAAGTCAACTGGTGGGAGG - Intergenic
1090701784 11:129302719-129302741 GGCTGAAGTCAACAGGGAGCAGG - Intergenic
1091763164 12:3101063-3101085 GTCTGAAGTCATCTGGAGGAGGG + Intronic
1092090260 12:5798244-5798266 GGGTGAAGGCACCTGGTCACAGG + Intronic
1092173264 12:6386152-6386174 GGCTGCACTCACCTGGTGTGGGG - Exonic
1092261127 12:6953824-6953846 GGCTGGAGTCACCTCCGGGCAGG + Intronic
1092824385 12:12384800-12384822 AGCTGCAGTCAGTTGGTGGCTGG + Intronic
1093178371 12:15939258-15939280 GGCTAAACTCAGATGGTGGCTGG - Intronic
1094371017 12:29737588-29737610 GGCAGAAGTCTCCTGGGAGCAGG - Intronic
1097687030 12:62700689-62700711 GGATGATGTCACCAGGTGGATGG + Intronic
1098183664 12:67874694-67874716 GGCTGTAGTCAGATGGTGGCTGG - Intergenic
1100475536 12:94932043-94932065 GGTAGAAGGCACCTGGGGGCTGG + Intronic
1101433753 12:104647797-104647819 GGCTGTAGTCAGATGTTGGCTGG + Intronic
1101512218 12:105403550-105403572 GGGAGATGTCAGCTGGTGGCTGG - Intergenic
1102190330 12:110982929-110982951 GGTTGCAGTCAGCTGGTGGCAGG - Intergenic
1103237454 12:119385256-119385278 GGCTGAATCCAACTGGAGGCTGG - Intronic
1103923320 12:124410693-124410715 TGCTGAAGTCACTTGATGGTGGG - Intronic
1104474765 12:129062147-129062169 GGCTGCACTCACCTGCTGGCTGG + Intergenic
1104695951 12:130863891-130863913 GGCTACAGTCACCTGAAGGCTGG + Intergenic
1104733956 12:131124629-131124651 GGCTGTAGACGCCTGGTGGGGGG - Intronic
1105890604 13:24680318-24680340 GGCTGTACTCACCTGGATGCCGG + Intergenic
1107872934 13:44763780-44763802 CCCTGAGGTCTCCTGGTGGCGGG + Intergenic
1108057709 13:46500804-46500826 GGCTGAGGTCACCTGAGGTCAGG + Intergenic
1108418971 13:50229249-50229271 GTCTAAAGTCACATGGCGGCTGG - Intronic
1108633454 13:52309716-52309738 GGCTGACATCACATGTTGGCAGG + Intergenic
1108653236 13:52502821-52502843 GGCTGACATCACATGTTGGCAGG - Intergenic
1109332303 13:60944576-60944598 GGCGGAAGTCACCTGGTATCTGG + Intergenic
1109715605 13:66218199-66218221 GGTTGTAGTCAGTTGGTGGCTGG + Intergenic
1110498697 13:76200434-76200456 CCCTGGAGTCACCTGTTGGCAGG + Intergenic
1112991580 13:105520309-105520331 GGATGAAGTCTCCAGGTAGCAGG + Intergenic
1114309592 14:21454966-21454988 TGCTGAAGTCATCTGGTGTGGGG - Intronic
1116803395 14:49466859-49466881 TGCTGATGTGTCCTGGTGGCAGG - Intergenic
1117440630 14:55755942-55755964 GGCTGCAGTCATCTGTAGGCTGG + Intergenic
1119675188 14:76548184-76548206 GGCTGCTGTCACCTCCTGGCTGG + Intergenic
1119998481 14:79278509-79278531 GGGTGAAGTCCCCTGGGCGCTGG - Intronic
1121338766 14:93092822-93092844 TGCTGGAGTCTCCTGGTGCCTGG - Intronic
1121468625 14:94133561-94133583 GGTAGAAGGCAGCTGGTGGCCGG - Intergenic
1125503060 15:40251616-40251638 GGCTGCCGTCAAGTGGTGGCTGG - Exonic
1126664370 15:51062964-51062986 GGTTGGAGTGACATGGTGGCTGG + Intronic
1126853942 15:52819114-52819136 GGCTGAAGCCACCAGATGGATGG + Intergenic
1128091789 15:64924095-64924117 GGCTGCAGTCAGCAGGTGGGTGG + Intronic
1128329228 15:66745032-66745054 GCCAGAGGTCACCTGGTGGGGGG - Intronic
