ID: 950725437

View in Genome Browser
Species Human (GRCh38)
Location 3:14914036-14914058
Sequence TCAGCCCCACAGTCTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 182}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950725432_950725437 6 Left 950725432 3:14914007-14914029 CCTCTGATTACCCTGCTGTGATT 0: 1
1: 0
2: 0
3: 13
4: 169
Right 950725437 3:14914036-14914058 TCAGCCCCACAGTCTGAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 182
950725434_950725437 -4 Left 950725434 3:14914017-14914039 CCCTGCTGTGATTAGGCCATCAG 0: 1
1: 0
2: 1
3: 12
4: 121
Right 950725437 3:14914036-14914058 TCAGCCCCACAGTCTGAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 182
950725431_950725437 7 Left 950725431 3:14914006-14914028 CCCTCTGATTACCCTGCTGTGAT 0: 1
1: 0
2: 0
3: 15
4: 134
Right 950725437 3:14914036-14914058 TCAGCCCCACAGTCTGAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 182
950725435_950725437 -5 Left 950725435 3:14914018-14914040 CCTGCTGTGATTAGGCCATCAGC 0: 1
1: 0
2: 1
3: 8
4: 79
Right 950725437 3:14914036-14914058 TCAGCCCCACAGTCTGAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 182
950725429_950725437 27 Left 950725429 3:14913986-14914008 CCTCAGGGATAGGCCTGCATCCC 0: 1
1: 0
2: 1
3: 25
4: 173
Right 950725437 3:14914036-14914058 TCAGCCCCACAGTCTGAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 182
950725428_950725437 28 Left 950725428 3:14913985-14914007 CCCTCAGGGATAGGCCTGCATCC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 950725437 3:14914036-14914058 TCAGCCCCACAGTCTGAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 182
950725430_950725437 14 Left 950725430 3:14913999-14914021 CCTGCATCCCTCTGATTACCCTG 0: 1
1: 0
2: 2
3: 17
4: 176
Right 950725437 3:14914036-14914058 TCAGCCCCACAGTCTGAAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950725437 Original CRISPR TCAGCCCCACAGTCTGAAGC TGG Intronic
900115532 1:1026370-1026392 TTAGCCCCACAGCCTGCAGAAGG + Intronic
900187356 1:1338678-1338700 TCAGCCCCAGCATCTGAAGGCGG + Intronic
901063438 1:6484415-6484437 TCAGCCCCAGGATCTGAACCAGG + Intronic
901835861 1:11923661-11923683 TCAGGCCCACAGGCTCAAGTTGG - Intronic
902950991 1:19882687-19882709 TCAGCCCCAGGGCCTGCAGCTGG - Exonic
903740565 1:25556252-25556274 TCAGCCTCAGAGTCTCAATCGGG - Intronic
905713878 1:40131625-40131647 TCAGCCTCCCAGCCTGTAGCTGG + Intergenic
906494939 1:46298544-46298566 TCAGCCACTCAGTTGGAAGCTGG + Intronic
906794659 1:48687439-48687461 GCACCCCCACAGGCTGACGCAGG + Intronic
907180615 1:52566426-52566448 TCAGCCCCACAGCATGCAGTAGG - Intergenic
907625573 1:56025943-56025965 TCAGCCCCACACTGTGAACGAGG + Intergenic
