ID: 950726148

View in Genome Browser
Species Human (GRCh38)
Location 3:14918347-14918369
Sequence TAGGCTCTTTACCATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950726142_950726148 21 Left 950726142 3:14918303-14918325 CCAGGAGAGCTGAGAGAGGCACT 0: 1
1: 0
2: 3
3: 23
4: 314
Right 950726148 3:14918347-14918369 TAGGCTCTTTACCATGGGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950726148 Original CRISPR TAGGCTCTTTACCATGGGGA AGG Intronic
907409229 1:54273068-54273090 TGGGCTCTGTAGCATGGGGCTGG + Intronic
910509258 1:87985261-87985283 CAGGCTCTGTCCCAGGGGGAAGG + Intergenic
915848763 1:159298380-159298402 TGAACTCATTACCATGGGGAAGG - Intronic
919292465 1:195650123-195650145 TAGGTTATTTACCATTGGAAAGG + Intergenic
920510525 1:206548452-206548474 GATGCTCATTACCATGGGGAGGG + Intronic
920979575 1:210820733-210820755 AAAGATCTTTACAATGGGGAGGG + Intronic
920982699 1:210853284-210853306 TATGCTCTATACCATGGGCAAGG - Intronic
921828547 1:219701445-219701467 TATGCTCTATTCCATTGGGAAGG + Intronic
922018402 1:221676362-221676384 TTTGCCCTTTATCATGGGGAGGG + Intergenic
924637066 1:245798512-245798534 GTGGCTCTTAAGCATGGGGAAGG - Intronic
1063336127 10:5216218-5216240 AACACTCATTACCATGGGGAGGG + Intronic
1064316462 10:14262326-14262348 CTGGTTCTGTACCATGGGGATGG + Intronic
1064555872 10:16546546-16546568 TTCGCTCATTACCATGAGGAGGG - Intergenic
1066983946 10:42447146-42447168 TTTGCTTCTTACCATGGGGATGG - Intergenic
1067371099 10:45683194-45683216 TGTGCTTATTACCATGGGGATGG + Intergenic
1067388683 10:45842958-45842980 TGTGCTTATTACCATGGGGATGG - Intronic
1067417382 10:46114000-46114022 TTTGCTTATTACCATGGGGATGG + Intergenic
1067502797 10:46820883-46820905 TGTGCTTATTACCATGGGGATGG + Intergenic
1067591794 10:47519129-47519151 TTTGCTTATTACCATGGGGATGG - Intronic
1067638909 10:48027203-48027225 TTTGCTTATTACCATGGGGATGG - Intergenic
1067874574 10:49993096-49993118 TGTGCTTATTACCATGGGGATGG + Intronic
1070135898 10:73693359-73693381 TTTGCTTTTTACCATGGGGATGG - Intronic
1072677231 10:97476950-97476972 TAGGCTCTTTAGCTCTGGGAAGG + Exonic
1077447656 11:2606417-2606439 TTCGCTCATTACCACGGGGATGG - Intronic
1078020728 11:7654173-7654195 TAGGCTCATAACCATGGTGGGGG + Intronic
1080636395 11:34127536-34127558 TAGGCTCTTCACCAAGGGGAGGG - Exonic
1080865246 11:36188619-36188641 TAGGCTGTGTAGCATAGGGAAGG - Intronic
1081578055 11:44332029-44332051 TTGGGTCTATACCATGGGAATGG + Intergenic
1081637711 11:44731771-44731793 TGGGCTTCTTGCCATGGGGACGG - Intronic
1082839129 11:57674335-57674357 TAAGCTCTTGACCATCTGGAAGG + Intronic
1082936911 11:58664664-58664686 TAGGAACAATACCATGGGGAGGG + Intronic
1084032171 11:66487474-66487496 TAGGCTCTATAGCCTGGGGTGGG - Intronic
1085761171 11:79242945-79242967 TAAACTCTGTACCCTGGGGAGGG + Intronic
1089584815 11:119503503-119503525 TAAACTTGTTACCATGGGGAGGG - Intergenic
