ID: 950725438

View in Genome Browser
Species Human (GRCh38)
Location 3:14914037-14914059
Sequence CAGCCCCACAGTCTGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 224}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950725434_950725438 -3 Left 950725434 3:14914017-14914039 CCCTGCTGTGATTAGGCCATCAG 0: 1
1: 0
2: 1
3: 12
4: 121
Right 950725438 3:14914037-14914059 CAGCCCCACAGTCTGAAGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 224
950725431_950725438 8 Left 950725431 3:14914006-14914028 CCCTCTGATTACCCTGCTGTGAT 0: 1
1: 0
2: 0
3: 15
4: 134
Right 950725438 3:14914037-14914059 CAGCCCCACAGTCTGAAGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 224
950725435_950725438 -4 Left 950725435 3:14914018-14914040 CCTGCTGTGATTAGGCCATCAGC 0: 1
1: 0
2: 1
3: 8
4: 79
Right 950725438 3:14914037-14914059 CAGCCCCACAGTCTGAAGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 224
950725430_950725438 15 Left 950725430 3:14913999-14914021 CCTGCATCCCTCTGATTACCCTG 0: 1
1: 0
2: 2
3: 17
4: 176
Right 950725438 3:14914037-14914059 CAGCCCCACAGTCTGAAGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 224
950725432_950725438 7 Left 950725432 3:14914007-14914029 CCTCTGATTACCCTGCTGTGATT 0: 1
1: 0
2: 0
3: 13
4: 169
Right 950725438 3:14914037-14914059 CAGCCCCACAGTCTGAAGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 224
950725429_950725438 28 Left 950725429 3:14913986-14914008 CCTCAGGGATAGGCCTGCATCCC 0: 1
1: 0
2: 1
3: 25
4: 173
Right 950725438 3:14914037-14914059 CAGCCCCACAGTCTGAAGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 224
950725428_950725438 29 Left 950725428 3:14913985-14914007 CCCTCAGGGATAGGCCTGCATCC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 950725438 3:14914037-14914059 CAGCCCCACAGTCTGAAGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950725438 Original CRISPR CAGCCCCACAGTCTGAAGCT GGG Intronic
901836153 1:11925569-11925591 GGGCCCCACAGTCTGCAGCGCGG + Exonic
903818070 1:26079559-26079581 CACCCCCACAGCTTGAACCTGGG + Intergenic
904824745 1:33266883-33266905 AAACTCCACAGTCTGATGCTCGG - Intronic
905713879 1:40131626-40131648 CAGCCTCCCAGCCTGTAGCTGGG + Intergenic
906794660 1:48687440-48687462 CACCCCCACAGGCTGACGCAGGG + Intronic
907338130 1:53713965-53713987 CAGCCACACACCCTAAAGCTGGG - Intronic
907469794 1:54665866-54665888 CTGCCCCAGGGACTGAAGCTTGG - Intronic
907983318 1:59506108-59506130 CTGCTCCACAGTCTGAAGGCAGG - Intronic
908748403 1:67397283-67397305 CAGCCTCCCACTCTGAATCTCGG + Intergenic
909268718 1:73595858-73595880 CAGACCTACTGTCTGAAGATGGG + Intergenic
913311387 1:117499519-117499541 CAGCCCCACTGCCTGTATCTTGG - Exonic