912120587 1:106467403-106467425 TCAACCCCACTGTCAGAAACAGG + Intergenic
912551255 1:110486903-110486925 TCAGACCCACAGTCTGGTGGGGG - Intergenic
913286066 1:117227995-117228017 TCATCCCCAGAGTCTGAAAGAGG - Intergenic
917976844 1:180245270-180245292 GACGCCCCCCAGTCTGAAGCAGG - Intronic
920342838 1:205286355-205286377 TGAGCCCCACAGTTTGAATAGGG - Intergenic
920609729 1:207424693-207424715 TCAGACAAACAGCCTGAAGCAGG - Intergenic
922671090 1:227509198-227509220 TCAGCCCTCCAGACTGAGGCAGG - Intergenic
922750266 1:228066950-228066972 ACAGCTCCTCAGTCTGAAGGAGG - Intergenic
922802358 1:228370252-228370274 TCAGCCCCACACTATGCAGGGGG + Intronic
923739711 1:236644227-236644249 TCCGCCCCACAGTCTGTCTCTGG - Intergenic
924743892 1:246814944-246814966 TCAGCACCTCGCTCTGAAGCAGG - Intergenic
1064979938 10:21155984-21156006 ACAGCCCTACAGTCTCCAGCAGG + Intronic
1066455046 10:35565360-35565382 TGATCCCCACAGTGTGAAGGTGG + Intronic
1068971096 10:62959308-62959330 ACAGCCACACAGACAGAAGCAGG + Intergenic
1071289226 10:84176583-84176605 TCTGCCCCACAGTCTGGACGAGG - Intronic
1073441687 10:103556126-103556148 ACAGACCCACAGCCTGGAGCTGG + Intronic
1075520635 10:123141641-123141663 TGGGCTCCACAGTCTGAAGGAGG - Intergenic
1076071824 10:127496534-127496556 TCAGGCCCAGAGACAGAAGCAGG - Intergenic
1076476000 10:130751873-130751895 TCAGCTCCACTTCCTGAAGCCGG - Intergenic
1078026124 11:7697146-7697168 GCTGCCCGACAGGCTGAAGCAGG - Intronic
1081638940 11:44739814-44739836 TCAGGCCAAGAGTTTGAAGCTGG + Intronic
1081850253 11:46270770-46270792 TCAGCCACAGAGGCTGGAGCTGG + Intergenic
1084898536 11:72293194-72293216 TCAGCCCCAAAACCTGAAGGAGG - Exonic
1086401016 11:86460952-86460974 TGAGGCCCACAGTCACAAGCTGG - Intronic
1087203035 11:95365276-95365298 CCAGCCCCACAGTGTGAATTTGG - Intergenic
1088135662 11:106552703-106552725 CCAGTCCCACAGACTGAAGTGGG + Intergenic
1088721997 11:112600995-112601017 ACAGCACCACAGGATGAAGCAGG + Intergenic
1089131472 11:116215633-116215655 CCAGCCCCACAGTCTGGGCCAGG + Intergenic
1091993388 12:4974056-4974078 TCTACCCCACAGCCTGAGGCTGG + Intergenic
1092215539 12:6679212-6679234 TCAGCCTCTCAGGCTGAAGAGGG - Intronic
1092447109 12:8568046-8568068 CCAGTCCCACAGACTGGAGCGGG - Intergenic
1095103352 12:38204657-38204679 TCAGCCCTCCAGACTGAGGCAGG - Intergenic
1096779043 12:53981835-53981857 ACAGCCCCACAGACAGAAGGAGG + Intergenic
1097132706 12:56824619-56824641 GGAGCCCCAAAGTCTGTAGCAGG - Intergenic
1099481756 12:83176026-83176048 TCAGCCCCCCAATCTCAAGTTGG + Intergenic
1100949108 12:99825461-99825483 GTAGCCCCACAGTCAGCAGCAGG + Intronic
1101078670 12:101158787-101158809 GCAGCTCCACTGTCTGAAGCGGG - Intronic
