ID: 950725430

View in Genome Browser
Species Human (GRCh38)
Location 3:14913999-14914021
Sequence CAGGGTAATCAGAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950725430_950725438 15 Left 950725430 3:14913999-14914021 CCTGCATCCCTCTGATTACCCTG 0: 1
1: 0
2: 2
3: 17
4: 176
Right 950725438 3:14914037-14914059 CAGCCCCACAGTCTGAAGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 224
950725430_950725437 14 Left 950725430 3:14913999-14914021 CCTGCATCCCTCTGATTACCCTG 0: 1
1: 0
2: 2
3: 17
4: 176
Right 950725437 3:14914036-14914058 TCAGCCCCACAGTCTGAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950725430 Original CRISPR CAGGGTAATCAGAGGGATGC AGG (reversed) Intronic
901352734 1:8612254-8612276 CAGTGTAATGAGAGAGCTGCTGG - Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
904301123 1:29555598-29555620 CTGGGTAATCCGAGGCTTGCTGG + Intergenic
904603104 1:31684294-31684316 CAGAGTGTTCAGAGGGGTGCAGG - Intronic
904863754 1:33560406-33560428 AGGGGGAATCAGAGGGATGCAGG - Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906144467 1:43551630-43551652 CTGGCAAGTCAGAGGGATGCAGG - Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
907222131 1:52914847-52914869 GTGGGTGATCCGAGGGATGCAGG - Intronic
908555852 1:65255502-65255524 AAGGGGAAAGAGAGGGATGCAGG + Intronic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
913126029 1:115791128-115791150 CAAGGCAACCAGAAGGATGCTGG + Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
920192156 1:204200725-204200747 CAGGCTAATCAGGGGGTTTCAGG + Intronic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
922784978 1:228278244-228278266 AGGGCTAATCAGAGGTATGCGGG + Intronic
922806194 1:228391318-228391340 CAGGGAAAGCACAGGGATCCGGG + Intergenic
923017229 1:230136335-230136357 CAGGGTTATCAGAGGATGGCTGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1076437904 10:130459256-130459278 CAGGGAAGTCAGAGGGGTGGAGG + Intergenic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079402652 11:20118306-20118328 CAGGGTGATGTGGGGGATGCAGG - Exonic
1081814327 11:45930022-45930044 TAGGGTAATGAGATGGATGGTGG - Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1084284046 11:68120631-68120653 CTGGGTAATCCAAGGGAAGCGGG - Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084900642 11:72307612-72307634 GTGGGTATTGAGAGGGATGCAGG - Intronic
1087879957 11:103404518-103404540 CAGGATAATCAGAGTAATGTTGG + Intronic
1091187215 11:133657586-133657608 CTGGGTATTCAGAGGGCTTCGGG + Intergenic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1095864226 12:46954183-46954205 CTGGGTAATAAGAGGGATTTTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098546370 12:71716334-71716356 CAGAGGAGTCAGAGAGATGCTGG + Intergenic
1101701672 12:107179649-107179671 CAGGGTCCTCTGTGGGATGCTGG - Intergenic
1103318765 12:120077951-120077973 GAGGGAAACCAGAGGGACGCAGG - Intronic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1107817761 13:44259417-44259439 CAGGGAAATCAGTGGGCTACGGG + Intergenic
1110833349 13:80056867-80056889 CAAGGTAAACATGGGGATGCAGG - Intergenic
1112880846 13:104104716-104104738 CAGGGAAATCAGAGGGAAAGGGG - Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1117732447 14:58736940-58736962 CAAGGTAATCAGAGAGAGACCGG + Intergenic
1118482323 14:66179718-66179740 GAGGGAAATTAGAGGGGTGCTGG - Intergenic
1119179263 14:72593938-72593960 GAGGGTCATCAGAGGGGTGGGGG + Intergenic
1120308086 14:82795970-82795992 CAGGATATTCAGAGAGATTCCGG + Intergenic
1120887570 14:89463744-89463766 CTGGGGAATCAGAGATATGCAGG + Intronic