919539518 1:198830089-198830111 CAGGGCCTCAGCCTGAAGCTTGG + Intergenic
923148863 1:231216678-231216700 CAGTCTCACAGTGGGAAGCTGGG - Exonic
923283023 1:232462929-232462951 CATCCCCAAAGTCTGAAGTAAGG + Intronic
1062823031 10:548706-548728 AAGCTCCACAGTCTGAGGCCTGG - Intronic
1063298151 10:4826610-4826632 CAGCCCCAGAGTCTGAGGCTTGG - Intronic
1064978374 10:21142326-21142348 CAGCCACACAGACTCCAGCTTGG + Intronic
1064979939 10:21155985-21156007 CAGCCCTACAGTCTCCAGCAGGG + Intronic
1066633822 10:37481629-37481651 CAGTCCCTCAGTCAGATGCTAGG + Intergenic
1072736722 10:97884134-97884156 CAACCCCATGGGCTGAAGCTGGG - Intronic
1073323830 10:102631172-102631194 CAGCCCTACAGCCTGAAGGCTGG - Exonic
1073716723 10:106115596-106115618 CAGCCTCAAAGATTGAAGCTAGG + Intergenic
1074687687 10:115975199-115975221 CAGGCCCAGTGTCTGAAGGTTGG - Intergenic
1075383873 10:122040441-122040463 CAGCCCCAAATCCTGAAGGTGGG + Intronic
1075992830 10:126852377-126852399 GAGTCCCCCAGTCTGGAGCTGGG + Intergenic
1076404929 10:130205276-130205298 CATGCCCACATTCAGAAGCTTGG - Intergenic
1076587446 10:131559351-131559373 GGGCCCCACAGTTTGAGGCTGGG + Intergenic
1077007053 11:363314-363336 CAGCCCCACCGTCTGGAGAGAGG + Intergenic
1077322056 11:1947035-1947057 CGGCCCCACAGCCTGAAGCCCGG - Intergenic
1082799462 11:57403897-57403919 CACCCCCACAGTGCCAAGCTGGG - Intronic
1083235629 11:61349083-61349105 AAGCACAGCAGTCTGAAGCTTGG + Exonic
1086337462 11:85813110-85813132 CTGCCCCACAACCTGAAGCAAGG - Intergenic
1087203034 11:95365275-95365297 CAGCCCCACAGTGTGAATTTGGG - Intergenic
1087886231 11:103486045-103486067 CAGCCTGCCAGTCTTAAGCTAGG + Intergenic
1089131473 11:116215634-116215656 CAGCCCCACAGTCTGGGCCAGGG + Intergenic
1090913480 11:131142164-131142186 AGTGCCCACAGTCTGAAGCTAGG - Intergenic
1202805072 11_KI270721v1_random:2348-2370 CGGCCCCACAGCCTGAAGCCCGG - Intergenic
1091396351 12:156167-156189 CACCCACACACACTGAAGCTCGG + Intronic
1091788245 12:3256112-3256134 CAACCCAACAGTCTGAAGAAAGG - Intronic
1092447108 12:8568045-8568067 CAGTCCCACAGACTGGAGCGGGG - Intergenic
1093916016 12:24803316-24803338 CAGTCCCAACGTCTGCAGCTTGG - Intergenic
1094608600 12:31971724-31971746 CAGCCCTCCATTCTGAAACTAGG - Intronic
1096407531 12:51354692-51354714 CATCCACTCAGTCTGAAGCTAGG - Intronic
1096503446 12:52079385-52079407 CAGCACCCCAGCCTGCAGCTGGG + Intergenic
1096842277 12:54386695-54386717 GAGCACCAGAGGCTGAAGCTTGG + Intronic
1097132705 12:56824618-56824640 GAGCCCCAAAGTCTGTAGCAGGG - Intergenic
1101078669 12:101158786-101158808 CAGCTCCACTGTCTGAAGCGGGG - Intronic
1109324221 13:60848419-60848441 GAGCCCCACAGTATGATGCAAGG + Intergenic
1111640921 13:90968758-90968780 CAGCCCCAAAGCCTGAAACCAGG + Intergenic