1103401829 12:120648573-120648595 GCAGCCACCCAGTCAGAAGCTGG + Intronic
1104839750 12:131817484-131817506 TCATCCCAACAGTCTGAGGACGG + Intergenic
1107464896 13:40640519-40640541 TCAGGACCTCAGTCTGGAGCAGG + Intronic
1108079258 13:46717158-46717180 TCAACCCCACAGTGTGACCCAGG - Intronic
1110508653 13:76321850-76321872 TCTGCCTCACAGCCTGAAGAAGG + Intergenic
1110920200 13:81074866-81074888 TCAGCCCCACACTATAAAGCTGG + Intergenic
1113859776 13:113473747-113473769 TCATCCCAACACTCTGAAGTGGG + Intronic
1115682844 14:35760879-35760901 TCAGCACCACAGTCTGAACATGG - Exonic
1119704180 14:76773771-76773793 CCAGCCCCACAGTCAACAGCGGG + Intronic
1121329231 14:93039713-93039735 TCAGCCCCACACCCTGCAGCAGG + Intronic
1121821976 14:96977634-96977656 TCAGCCACACACTCTGAAAGAGG - Intergenic
1122846174 14:104500387-104500409 CCACAGCCACAGTCTGAAGCGGG - Intronic
1125006372 15:34822260-34822282 TCTGCCTCACATGCTGAAGCGGG - Intergenic
1127269176 15:57385532-57385554 TTTGCCCCACAGTGTGAAGAAGG - Intronic
1127364211 15:58272176-58272198 TAGGCCCCACAGTCTGGGGCTGG - Intronic
1128256538 15:66201313-66201335 CCAGCCCCACATTCTGCAGGAGG - Intronic
1129459924 15:75695427-75695449 TCAGCCCCACAGGAAGCAGCAGG - Intronic
1129674529 15:77625172-77625194 ACAGCCTCACAGACTGAGGCTGG + Intronic
1129707795 15:77804660-77804682 TCAGCCCTCCAGCCTGGAGCCGG - Intronic
1133120097 16:3601022-3601044 GCAGCCGCACAGCCTGAAGCAGG + Exonic
1134250736 16:12572124-12572146 TAAGCTCCAAAGTATGAAGCAGG - Exonic
1134862576 16:17573830-17573852 AAAGCCCCACAGTATGGAGCAGG - Intergenic
1135028904 16:19021541-19021563 TCAGCCACAAAAGCTGAAGCTGG - Intronic
1137803068 16:51278655-51278677 ACAGCACCACATTCTGCAGCTGG + Intergenic
1137962283 16:52894725-52894747 TGAGCCCAGGAGTCTGAAGCTGG + Intergenic
1140950809 16:79815630-79815652 TCAGCTCCACCTTCTGGAGCAGG + Intergenic
1141155337 16:81593211-81593233 TCAGCAGCACAGCCTGCAGCTGG - Intronic
1143178873 17:4972275-4972297 GCAGCCCCATCATCTGAAGCTGG + Exonic
1143749225 17:9016235-9016257 TCTGCCCCAAACTCTGATGCTGG + Intergenic
1143980458 17:10865074-10865096 ACAGCCCCAAATTTTGAAGCTGG + Intergenic
1144003022 17:11073131-11073153 TCAGGCCTACAGTCTGACTCTGG - Intergenic
1147577451 17:41610967-41610989 TCAGCTCCTCGGTCTGAGGCAGG + Exonic
1147999808 17:44380981-44381003 TCAGCCCCTCACTCTGACCCAGG + Exonic
1148461769 17:47843214-47843236 TCCGCCCCACAGTGGGAAGCCGG - Intergenic
1149420674 17:56508104-56508126 TTAGCCCCACAGCCTGAACAAGG + Intronic
1150246038 17:63676104-63676126 ACAGGCCCACAGGCTGGAGCAGG - Intronic
1152931287 17:83111464-83111486 CCAGCCCCTCACTCTGAAGGAGG - Intergenic
1157069894 18:44393840-44393862 TGAGCCCCACAGTTTCAAGTCGG - Intergenic