1128500955 15:68227516-68227538 GGCTGAAGCCACATTGTGGGGGG + Intronic
1128553393 15:68613491-68613513 GTCTTCAGTCCCCTGGTGGCTGG + Intronic
1128746353 15:70117097-70117119 AGCTGAAGTCACCCGCTGGCTGG + Intergenic
1130706331 15:86236754-86236776 GGCAGAAATCAGCTGGAGGCTGG + Intronic
1132654966 16:1037890-1037912 GGCCGAGGTCACCTGAAGGCTGG - Intergenic
1132693681 16:1192783-1192805 GGCTGGAGACATCTGGAGGCGGG + Intronic
1135422479 16:22314345-22314367 GGCTAGAGTCACCTGGGAGCAGG + Intronic
1137757330 16:50913060-50913082 GGCTGGGCTCACCTGGGGGCAGG + Intergenic
1138655329 16:58488024-58488046 GGCTGAAGCCACCGTGAGGCTGG - Intronic
1138702777 16:58881996-58882018 GGCTGAATTCACTTAATGGCTGG + Intergenic
1139688496 16:68623020-68623042 AGCTGCAGTCATCTTGTGGCTGG - Intergenic
1141630081 16:85282974-85282996 GGCTGGAGTCACCTGCAGGCTGG + Intergenic
1141809450 16:86365185-86365207 GGATGATGTCACCTGGGGGTGGG - Intergenic
1142747994 17:1969905-1969927 GGTTGCAGTCAGATGGTGGCAGG + Intronic
1145266708 17:21383156-21383178 GGATGGAGTGGCCTGGTGGCCGG + Intronic
1146210135 17:30935846-30935868 AGATGAAGTCACATGGTGGAGGG + Intronic
1147915159 17:43881457-43881479 GGATGATGCCAACTGGTGGCAGG - Exonic
1148558620 17:48593311-48593333 GGCTGAGGTCGCCTGGTCGGAGG + Exonic
1148851102 17:50555766-50555788 GGCCGAGGTCACCTGGTGGCAGG - Exonic
1149535969 17:57433554-57433576 GGTTTAAGCCACCTGGTTGCAGG + Intronic
1149790919 17:59476298-59476320 GGCTGCAGTCAGATGCTGGCTGG - Intergenic
1149996874 17:61410272-61410294 GGCTGGAGACACCTGCTAGCTGG - Intergenic
1151169408 17:72234367-72234389 GGCTCATGTCACTTGGTGGAGGG + Intergenic
1151439889 17:74121548-74121570 GGCTGCAGTCATCTGAAGGCTGG + Intergenic
1151513035 17:74573375-74573397 GGCACAAGTCACCTGCTGGATGG - Intergenic
1152073382 17:78145024-78145046 GGCAATGGTCACCTGGTGGCAGG + Intergenic
1152588208 17:81198490-81198512 GGGAGGAGTCCCCTGGTGGCTGG - Intronic
1153499339 18:5732133-5732155 GGCTGGACTCATCTGGTTGCTGG - Intergenic
1155259344 18:24026175-24026197 AAATAAAGTCACCTGGTGGCTGG - Intronic
1157823382 18:50790231-50790253 GGCTGAGGTCCCCTGGTGAAAGG + Intergenic
1159616161 18:70582346-70582368 GGCAGAAATCACCTGGTTCCTGG + Intergenic
1160013648 18:75125158-75125180 GGCTGAAGGCACCTGGTCCTGGG + Intergenic
1160096776 18:75880495-75880517 GGCTTCAGTCAGCTGGTGGCTGG - Intergenic
1160551225 18:79694637-79694659 GGCTGAGGGCACCTAGGGGCGGG + Intronic
1161149645 19:2701345-2701367 GGCTGGAGACACCTGGGGGCAGG - Intronic
1165245024 19:34493804-34493826 GGCAAAAGACAGCTGGTGGCCGG - Intronic
1165939300 19:39407289-39407311 GGCTGAAGTCTCAGGGTGGGGGG + Intronic
1166764610 19:45245379-45245401 GGCTGAAGTAGCCTGGGGACAGG - Intronic
1166967460 19:46538160-46538182 GGCTGCAGTCACATGGGGGCTGG - Intronic
1167484955 19:49757277-49757299 GGCTGCAGTCACCTGAAGGTTGG - Intronic
1167741177 19:51325787-51325809 GGCTTAGGGCACCTAGTGGCAGG - Intronic
1168607376 19:57770648-57770670 GTCTGAAGTCATCTGGCTGCAGG + Intronic