1117919405 14:60713431-60713453 CAGCTGGACAGTCTGGAGCTTGG + Exonic
1119387425 14:74266322-74266344 CAGCTCCACACTCTGAAGAGAGG - Intergenic
1121958834 14:98240126-98240148 CAGCCCCAGAGAGTGAAGCCAGG + Intergenic
1124707346 15:31976966-31976988 CAGCCACAGACACTGAAGCTGGG - Intergenic
1125298340 15:38227146-38227168 ATGCCCCAGAGTCAGAAGCTTGG - Intergenic
1126651548 15:50927429-50927451 CAACCCCAGAGCCTGAATCTAGG + Intronic
1129205050 15:74032597-74032619 CAGCCCCAGGGCCTGAACCTGGG - Exonic
1129296765 15:74604155-74604177 CAGCCCCACAGCCTGTGGGTGGG - Intronic
1130336410 15:82960693-82960715 CAGCCACACCATCTGTAGCTAGG - Intronic
1134531787 16:14989492-14989514 GGGCCCCACAGTCTGCAGCGCGG + Intronic
1135330683 16:21557319-21557341 AAGCCCCACCGTGTGAAGCCAGG - Intergenic
1135421469 16:22308212-22308234 CAGCCCCACCTTCTGCTGCTTGG - Exonic
1139581605 16:67877110-67877132 CACCACCAGAGTCTCAAGCTTGG - Intronic
1141155336 16:81593210-81593232 CAGCAGCACAGCCTGCAGCTGGG - Intronic
1141610144 16:85176678-85176700 CATCCCCACAGTGAGAGGCTGGG - Intronic
1141902770 16:87003364-87003386 GAGCCCCACAGTGATAAGCTGGG + Intergenic
1142043707 16:87911786-87911808 AAGCCCCACCGTGTGAAGCCAGG - Intronic
1142143541 16:88483196-88483218 GAGCCCCAAAGGCTGCAGCTAGG + Intronic
1142540574 17:655570-655592 CAGAGCCACAGCCTGAAGATGGG + Intronic
1142954454 17:3511890-3511912 CAGCTCCATAGTGTGGAGCTTGG + Intronic
1143263865 17:5621125-5621147 CAGCTCCTCAGGCTTAAGCTGGG - Intergenic
1144582284 17:16465776-16465798 CAGAGCCACAGTCAGCAGCTGGG - Intronic
1147936462 17:44014239-44014261 CAGCTGCACAGTGTGAAGCCTGG - Intronic
1148461767 17:47843213-47843235 CCGCCCCACAGTGGGAAGCCGGG - Intergenic
1151293195 17:73165063-73165085 CAGAGCCCCAGTCTGAGGCTTGG + Exonic
1152931286 17:83111463-83111485 CAGCCCCTCACTCTGAAGGAGGG - Intergenic
1156350832 18:36299615-36299637 CAGCCCCACAGTCTTGATCCTGG + Intronic
1156603435 18:38638093-38638115 CAGCCCTATAGTCTGGAGCCTGG + Intergenic
1157397762 18:47356923-47356945 CATCTCCACAGTTGGAAGCTGGG - Intergenic
1157616852 18:48992204-48992226 CTGCCCCACAGCCTCAAGCTCGG + Intergenic
1158722607 18:59938868-59938890 CCACCCCACAGACTGCAGCTAGG - Intergenic
1160437761 18:78865024-78865046 CTGCCCCACAGTCTCACTCTGGG - Intergenic
1160731847 19:644809-644831 GAGCCCCACAGCCTGGAGCCAGG + Intergenic
1161496111 19:4586716-4586738 CAGACACACAGCCTGAACCTCGG - Intergenic
1161810079 19:6466515-6466537 CAGCCCCACAGCCAGGAGCAAGG - Exonic
1162473475 19:10886307-10886329 CAGCCTCCCAGCCTGTAGCTGGG + Intronic
1164076683 19:21825542-21825564 CAGCCCCAAATTCTGATTCTGGG - Intronic
1164140681 19:22459277-22459299 CAGCTCCAAATTCTGAATCTAGG + Intronic
1164271150 19:23673173-23673195 CAGCTCCAAATTCTGAATCTAGG - Intronic