1158273347 18:55740262-55740284 AAAGCCCCACAGCCTGAAGCTGG + Intergenic
1159968009 18:74615757-74615779 TTAGTCCCATAGTCTGAAGGGGG + Intronic
1161454222 19:4362136-4362158 TCAGCCTCACAGTGTGAATGAGG - Intronic
1162473474 19:10886306-10886328 TCAGCCTCCCAGCCTGTAGCTGG + Intronic
1162725703 19:12688850-12688872 GCAGCCCCACAGCCCCAAGCAGG + Intronic
1163127129 19:15250333-15250355 TAAGCGCCACACTCTGGAGCAGG + Intronic
1163650513 19:18515207-18515229 TCGGGCCCACAGACTCAAGCTGG + Intronic
1163875730 19:19866088-19866110 TCAGCTCCACAATCTGCCGCCGG + Intronic
1165176448 19:33933973-33933995 TCACACACACAGTCTCAAGCAGG - Intergenic
1167431683 19:49458855-49458877 TCAGCCCAAGAGTGTAAAGCTGG - Intronic
926596738 2:14797741-14797763 TCATCCCAACAGTCTGTGGCTGG - Intergenic
929880576 2:45833532-45833554 TCCTCCCAACACTCTGAAGCAGG + Intronic
930606284 2:53496612-53496634 TCTGCCCTACAGTCTGGAGTGGG - Intergenic
934700267 2:96433950-96433972 CAAGCCCCACAGACTGAAGCTGG + Intergenic
939594970 2:144111586-144111608 TCAGGCACTCTGTCTGAAGCTGG - Intronic
940289994 2:152068957-152068979 TCACCGCCTCAGTGTGAAGCTGG - Intronic
942042428 2:172079676-172079698 TAAGTCCCACAGTCAGAAACAGG - Intronic
947756489 2:232569612-232569634 ACAGCCACACAGACAGAAGCAGG - Intronic
948284867 2:236776214-236776236 TTATCCCCACAGTGGGAAGCCGG + Intergenic
949057198 2:241934607-241934629 CCAACTTCACAGTCTGAAGCAGG - Intergenic
1169452017 20:5719972-5719994 TCAGGACAACAGTCTGAGGCTGG + Intergenic
1173482897 20:43416951-43416973 ACAGCCCCACAGTCTGCCCCTGG + Intergenic
1175940517 20:62535573-62535595 TCAGGCCCACAGGCAGACGCAGG - Intergenic
1178701039 21:34834410-34834432 TCAGCCTCAGAGTCAGATGCAGG - Exonic
1179606485 21:42519035-42519057 ACAAGCCCAGAGTCTGAAGCTGG + Intronic
1179786615 21:43733929-43733951 TCAGCCCTCCAGCCTGCAGCTGG + Intronic
1179954983 21:44733536-44733558 CCAGCACCCCATTCTGAAGCTGG + Intergenic
1180992301 22:19944008-19944030 ACAGCCCTGCAGACTGAAGCCGG - Intronic
1182054498 22:27339388-27339410 TCACCCCCACACACTGAGGCAGG + Intergenic
1182464649 22:30506784-30506806 TGAGAGCCACAGTCTGAAGGTGG + Intergenic
1182750186 22:32635326-32635348 ACAGCCCCAGATTCTGAAGATGG - Intronic
1183251480 22:36733415-36733437 TCAGACCCACTTTCTGAAGCTGG + Intergenic
1183418909 22:37698728-37698750 TCAGTCCCAGAGACTGAGGCAGG + Intronic
1184145252 22:42606509-42606531 TCTACTCCACAGGCTGAAGCAGG + Intronic
1184825247 22:46946229-46946251 TCAGCCACACAGGCCCAAGCGGG - Intronic
1184838012 22:47035522-47035544 TCTACCCCACAGTGTGAAGCAGG + Intronic
950218692 3:11178207-11178229 TGAGCCCAGCAGTCAGAAGCTGG - Intronic