1168723390 19:58567524-58567546 GGCTGAAGTTACCTTCTTGCAGG + Intronic
925083899 2:1092445-1092467 GGCTGAACAAACCTGGGGGCAGG + Intronic
925574617 2:5348374-5348396 GGTGGAAGTCACCTGGTGAATGG + Intergenic
925808089 2:7672244-7672266 GGATGCAGCCACCAGGTGGCAGG - Intergenic
927125712 2:20011335-20011357 GGCTAGATTCAGCTGGTGGCTGG - Intronic
927191977 2:20523312-20523334 GGCTGAAGGCACCTGGGGATAGG - Intergenic
928176586 2:29038192-29038214 ATCTGAACTCACCTGGTAGCAGG + Intronic
930379286 2:50607192-50607214 GTCTGAAGTGAGCTGGCGGCAGG - Intronic
933194427 2:79372173-79372195 GACTGATGGCATCTGGTGGCAGG + Intronic
934624526 2:95835526-95835548 GGCTGAAGTCCCCGGTTGGGAGG - Intergenic
934650188 2:96086062-96086084 GGCAGAAGTCACCTGGGGGAAGG + Intergenic
936284672 2:111173037-111173059 AGCTGAAATGCCCTGGTGGCTGG - Intergenic
938900660 2:135796422-135796444 GGCTGAGGCCACATGGTGGAGGG - Intronic
939053622 2:137334974-137334996 GGCAGAAGTCACCTCTTGACAGG - Intronic
940803292 2:158156547-158156569 GGTTGCAGTCACATGATGGCAGG + Intergenic
942966252 2:181895825-181895847 TGCTGAACTGACCTGATGGCAGG + Intronic
946521576 2:220470260-220470282 GGCACAACTCACATGGTGGCAGG - Intergenic
946756601 2:222953750-222953772 GGGGGAAGTCACCAGGTGACAGG - Intergenic
947426574 2:229988761-229988783 GGCTGAGGTCACCTGAGGTCAGG - Intronic
948310017 2:236978216-236978238 GGCTGCATTCAGCTGGTGCCTGG - Intergenic
948315843 2:237027611-237027633 AGCTGAGTCCACCTGGTGGCCGG + Intergenic
948387560 2:237591120-237591142 GGCTGATGCCACCTGAGGGCGGG + Intronic
948799830 2:240427537-240427559 GGCTGGAGTGGCCAGGTGGCTGG - Intergenic
1169264952 20:4161984-4162006 GGCGGCAGCCACCGGGTGGCAGG + Intronic
1170332072 20:15224113-15224135 GGTTGTAGTCAACTGGTGGCTGG - Intronic
1170608317 20:17890558-17890580 GGCTGCAGTCAGGTGTTGGCTGG - Intergenic
1171003171 20:21435302-21435324 ATCTGAAGTCACCTTTTGGCAGG + Intergenic
1172361775 20:34317697-34317719 GGCTGCAGTCTGGTGGTGGCTGG + Intergenic
1172364275 20:34336915-34336937 GGCTGCAGTCATCTGGAAGCTGG - Intergenic
1172839658 20:37894665-37894687 GGCTGAAGTCACACAGTGGCTGG - Intergenic
1173326770 20:42040897-42040919 GCCTGGAGTCACCTGGAGGAAGG + Intergenic
1173564201 20:44027665-44027687 GGCTGAAGTCAACTGGTGTCTGG - Intronic
1176310446 21:5146277-5146299 GGCTGAAGCCCCCTGCGGGCTGG - Exonic
1178372173 21:32035544-32035566 CCCTGAAGTAACCTGGTGGGGGG - Intronic
1178425734 21:32477516-32477538 GGCTGCAGTCCCCTGAGGGCTGG + Intronic
1179088079 21:38238101-38238123 GGCTGAAGTCACCTGGTGGCAGG + Intronic
1179305781 21:40152911-40152933 TGCAGAATTCACCTGTTGGCTGG + Intronic
1179451140 21:41469171-41469193 GGCTGAAGCCCCAGGGTGGCGGG - Intronic
1179804724 21:43829973-43829995 GACAGAAGTCACCTGGCTGCCGG + Intergenic
1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG + Intergenic
1179846609 21:44115758-44115780 GGCTGAAGCCCCCTGCGGGCTGG + Exonic
1180618329 22:17143355-17143377 GGGTGAAGTCACCAGGAGGAAGG + Intronic