1165315068 19:35049903-35049925 CATCCCCACACTCTGAGGGTGGG + Intronic
1165393565 19:35551697-35551719 CACCCCCACACTCTGATGCAAGG - Intronic
1166565921 19:43765483-43765505 CAGGCCCCCAGCCGGAAGCTAGG - Intergenic
1167172146 19:47840240-47840262 CAGCACCACTTTCTGAAGCCTGG - Exonic
1167443628 19:49524755-49524777 CAGCCCCTCAGGGTGGAGCTGGG + Exonic
925347219 2:3179639-3179661 CAGCCCCAGAGCTTCAAGCTTGG - Intergenic
926316675 2:11715214-11715236 CTGCCCCACAGTCTGGAGAATGG - Intronic
927181320 2:20448324-20448346 CAGCCACACACTCTGAGGCCCGG - Exonic
933720754 2:85395927-85395949 CGGCCTCACAGTCTGATGCTAGG - Intronic
934475054 2:94588211-94588233 CATCTCCACAGTCCAAAGCTGGG + Intergenic
934777441 2:96948474-96948496 GAGCCTGACAGTCAGAAGCTGGG + Intronic
936108444 2:109645574-109645596 CTGCCACATGGTCTGAAGCTTGG + Intergenic
936625130 2:114140688-114140710 CAGCCCAAGAATCTGCAGCTAGG - Intergenic
937095773 2:119234340-119234362 CAGCCTCAGCGTCTGGAGCTGGG - Intronic
937224991 2:120363650-120363672 AAGCCCCTCGGTCTGAAGCCTGG - Intergenic
947033113 2:225820541-225820563 GTGACCCACAGTCTGAAGCCTGG + Intergenic
947565474 2:231190484-231190506 CAGCTCCACAGTCAGGGGCTGGG + Intergenic
947756488 2:232569611-232569633 CAGCCACACAGACAGAAGCAGGG - Intronic
1168756790 20:324223-324245 CCGCCCCACACCCTCAAGCTCGG + Intergenic
1171934231 20:31258273-31258295 CAGGCTCACAGTATGGAGCTGGG + Intronic
1172441931 20:34971936-34971958 CAGCCCCACCAGCTGCAGCTGGG - Intergenic
1173024026 20:39291082-39291104 CAGACCCACAGTGTGAAGTATGG - Intergenic
1174448112 20:50603733-50603755 CAGTGCCACAGTGTGAATCTGGG + Intronic
1174768546 20:53276196-53276218 CAGCTCCAGGGTCTAAAGCTAGG + Intronic
1174825674 20:53766250-53766272 CAGACCCAGATTTTGAAGCTGGG + Intergenic
1175312347 20:58020499-58020521 CAGCTCCAGAGGCTGCAGCTGGG - Intergenic
1175542537 20:59756645-59756667 CAGCCCCAAAGTCAGATGCCTGG - Intronic
1175968052 20:62669466-62669488 CAGCCCCCCAGACTGAGGCCCGG - Intronic
1178388948 21:32182727-32182749 GAAACCCACAGTGTGAAGCTGGG + Intergenic
1178690525 21:34746238-34746260 CAGCCCCACCGTGTTTAGCTTGG - Intergenic
1179597179 21:42450723-42450745 CAGCACCACAGGCTGCAGCCTGG - Intergenic
1179606486 21:42519036-42519058 CAAGCCCAGAGTCTGAAGCTGGG + Intronic
1179786616 21:43733930-43733952 CAGCCCTCCAGCCTGCAGCTGGG + Intronic
1180713150 22:17853757-17853779 CAGCTCCACTCTCTGAGGCTGGG + Intronic
1181780697 22:25190854-25190876 CAGCCCCAGTCTCTGAAGCGTGG - Intronic
1183478692 22:38050972-38050994 CACCCCCTGAGTCTGAAGCAAGG - Intergenic
1184309615 22:43632763-43632785 AGGCCCCACAGTCTGCAGCATGG - Intronic
1185309407 22:50145870-50145892 CCGCCCCTCAGACAGAAGCTAGG - Intronic