1122383352 14:101326466-101326488 AAGGGTAATCAGAGGACTACAGG - Intergenic
1122767740 14:104083402-104083424 CATGGTGCTCACAGGGATGCAGG + Intergenic
1124425863 15:29562075-29562097 GAGGATAATCAGATGGATCCAGG + Intronic
1125584510 15:40810538-40810560 CAGGGAAAGGAGAGGGATCCAGG - Intronic
1126957272 15:53947555-53947577 CAAGGTGATCAGAGGCATGATGG - Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1138321241 16:56113909-56113931 CAGGGTAATCAAAAGTATTCTGG + Intergenic
1139510563 16:67426046-67426068 TAGGGTAATCAGAGGGGAGTCGG + Intergenic
1143138050 17:4723113-4723135 CACGGGAGTCGGAGGGATGCTGG - Intergenic
1146500504 17:33360468-33360490 AAGGGTATTCAGAGAGAAGCTGG - Intronic
1146552650 17:33795060-33795082 CATGGTAATCAGAGCAAAGCTGG + Intronic
1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG + Intronic
1146793312 17:35765011-35765033 CAGGTTTGTCAGAGGGATGAGGG - Exonic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1150062252 17:62078525-62078547 AAGGGCAAACAGAGGGATGGTGG - Intergenic
1150083605 17:62262481-62262503 CAGGGGGCTCAGAGGGCTGCTGG + Intergenic
1150431342 17:65120224-65120246 CAGGGTGGTCAGTGGGATGGAGG + Intergenic
1150915207 17:69429787-69429809 CAGGATAATCTGATGGATGATGG - Intronic
1151358196 17:73572490-73572512 CTGGGTGATAAGAGGGAGGCTGG - Intronic
1152158825 17:78654143-78654165 CAGGGTAGTGTGCGGGATGCTGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1155157746 18:23171677-23171699 GAGGGTTATCAGAGGGTGGCAGG - Intronic
1155526527 18:26721514-26721536 CAGGGAAAGCCTAGGGATGCAGG - Intergenic
1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG + Intronic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1162156466 19:8681423-8681445 AAGGGTAATCAGATGCATGTGGG + Intergenic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1164562249 19:29300305-29300327 CAGTGTAAGCAGAGGGGTGGAGG - Intergenic
1164876349 19:31693437-31693459 CAGGGAAATGACAGGGTTGCTGG - Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG + Intergenic
930523169 2:52493798-52493820 CTGGGTAAACTGAGGGCTGCAGG - Intergenic
931167265 2:59761526-59761548 CAGGGTGATCAGAGGATTCCTGG + Intergenic
932880210 2:75494320-75494342 TGGGGTAAACACAGGGATGCTGG + Intronic
936603573 2:113924756-113924778 CAGGGGAATGAGAGGTATGGAGG - Intronic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
942350398 2:175046542-175046564 CAGGGTAATTAGAGTAATGTTGG + Intergenic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
945768089 2:214004709-214004731 CTGGGTCATCCTAGGGATGCAGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
1169912735 20:10660550-10660572 CAGGGCAATCCTAGGGGTGCAGG + Intronic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1175486466 20:59350310-59350332 TAGGGAGATCAGAGGCATGCGGG + Intergenic
1175547162 20:59785839-59785861 CAGGGGATGCAGAGGGCTGCTGG - Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
950045013 3:9943834-9943856 CAGGGTAATCACAACGATGATGG + Intronic
950602270 3:14045381-14045403 TATGGTAATTAGAGGGATTCGGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951778168 3:26333581-26333603 CAAGGTACTCAGAGAAATGCTGG - Intergenic
952199335 3:31110271-31110293 CAGGGTAAGCAGGGGTATGCTGG + Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954087787 3:48259595-48259617 CAGGGTAATCAGAGGCAGCTGGG + Intronic
954148327 3:48645316-48645338 CAGGGTTTTCAGCAGGATGCTGG - Intronic
954633426 3:52058878-52058900 CAGGCTAATGTGAGGGATGGCGG - Intergenic
955559175 3:60170190-60170212 CAGGTTAATAAGATGGATGGAGG + Intronic
956019666 3:64920775-64920797 CAGGGTACTCACAGGCATGTGGG + Intergenic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