1181495841 22:23287065-23287087 GGCTGAATGCAGCTGGTGGTGGG + Intronic
1183268733 22:36847492-36847514 GGATGAAGACCCCTGGTGGGAGG - Intergenic
1183529902 22:38347697-38347719 GGCTGGAGAACCCTGGTGGCAGG + Intronic
1183580650 22:38724321-38724343 TGCTGAAGTCACCAGGCTGCCGG + Exonic
950492386 3:13313921-13313943 GGATGAAGTGAGCTGGTGACTGG + Intergenic
950723990 3:14904126-14904148 GGCTGAAGTCACCTGGTGGCAGG + Intronic
950859475 3:16135046-16135068 TGCTGTAGTCAGGTGGTGGCTGG + Intergenic
953008960 3:39005584-39005606 GGCTGAAGTCACATGGTCCTTGG - Intergenic
953923243 3:46966618-46966640 GTCTGAACTCACCTGGTGTTTGG - Intronic
954394498 3:50286399-50286421 GCCTGAAGCCACCTGGTAGAAGG + Intronic
954798027 3:53171452-53171474 GGCTGCAGGGACCTGTTGGCTGG - Intronic
956722309 3:72128987-72129009 GGCTGAGGTCACCTGAAGTCTGG + Intergenic
956788242 3:72660567-72660589 GGCTGAAATCAGGTGGTAGCTGG + Intergenic
961553653 3:127682855-127682877 GGCTGAGTCCACCTGGTGGGTGG + Intergenic
961589900 3:127971160-127971182 GGCAGATGACACCTAGTGGCAGG + Intronic
962481223 3:135800355-135800377 GGCTGATGTGCCCTAGTGGCAGG - Intergenic
962605157 3:137026655-137026677 GGCTGAGATGTCCTGGTGGCTGG + Intergenic
962735750 3:138323693-138323715 TGCTGAAGTCATTTGGTGGAGGG + Intronic
963152188 3:142056835-142056857 GGCTGTAGTCATCTGCAGGCTGG - Intronic
963412919 3:144954437-144954459 GGCTAAAGTCAAGTGGTGGCTGG + Intergenic
963835785 3:150056668-150056690 GGCTGTAGTCACGGGGTGGAGGG + Intergenic
964748257 3:160031798-160031820 GGCTGAAGTTCCCGAGTGGCTGG - Intergenic
967001723 3:185342131-185342153 GGATGTAGTCACCTGAAGGCTGG - Intronic
967943045 3:194780908-194780930 GACTCAAGTCAGCTTGTGGCTGG - Intergenic
968176261 3:196551881-196551903 GCCTGAAGGGAACTGGTGGCAGG - Intergenic
969131844 4:4995779-4995801 GGCTGAAGCAGCCTGCTGGCAGG + Intergenic
969443232 4:7229312-7229334 GGCTCCTGTCAGCTGGTGGCAGG - Intronic
969496201 4:7527689-7527711 GGCTGACTTCACCTGGTGGGGGG - Intronic
973880648 4:55268447-55268469 GGCTAAAGTCAGATGATGGCTGG + Intergenic
976445645 4:85127769-85127791 GGCAGCAGCCACCTGGTGGCAGG - Intergenic
978159371 4:105527278-105527300 GGCAGAGGTCTCCTGATGGCTGG + Intergenic
983847445 4:172537454-172537476 GGCACATGTTACCTGGTGGCAGG - Intronic
984943587 4:184954382-184954404 GGCTGAGGTCTGCTGGTGGATGG - Intergenic
985761394 5:1751105-1751127 GGCAGCTGTCACCAGGTGGCCGG - Intergenic
985995811 5:3596267-3596289 GGCTGCAGTCACCTCGGTGCTGG + Exonic
988609945 5:32714036-32714058 GGCTGCAGTAACCTGGCGACTGG - Intronic
992611090 5:78509293-78509315 AGCTGAAATCATCTGGGGGCTGG + Intronic
996371313 5:122755823-122755845 GGCCCAAGTCATATGGTGGCAGG + Intergenic
999664825 5:153901749-153901771 GGTTGCAGTCAGATGGTGGCTGG - Intergenic
1001039201 5:168320732-168320754 GGCTGAAATGAGATGGTGGCTGG + Intronic
1001799665 5:174532070-174532092 GGTTGAAGGCACCAGGAGGCTGG + Intergenic
1004380930 6:15131937-15131959 GCCTGGAGTCACCTGGGGGAGGG - Intergenic