949761653 3:7477579-7477601 CAGCCCCAAAGTCTGGTACTTGG - Intronic
950725438 3:14914037-14914059 CAGCCCCACAGTCTGAAGCTGGG + Intronic
954107267 3:48416072-48416094 CAGCCGCCCAGTCAGGAGCTTGG + Exonic
954465923 3:50654755-50654777 CAGGACCAGGGTCTGAAGCTAGG + Intergenic
954746920 3:52792629-52792651 CCGCCCCACAGCCTGCCGCTAGG - Intergenic
955073147 3:55588576-55588598 CAGCACCACAGTCAGAAGATGGG + Intronic
960004980 3:112772531-112772553 CAGCCCCAAAGTGTGAAGTCAGG - Intronic
960453855 3:117845186-117845208 GAGCCAGACAGTCAGAAGCTGGG + Intergenic
960781535 3:121323907-121323929 CAGCCCCACAGTTGAAAGCTTGG - Intronic
961464432 3:127072748-127072770 CAGCCCCACAGTCTCCATATGGG - Intergenic
961781168 3:129320705-129320727 CAGCTCGACAGTCTGATTCTGGG + Intergenic
962741184 3:138363545-138363567 GAGCCCCACAGGCTGGGGCTGGG + Intronic
962968198 3:140373553-140373575 CAGCCCCACAGCCTGAATCAAGG - Intronic
963004251 3:140711145-140711167 CATCCCCACAGTCTCAAGCATGG + Intergenic
963531180 3:146475281-146475303 CAGCCTCAAAGACTGAAACTAGG - Intronic
967136740 3:186519110-186519132 CAGCCCCACACTCTGATTCCTGG + Intergenic
968092910 3:195909374-195909396 CAGCTCCGCGGGCTGAAGCTCGG - Intronic
968266006 3:197363922-197363944 CAGCCCAGGAGTCAGAAGCTGGG + Intergenic
968953264 4:3705641-3705663 CAGCCACACAGCCTGAGGCTTGG - Intergenic
969136306 4:5031859-5031881 CAGCCACTCTGTCTGAAACTGGG - Intergenic
969485051 4:7467537-7467559 CAGGCCCACACTCAGGAGCTGGG - Intronic
969921329 4:10543068-10543090 CATCCCCAGAGCCAGAAGCTTGG - Intronic
969927097 4:10594976-10594998 CAGCCCCCCAGCCAGTAGCTGGG - Intronic
973711265 4:53632350-53632372 CAGCCACACTCTCAGAAGCTAGG - Intronic
979189048 4:117834442-117834464 TAGGGCCACAGCCTGAAGCTTGG + Intergenic
984710200 4:182878607-182878629 CAGCCCCAGAGTCAGAATCAAGG - Intergenic
985961709 5:3307560-3307582 CAGCCGCACAGCCTGGGGCTTGG + Intergenic
986408132 5:7447599-7447621 CACTCCCACAGCCTGCAGCTGGG + Intronic
986556192 5:9011809-9011831 CATCCCCACCATCTGAAGTTTGG + Intergenic
992738692 5:79751018-79751040 CATCCCCACAGTCTTAATTTAGG + Intronic
995464417 5:112436253-112436275 TAGCACAGCAGTCTGAAGCTTGG + Intergenic
995806615 5:116059864-116059886 CAGCCCCACATTCAGAATCTGGG + Exonic
996581299 5:125034942-125034964 CAACCTCACTGCCTGAAGCTAGG - Intergenic
997265941 5:132495690-132495712 CAGCCCCACATTCTGCATTTAGG - Intergenic
998217973 5:140251794-140251816 CAGCCCCTCAGTCTGACTCCTGG - Intronic
998374194 5:141680555-141680577 CTGCCCCAGAGTCTGAGGCCTGG + Intronic
998711889 5:144835332-144835354 CAGCACCAAAGTCTGAGGGTAGG + Intergenic
999291029 5:150426522-150426544 CAGCCTCCCAGCCTGTAGCTGGG + Intergenic
999316621 5:150588384-150588406 CAACCCCAGCCTCTGAAGCTGGG + Intergenic