1096975879 12:55699048-55699070 TTGGCTCTTAACCTAGGGGAGGG - Intronic
1099345987 12:81500287-81500309 TAGGCTCTATAGGATAGGGAGGG - Intronic
1104110239 12:125697874-125697896 CAGGCTCATGACCATGAGGAGGG + Intergenic
1106399643 13:29417250-29417272 CAAACTCCTTACCATGGGGAGGG + Intronic
1107718610 13:43225313-43225335 TATGCCCATTACCAGGGGGATGG + Intronic
1112378437 13:98865682-98865704 TGGGCTCTGTACCAGGTGGAAGG + Intronic
1112653438 13:101423089-101423111 TAGGTTCTCTACCATGGACATGG + Intergenic
1114589198 14:23844194-23844216 TAGAAACCTTACCATGGGGAAGG + Intergenic
1115877830 14:37880511-37880533 TGAACTCATTACCATGGGGAGGG - Intronic
1116361656 14:44005974-44005996 TATGCTCATTACCAGGGTGATGG - Intergenic
1117827009 14:59714513-59714535 AAGGCTCTAGACCAAGGGGATGG - Intronic
1118307519 14:64667649-64667671 AGGACTCATTACCATGGGGAGGG + Intergenic
1120214886 14:81670639-81670661 GAGGATGTTTACCATGGGGTAGG + Intergenic
1121462900 14:94095715-94095737 TTTGTTCATTACCATGGGGAGGG + Intronic
1122006899 14:98713173-98713195 TAGACTCTTTACACTGGGGTGGG - Intronic
1122653982 14:103244695-103244717 AAGGCTCATTCCCATGGGGGGGG + Intergenic
1125758575 15:42082308-42082330 GAGGCCCTTGACCATTGGGAAGG - Exonic
1126433341 15:48610032-48610054 TACGTTTTTTGCCATGGGGACGG + Intronic
1127013905 15:54661191-54661213 TAGACACTTTCCCATGGGAATGG - Intergenic
1131506205 15:93022057-93022079 GAGGCTCTTTACCTTGGGGGTGG - Intronic
1133934278 16:10256153-10256175 TAGGGTTTTTACCAGAGGGAGGG - Intergenic
1134328971 16:13232916-13232938 TAATCTCTTTACGATTGGGAGGG + Intronic
1137418400 16:48307996-48308018 TGAACTCATTACCATGGGGAAGG + Intronic
1137715151 16:50594116-50594138 TAGGCTCTGAAAGATGGGGAGGG + Intronic
1138193915 16:55038417-55038439 GAGCCCCTTTAGCATGGGGAAGG - Intergenic
1141859429 16:86706424-86706446 CAGGCTTCTTCCCATGGGGAAGG - Intergenic
1143963898 17:10742323-10742345 TAGGCTCCTAACCATGAGGGTGG - Intergenic
1144427141 17:15153875-15153897 TACACTCATTACCATGGGGAAGG + Intergenic
1146645669 17:34575871-34575893 TAGGCTGTTCAACACGGGGAGGG - Exonic
1147631498 17:41935214-41935236 CAGGCTCTTTACCTTCAGGATGG + Exonic
1147688629 17:42301661-42301683 TCCGTTCTTTACCCTGGGGATGG + Intronic
1147924027 17:43935794-43935816 TAGGCCCGCTGCCATGGGGAGGG - Intergenic
1150969301 17:70009577-70009599 TGAACTCATTACCATGGGGAAGG - Intergenic
1150969561 17:70011551-70011573 TGAACTCATTACCATGGGGAGGG - Intergenic
1151540430 17:74762026-74762048 TCGGCTCTGTACCATGAAGAAGG + Exonic
1156472579 18:37387106-37387128 TAGAATCTGTACCATGGGCAAGG - Intronic
1157042477 18:44057128-44057150 TTCACTCATTACCATGGGGAAGG - Intergenic
1158189753 18:54813462-54813484 TCCACTCATTACCATGGGGAGGG - Intronic
1159913148 18:74165250-74165272 TAGGATCTTAAGCCTGGGGAAGG - Intergenic
1165147740 19:33742504-33742526 CTCGCTCATTACCATGGGGAGGG + Intronic