950725437 3:14914036-14914058 TCAGCCCCACAGTCTGAAGCTGG + Intronic
950772835 3:15325804-15325826 TCAGCTCCAGAGTTTGAAACCGG + Intronic
954711582 3:52507654-52507676 TCCCCCCAACAGTGTGAAGCTGG + Exonic
955073146 3:55588575-55588597 TCAGCACCACAGTCAGAAGATGG + Intronic
955303814 3:57809639-57809661 CCAGCCCTACAGACAGAAGCGGG + Intronic
959692432 3:109212275-109212297 TCAGACCCACAGTCTTAAGAGGG + Intergenic
961834607 3:129646605-129646627 TCTCCCCCACAGTCTTATGCAGG - Intergenic
962741183 3:138363544-138363566 TGAGCCCCACAGGCTGGGGCTGG + Intronic
962753650 3:138452153-138452175 TCACCCCCACAGCCTGATGGGGG + Intronic
963002545 3:140695710-140695732 TCAGCCTGAGAGTCTGCAGCAGG - Intronic
965005632 3:163019144-163019166 TCAGTCCCACAGACTGAAGTGGG + Intergenic
968726751 4:2251400-2251422 CCAGCCCCACAGCCTGAGGTGGG + Intronic
969491311 4:7500668-7500690 TCACACCCACAGTCTCCAGCCGG - Intronic
969927098 4:10594977-10594999 TCAGCCCCCCAGCCAGTAGCTGG - Intronic
972169632 4:36329305-36329327 TCAGCTCCTGAGTCAGAAGCTGG + Intronic
974727656 4:65816396-65816418 TCAGCCCCACAATAAGAAGTTGG + Intergenic
981104056 4:140860458-140860480 TCAGTCACACAGTCTGAATATGG + Exonic
985877317 5:2609936-2609958 TCAACCCAACACTGTGAAGCTGG + Intergenic
986408131 5:7447598-7447620 TCACTCCCACAGCCTGCAGCTGG + Intronic
992418541 5:76577978-76578000 TCAGGCCCACAGGCTGGGGCAGG - Intronic
995806614 5:116059863-116059885 GCAGCCCCACATTCAGAATCTGG + Exonic
997401389 5:133605881-133605903 CCTGCCCCACACTCTGAAGAAGG + Intronic
997676012 5:135713976-135713998 GCAGCCCCAAAGGCTGGAGCAGG + Intergenic
997981335 5:138469416-138469438 TCAGGCCCACTGTGTGAAACTGG + Intergenic
999291028 5:150426521-150426543 TCAGCCTCCCAGCCTGTAGCTGG + Intergenic
999397830 5:151241526-151241548 TCACCTCAACAGTCTGAATCTGG - Intronic
1000597470 5:163232431-163232453 TCAGCCTCCCAGCCTGTAGCTGG + Intergenic
1000960540 5:167596298-167596320 GGTGCCCCACAGTCGGAAGCAGG + Intronic
1001756128 5:174171706-174171728 TCAGCACCACAGCCTGAGGATGG + Intronic
1005041276 6:21602544-21602566 CCATCCCCACAGTCTGACGGTGG - Intergenic
1005105015 6:22214655-22214677 CCAGGCCCCCAGCCTGAAGCAGG - Intergenic
1006552750 6:34838827-34838849 CCAGCCACTCAGACTGAAGCGGG + Intronic
1011712526 6:90069183-90069205 TCTGCCCCACAGTCCGCTGCTGG + Intronic
1013859831 6:114622577-114622599 ACAGCCCCACTTTCTGGAGCAGG + Intergenic
1018056775 6:160058954-160058976 TCTGCCTCACAGCCAGAAGCAGG - Exonic
1018289172 6:162272881-162272903 TCAGCCTCCCAGCCTGTAGCTGG - Intronic
1019293993 7:264323-264345 GCTGCCCCAGAGTCTAAAGCAGG + Intergenic
1019678368 7:2329590-2329612 TAAGACCCACAGTCTTAAGGTGG - Intronic
1019991861 7:4697372-4697394 TCTGGCCCACAGGCTGCAGCTGG - Intronic