999430825 5:151524055-151524077 CAGCCCCACTATCTCCAGCTTGG + Intronic
1000597471 5:163232432-163232454 CAGCCTCCCAGCCTGTAGCTGGG + Intergenic
1001288236 5:170438848-170438870 CAGCACCACAGTGTGCCGCTCGG - Intronic
1002876808 6:1217867-1217889 CAGCCCCACAGCCTGCCGATGGG - Intergenic
1005025760 6:21461413-21461435 CAGCCCCACAGTCTGCTATTTGG - Intergenic
1005105014 6:22214654-22214676 CAGGCCCCCAGCCTGAAGCAGGG - Intergenic
1007738032 6:43994110-43994132 CAGCCCCACTGTCTGAGGAAAGG - Intergenic
1007920722 6:45607227-45607249 CAGCCACATAGTGTGAAGCCAGG - Intronic
1008316379 6:50047127-50047149 AAGCCCCACAGACTCAGGCTAGG - Intronic
1011712527 6:90069184-90069206 CTGCCCCACAGTCCGCTGCTGGG + Intronic
1013937085 6:115609985-115610007 CAGCCACATAGCCTGAAGGTGGG - Intergenic
1014601085 6:123413259-123413281 CAGTCTCTCAGTCTGAATCTTGG + Intronic
1015088172 6:129321451-129321473 AGACCCCACAGTCTGAAGCCTGG + Intronic
1016750484 6:147625907-147625929 CTGACCCACTGTCTGCAGCTAGG - Intronic
1017264069 6:152422022-152422044 ATGCCCCACAAACTGAAGCTAGG + Intronic
1018289171 6:162272880-162272902 CAGCCTCCCAGCCTGTAGCTGGG - Intronic
1018711014 6:166498310-166498332 CAGCCCCACTTTCTGATGGTGGG + Intronic
1019442805 7:1055961-1055983 CAGCCTCGCAGGCAGAAGCTGGG + Intronic
1019678367 7:2329589-2329611 AAGACCCACAGTCTTAAGGTGGG - Intronic
1019709413 7:2511458-2511480 CAGCCCCCCAGGCTGCACCTCGG - Intergenic
1019895731 7:3981364-3981386 GAGCCCCACAGTGTGAAATTTGG + Intronic
1021566938 7:22025556-22025578 CAGCCCTGGAGGCTGAAGCTTGG - Intergenic
1022472960 7:30692987-30693009 CAGCCACCCAGTCTGGGGCTGGG - Intronic
1022808471 7:33846458-33846480 CACGCCCTCATTCTGAAGCTGGG + Intergenic
1022949933 7:35328479-35328501 CTGCCTCACAAGCTGAAGCTTGG + Intergenic
1023921470 7:44633417-44633439 TCCCCGCACAGTCTGAAGCTGGG + Intronic
1025803145 7:64806539-64806561 CAGCTCCAAACTCTGAATCTAGG + Intronic
1025866121 7:65382797-65382819 CGGCTCCACATTCTGAATCTGGG + Intronic
1026377022 7:69762082-69762104 CAGCCACAACATCTGAAGCTTGG - Intronic
1026609859 7:71848229-71848251 CAATCCCACAGTCAGAAGATGGG + Intronic
1026768216 7:73173858-73173880 CAACCCCACACTCTGGACCTGGG - Intergenic
1027044682 7:74983566-74983588 CAACCCCACACTCTGGACCTGGG - Intronic
1027078956 7:75218793-75218815 CAACCCCACACTCTGGACCTGGG + Intergenic
1027223531 7:76229685-76229707 AAGTGCCACATTCTGAAGCTGGG - Intronic
1029388175 7:100257353-100257375 CAACCCCACACTCTGGACCTGGG + Intronic
1030112321 7:106037576-106037598 CTGCCCCACAGCCTGCAGCAGGG + Intergenic
1031743732 7:125468190-125468212 CAGCAGCCCAGTCTGAAGATGGG + Intergenic
1033374564 7:140745549-140745571 CAGTCCCAGAATTTGAAGCTGGG - Intronic
1034433693 7:151053244-151053266 CACCCCCACCGTCTCAAGCCTGG - Intergenic