1005965378 6:30722791-30722813 GTCTGCTGCCACCTGGTGGCGGG + Intronic
1006422868 6:33946264-33946286 GGCTGGTTTCACCTGGAGGCTGG + Intergenic
1006937386 6:37727979-37728001 GGCGGAAGTGGCCTGGTGGGTGG - Intergenic
1010350371 6:74866973-74866995 GGCTGCAGTCAAATGTTGGCTGG + Intergenic
1014727264 6:124986461-124986483 GGCTGAAGACAGCTGGAGGAAGG - Intronic
1014840895 6:126218934-126218956 GGCAGAACTCAGCTGGTGCCTGG - Intergenic
1016423724 6:143912684-143912706 GGCTGAAGACTCCTGTTGGGGGG + Intronic
1017258085 6:152357226-152357248 GCCTGAAGTCACCTAGTGTTGGG + Intronic
1017794704 6:157833638-157833660 GGGAGAAGGCACATGGTGGCAGG - Intronic
1018173678 6:161161496-161161518 TGATGAATTCACATGGTGGCGGG + Intronic
1020079710 7:5280976-5280998 GAATGGAATCACCTGGTGGCGGG - Intronic
1020649208 7:10854855-10854877 GGCTGAAGACAGCTGGGTGCTGG + Intergenic
1021305015 7:19021838-19021860 GGCTGAAGTCACCCTTTGGTAGG + Intronic
1021360440 7:19706439-19706461 GGCTGTGGTCCCCTGGTGGAAGG + Intronic
1022289439 7:28986793-28986815 GGCTGGAGTCAGTTTGTGGCAGG + Intergenic
1022459238 7:30588320-30588342 GGCTGCAGTCATCTGAAGGCTGG + Intergenic
1023173488 7:37412916-37412938 GGCTGCAGTCATCTGAAGGCTGG - Intronic
1024464849 7:49701101-49701123 GGGGGAAGTCACCTGCTGCCAGG + Intergenic
1025199195 7:56951227-56951249 GAATGGAATCACCTGGTGGCGGG + Intergenic
1025672752 7:63625706-63625728 GAATGGAATCACCTGGTGGCGGG - Intergenic
1026854152 7:73742332-73742354 GGCTGAGATTACCTGGTGGAGGG - Intergenic
1027116480 7:75485802-75485824 GGGTGAAGTCACCTTGTGTTGGG - Intronic
1028013692 7:85680524-85680546 GGCAGCAGTCACCTGGTTTCAGG - Intergenic
1029420243 7:100468268-100468290 CGAGGAAGTCAGCTGGTGGCTGG + Intronic
1030060170 7:105615465-105615487 GGCTGCTGGCTCCTGGTGGCTGG + Intronic
1030114538 7:106053361-106053383 GGCTGAGGGCATCTGGGGGCGGG + Intergenic
1031764720 7:125763459-125763481 GGTTGAAGTCACCTGGCAGCTGG - Intergenic
1032522994 7:132560604-132560626 GGCGGAAGTGACCAGGAGGCCGG - Intronic
1032582790 7:133118561-133118583 GGCTGCAGTCATCTTGAGGCTGG - Intergenic
1033302256 7:140196886-140196908 GGCTGCAGTCACATGTTTGCTGG - Intergenic
1033853155 7:145523118-145523140 GGTGGAAGGCACCTGGTGGAAGG - Intergenic
1036228281 8:6978635-6978657 GGCTGGGGTCACCTGGAGGAGGG + Exonic
1036230734 8:6997752-6997774 GGCTGGGGTCACCTGGAGGAGGG + Exonic
1036233180 8:7016851-7016873 GGCTGGGGTCACCTGGAGGAGGG + Exonic
1036234834 8:7029490-7029512 GGCTGGGGTCACCTGGAGGATGG + Intergenic
1036536068 8:9653898-9653920 GGCTGAAGTCATCTGGTAGCAGG - Intronic
1039612200 8:38928902-38928924 GGCCCAGGTCACCTGGTGCCTGG + Intronic
1040546091 8:48398997-48399019 GGCTGGAGTCCTCTGGAGGCAGG + Intergenic
1045317256 8:101053815-101053837 GGCTGTAGTCATCTGAAGGCTGG - Intergenic
1047724779 8:127674561-127674583 GGCTGCAGTCATCTGAAGGCTGG + Intergenic
1048416383 8:134231919-134231941 GGCTCAATTTACATGGTGGCAGG + Intergenic
1048536362 8:135299801-135299823 GGCTGCAGTCATCTGAAGGCTGG + Intergenic