1023856551 7:44187724-44187746 GCAGCCCCAGAGTCTGAGACTGG + Intronic
1023921469 7:44633416-44633438 TTCCCCGCACAGTCTGAAGCTGG + Intronic
1025191559 7:56899465-56899487 TCAGCCCCACATGCTCCAGCAGG + Intergenic
1025680388 7:63677469-63677491 TCAGCCCCACATGCTCCAGCAGG - Intergenic
1026151047 7:67788375-67788397 TCAGCCCCTCTGCCTCAAGCTGG - Intergenic
1026441845 7:70451877-70451899 TCAGCCCCACAGCATGAACTGGG + Intronic
1030112320 7:106037575-106037597 ACTGCCCCACAGCCTGCAGCAGG + Intergenic
1031848691 7:126836689-126836711 CCTGCCCCACATTCTGAATCAGG + Intronic
1032654183 7:133909653-133909675 TCAGTTTCACAGTCTGAAGTGGG - Intronic
1033374565 7:140745550-140745572 TCAGTCCCAGAATTTGAAGCTGG - Intronic
1034999267 7:155598854-155598876 TCAGCCCCATATTCTAAAACTGG + Intergenic
1040665249 8:49623939-49623961 GAAGCCCTACAGGCTGAAGCTGG + Intergenic
1042042558 8:64608549-64608571 TCAGCCCCAGTGACTGCAGCAGG - Intronic
1042459212 8:69043126-69043148 TCAGCCTCTCAGTCTGCAGAAGG + Intergenic
1043184540 8:77130059-77130081 TCAGGCCAAAATTCTGAAGCTGG + Intergenic
1044053814 8:87542879-87542901 TCAGTGCCAAAGTCTGAAGGGGG + Intronic
1045229378 8:100287495-100287517 TCTTACCCACAGTCTGGAGCTGG + Exonic
1045249595 8:100472461-100472483 TCAGACCTACACTCTGAAGCTGG + Intergenic
1048018340 8:130517198-130517220 CCAGCCCCACAGCCTCCAGCTGG - Intergenic
1048799107 8:138179925-138179947 TAATCCCAACACTCTGAAGCAGG - Intronic
1048883075 8:138886051-138886073 TCAGCCCCAAAGCCTGCAGAGGG - Intronic
1049346797 8:142143572-142143594 TCAGCCCCACCGTCTCAGGCAGG + Intergenic
1049602104 8:143512753-143512775 TCAGCCCCACAGCCGCAAGAGGG + Intronic
1054914331 9:70481993-70482015 GCAGCCCCAAACTATGAAGCAGG - Intergenic
1055908290 9:81318462-81318484 TGAACCCCACAGTTTGCAGCTGG - Intergenic
1056295604 9:85190385-85190407 TGAGGCTCACCGTCTGAAGCAGG - Intergenic
1057510822 9:95678424-95678446 CCAGTCCCACAGACTGAAGTGGG - Intergenic
1058492866 9:105520728-105520750 TCAGCACCACAGTCTGAACATGG + Intronic
1060470207 9:123942386-123942408 TCAGCTGCACAGTCTGAGGGAGG + Intergenic
1061161666 9:128899038-128899060 ACAGCCCAGCAGTCTGACGCGGG + Intronic
1189200476 X:39191485-39191507 TCAGCCCTCCAGACTTAAGCTGG - Intergenic
1191627497 X:63284154-63284176 TCAGCTCCACACTCCCAAGCTGG - Intergenic
1195770696 X:108347913-108347935 TCAGCCCCATTGTTTGAAGTGGG - Intronic
1196831085 X:119776063-119776085 TCTGCCTCATAGTCTGAAACGGG + Intergenic
1197205369 X:123785111-123785133 GCAGCCCCACCCTCTGCAGCTGG + Intergenic
1200143886 X:153915953-153915975 GCAGCCCCACCATCGGAAGCTGG + Intronic
1201597463 Y:15687056-15687078 TCAGCCCCACAATCCCCAGCAGG - Intergenic