1036772932 8:11591592-11591614 CAGCCCCACTGTCTTAACCTCGG - Intergenic
1038492838 8:27982537-27982559 CAGCCCCACAGGAGGATGCTCGG + Intronic
1039920130 8:41887918-41887940 CAGCCCCACTGGCTGGAGGTGGG - Intronic
1040470150 8:47730038-47730060 CAGCACCACAGTCTTCAGGTTGG + Intronic
1040678350 8:49779617-49779639 CTGCCCTTCAGTATGAAGCTGGG + Intergenic
1041357532 8:57015888-57015910 CAGTCTCACAGTCTGTACCTTGG - Intergenic
1043299128 8:78705256-78705278 CAGCCTCAAAGACTGAAGTTAGG - Intronic
1043405681 8:79929942-79929964 CAGCCAAACAGTCAGAAGGTAGG + Intronic
1048867712 8:138772999-138773021 CAGCCTCAGTGTCTGCAGCTAGG - Intronic
1049207597 8:141370710-141370732 CAGCCCCACAGTGGGAACCAAGG + Intergenic
1049346798 8:142143573-142143595 CAGCCCCACCGTCTCAGGCAGGG + Intergenic
1049476923 8:142801198-142801220 AGGCCCCTCAGTCTGAACCTGGG + Intergenic
1053067726 9:35079961-35079983 CGGCCCCACAGTCCGTGGCTCGG + Exonic
1053267881 9:36729054-36729076 GAGCCCCAGAGGCTGGAGCTTGG - Intergenic
1053683017 9:40497880-40497902 CATCTCCACAGTCCAAAGCTGGG - Intergenic
1053932999 9:43126194-43126216 CATCTCCACAGTCCAAAGCTGGG - Intergenic
1054280697 9:63127048-63127070 CATCTCCACAGTCCAAAGCTGGG + Intergenic
1054296117 9:63333380-63333402 CATCTCCACAGTCCAAAGCTGGG - Intergenic
1054394133 9:64637875-64637897 CATCTCCACAGTCCAAAGCTGGG - Intergenic
1054428783 9:65143088-65143110 CATCTCCACAGTCCAAAGCTGGG - Intergenic
1054501597 9:65878455-65878477 CATCTCCACAGTCCAAAGCTGGG + Intronic
1054931485 9:70639943-70639965 CAGCCCAGCAGCCTGAAACTCGG - Intronic
1055908289 9:81318461-81318483 GAACCCCACAGTTTGCAGCTGGG - Intergenic
1056459809 9:86798854-86798876 CAGGTCCCCAGCCTGAAGCTTGG + Intergenic
1057046923 9:91893199-91893221 CAGAACCCCAGGCTGAAGCTGGG + Intronic
1059522400 9:114955931-114955953 CAACCCCACAGACAGAAGATAGG - Intergenic
1060828495 9:126699778-126699800 CAGCCCCACAGGCTTCTGCTGGG - Exonic
1061161667 9:128899039-128899061 CAGCCCAGCAGTCTGACGCGGGG + Intronic
1061952109 9:133942455-133942477 CAGCCCCAGACACTGGAGCTGGG + Intronic
1186086236 X:5993601-5993623 CAGCCCCACAGTCTGTTACTAGG - Intronic
1187028109 X:15456887-15456909 CAGCCCCAAAGACTAAATCTTGG + Intronic
1189200475 X:39191484-39191506 CAGCCCTCCAGACTTAAGCTGGG - Intergenic
1191627496 X:63284153-63284175 CAGCTCCACACTCCCAAGCTGGG - Intergenic
1193633771 X:83923984-83924006 CAGCCCCACAGTCTCCTGCAAGG + Intergenic
1196392679 X:115225041-115225063 CTGCCCCACAGTCAGAAGGAAGG - Intronic
1197898231 X:131340525-131340547 CAGCCTCACAGTTTAAATCTAGG + Intronic
1198115681 X:133542745-133542767 AACCCCCAGAGGCTGAAGCTGGG + Intronic
1199716824 X:150512594-150512616 CTGCCCAGCAGGCTGAAGCTGGG - Exonic