971504872 4:27355654-27355676 CAGGGTAATCAAAGAGAAACGGG - Intergenic
971551234 4:27958766-27958788 CAGGGTAATCAGAGCAATGCTGG - Intergenic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
977641637 4:99364061-99364083 AAGGGTAGTGAGAGGGATGGAGG - Intergenic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
987288390 5:16483772-16483794 CAGGTTAATCATAGGGTTCCAGG + Intronic
988260649 5:28882586-28882608 CAGGGCAATCAGAGGGCTCTGGG - Intergenic
989550000 5:42723479-42723501 CAGTCTACTCAGAGGGATGTAGG - Intergenic
991294173 5:65063202-65063224 CTAGGTAAGCAGAGAGATGCTGG - Intergenic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
996930351 5:128879027-128879049 TAAGGTAAGCAGAGAGATGCAGG + Intronic
999147961 5:149408133-149408155 CAGGGGACTTAGAGGAATGCAGG + Intergenic
999512020 5:152262257-152262279 CAAGGTAATGAGAGTGATGTGGG + Intergenic
999684426 5:154089484-154089506 CAGGGCTAGCAGAGGGATCCAGG - Intronic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1000413494 5:160958971-160958993 AATGTTAATAAGAGGGATGCTGG + Intergenic
1001381657 5:171309934-171309956 GAGGGTAATCGGAGAGTTGCAGG + Intronic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003827014 6:9964346-9964368 AAGGGTAATCAAAGGGAAACTGG - Intronic
1004426836 6:15512424-15512446 CACGGCACTCACAGGGATGCGGG - Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1007956125 6:45919363-45919385 CAGAGTAACCATGGGGATGCTGG + Intronic
1010180957 6:73086174-73086196 CAGGTTAATAAGAGGTCTGCTGG - Intronic
1014451827 6:121590973-121590995 CAGAGTAATCAGGGAAATGCAGG + Intergenic
1016523315 6:144971205-144971227 CAGGCTAATGAGAGAGAAGCTGG + Intergenic
1016918806 6:149270944-149270966 CTGGGTAGTCAGAGGGTTACGGG + Intronic
1019781254 7:2941284-2941306 CAGGTTAATCACTGGGGTGCAGG - Intronic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1022889426 7:34681454-34681476 CAAGGTAAGTAGAGGTATGCAGG + Intronic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1031187361 7:118500053-118500075 AAGGGTAGTAAGAGGGATTCTGG - Intergenic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1034116683 7:148589729-148589751 CAGAGTAATCTTAGGGATTCTGG + Intergenic
1035876463 8:3195228-3195250 CATGCACATCAGAGGGATGCGGG + Intronic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1042874565 8:73429094-73429116 CAGGGTTATCAGTGAGATGTGGG - Intronic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049867499 8:144948304-144948326 CAGGGTGCTCAGAGGAATGGTGG + Intronic
1053603420 9:39632878-39632900 AGGGGAAATAAGAGGGATGCTGG - Intergenic
1053861050 9:42386598-42386620 AGGGGAAATAAGAGGGATGCTGG - Intergenic
1054250117 9:62709546-62709568 AGGGGAAATAAGAGGGATGCTGG + Intergenic
1054564228 9:66744075-66744097 AGGGGAAATAAGAGGGATGCTGG + Intergenic
1055001392 9:71453512-71453534 CAGAGGAATCCGAGGGAAGCTGG - Intergenic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1060057343 9:120426140-120426162 CATGGTTAACAGAGTGATGCAGG - Intronic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1189012314 X:37058935-37058957 CAGGGTAATCACATGGTTTCTGG + Intergenic
1189036398 X:37497317-37497339 CAGGGTAATCACATGGTTTCTGG - Intronic
1190106452 X:47564557-47564579 AAGGGTAATGAGAGGCATGACGG - Intronic
1191787349 X:64930694-64930716 CAGTTTTATCATAGGGATGCAGG - Intronic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG + Intergenic
1195993155 X:110703215-110703237 CAGGGGATTCTGATGGATGCAGG + Intronic
1200703520 Y:6422196-6422218 CACCGTTATCAGAGGGCTGCAGG - Intergenic
1201030591 Y:9742511-9742533 CACCGTTATCAGAGGGCTGCAGG + Intergenic