1049594582 8:143477519-143477541 GCCTGCAGGCACCTGGAGGCCGG - Intronic
1049612186 8:143560898-143560920 AGCCGAAGTCACCTGGCGGCGGG + Intronic
1052248566 9:26369277-26369299 GGCTGAAGTCACCTAGCTCCAGG + Intergenic
1052352337 9:27470487-27470509 GGGAGAAGTCGCCTGGAGGCTGG - Intronic
1052782702 9:32797155-32797177 TGTTGAAGTGACCTGGTGGGAGG - Intergenic
1053016711 9:34665966-34665988 GGCTGGGGTCACCTGGAGGGGGG + Exonic
1053107501 9:35424366-35424388 GGCAGAAGTCACCTCTTGGCAGG + Intergenic
1053439201 9:38101881-38101903 GGATGGAGTCACCTGGGGTCAGG - Intergenic
1055689744 9:78816648-78816670 GGCTGAAGTCATCTGAAGCCTGG - Intergenic
1056601218 9:88048569-88048591 AGCTGAAGCCACATGGTGGAGGG + Intergenic
1057619179 9:96619657-96619679 GGCTGCGGGCACCTGGGGGCGGG - Exonic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059226608 9:112678746-112678768 GGCTGCATTCAGCTGGTGGCTGG + Intergenic
1059234933 9:112752848-112752870 GGCTGCAGTCATCTGAAGGCTGG + Intronic
1060111505 9:120909938-120909960 GGCTGGGGTCCCCTGGAGGCTGG + Intronic
1060151638 9:121292646-121292668 GGCTCAAGTTCCCTGGTGGTAGG + Intronic
1061034072 9:128103750-128103772 TGGTGGAGACACCTGGTGGCAGG + Exonic
1061518178 9:131101755-131101777 GGCTGCAGCCACCTGGTGACAGG - Intronic
1061860695 9:133467304-133467326 GTTTGGCGTCACCTGGTGGCAGG - Intronic
1185546524 X:949948-949970 GGCTGAAGACAGCTGGTCTCTGG - Intergenic
1186384907 X:9100365-9100387 GGTTGTAGTCAAATGGTGGCTGG + Intronic
1188763686 X:34063007-34063029 GGCTGTAGGCAACTGGTTGCTGG - Intergenic
1189634114 X:42986905-42986927 GGCTGAAGTCACAAGCTGGCTGG + Intergenic
1189815121 X:44817078-44817100 GGTTGCAGTCAGATGGTGGCAGG + Intergenic
1190172932 X:48126061-48126083 GGCTAAACTCCCCTGGTGACAGG + Intergenic
1190192660 X:48290657-48290679 GGCTAAACTCCCCTGGTGACAGG - Intergenic
1190198632 X:48341645-48341667 GGCTAAACTCCCCTGGTGACAGG - Intergenic
1190665402 X:52692055-52692077 GGCTAAACTCCCCTGGTGACAGG - Intronic
1190674020 X:52766364-52766386 GGCTAAACTCCCCTGGTGACAGG + Intronic
1191876147 X:65798639-65798661 GGTTGAAGTCTCCTGGTTGTTGG + Intergenic
1194082664 X:89487582-89487604 GGCTCATGTTACATGGTGGCAGG + Intergenic
1194302475 X:92204854-92204876 GGTGGAAGCCACCTGGTGGCAGG + Intronic
1197071205 X:122300021-122300043 GTCTGTAGACACCTGCTGGCAGG + Intergenic
1197769651 X:130082072-130082094 GGCTGACTTCACCTGGAGCCAGG - Intronic
1199074065 X:143510278-143510300 GGCTGCAGTCACCTGGTGACTGG - Intronic
1199093065 X:143713514-143713536 GGCTGCAGTCACCTGGTGACTGG - Intronic
1199215273 X:145254623-145254645 GGCTGCGGTCACCTGGTGACTGG + Intronic
1200435313 Y:3143456-3143478 GGCTCATGTTACATGGTGGCAGG + Intergenic
1200830046 Y:7680449-7680471 GGCTGAGGTGACCTGCTAGCTGG - Intergenic
1201369485 Y:13246179-13246201 GGCCGAAGTCACCTGTGGTCAGG - Intergenic
1201894377 Y:18978080-18978102 GGTGGAAGTGACCTGGTGGGAGG + Intergenic
1202110062 Y:21408758-21408780 GGCTGAGGTGACCTGCTAGCTGG - Intergenic