1165207147 19:34199504-34199526 TAGTGTTTTTACCATGGAGACGG + Intronic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1167054427 19:47100421-47100443 TAGGCACGTTACCATGGAAATGG - Intronic
928528346 2:32164835-32164857 GTGGCTCTTTATCTTGGGGATGG - Intergenic
931235381 2:60408399-60408421 TATATTCTTTACCATGGGTAGGG + Intergenic
931972257 2:67601701-67601723 TAGGTTGTTAGCCATGGGGAAGG - Intergenic
932536750 2:72605373-72605395 TAAACAGTTTACCATGGGGAGGG + Intronic
933543221 2:83675102-83675124 TAGGCTGTTAGCCATGGGGAGGG - Intergenic
935959793 2:108413706-108413728 TGGGCTCTCGCCCATGGGGAGGG + Intergenic
937378741 2:121356433-121356455 TAGGCTCAGTACCAGAGGGAGGG + Intronic
938163098 2:129004244-129004266 TGGGCTCTTTAGGGTGGGGAAGG - Intergenic
938928956 2:136069223-136069245 AAGTATCTTTACCAAGGGGAAGG + Intergenic
939392831 2:141591003-141591025 TAGGCTATTTACCATGGCTCGGG - Intronic
942364727 2:175212827-175212849 GAAACTCTTTACCATAGGGAGGG - Intergenic
943920108 2:193695942-193695964 AATACTCTTTGCCATGGGGATGG + Intergenic
944556888 2:200896185-200896207 CAGGCTCTTTAGCATGGTGTTGG + Intronic
946278377 2:218647772-218647794 TAGCCTTTTCACCATAGGGAAGG - Intronic
946486189 2:220103012-220103034 TAGGACTTTTACCATGGAGAGGG + Intergenic
946825441 2:223672957-223672979 TGAACTCATTACCATGGGGAGGG + Intergenic
947197348 2:227582250-227582272 TGAACTCATTACCATGGGGAAGG - Intergenic
947951440 2:234150944-234150966 TAGGTTCTTTGCCATCTGGAGGG - Intergenic
1169561467 20:6805268-6805290 GAGGCTATGTACCATGGGGGAGG + Intergenic
1172890447 20:38260486-38260508 TTGGCGCGTTACCATGGTGACGG + Exonic
1173197258 20:40925883-40925905 CAGGCTCTTTAACATGTGGCTGG + Intergenic
1173993738 20:47322201-47322223 TAGCCGCTTTACCATGGGCCTGG - Intronic
1175790891 20:61739209-61739231 GGGGCTGTTTCCCATGGGGAGGG + Intronic
1180032174 21:45219757-45219779 TAGGCGCTTTGTCATGGTGAAGG + Intronic
1182860274 22:33553844-33553866 TAGGCTCCTCACCAAGGGGGAGG - Intronic
1184623747 22:45705375-45705397 TGGGCTTTTTATCATGGGAAGGG + Intronic
949950060 3:9221585-9221607 GAGGCTCTTTACCAAGAGCAGGG - Intronic
950201070 3:11044425-11044447 CAAACTCATTACCATGGGGAGGG - Intergenic
950529612 3:13545645-13545667 TAGACTCTTCACTCTGGGGAGGG + Intergenic
950726148 3:14918347-14918369 TAGGCTCTTTACCATGGGGAAGG + Intronic
951351783 3:21615174-21615196 TGAGCTCATTACCATGGTGAGGG - Intronic
953650642 3:44799959-44799981 TTGGCTCTTCTCCATTGGGAGGG + Intronic
954945965 3:54424636-54424658 TGGGCTCTGTACTCTGGGGATGG + Intronic
955007743 3:54985570-54985592 TAGGCTCTGTGCAATGAGGATGG + Intronic
956230570 3:67011619-67011641 TGCGCTCATTACCATAGGGAGGG + Intergenic
959245384 3:103861715-103861737 TTCACTCATTACCATGGGGAAGG - Intergenic
961438180 3:126933623-126933645 TTCGCTCATTACCATGGGGAGGG + Intronic
963975202 3:151472797-151472819 CAGGTTCTAAACCATGGGGAGGG - Intergenic
966325580 3:178749958-178749980 GAGGCTCTTTCCCATGGGCATGG + Intronic
968776334 4:2543040-2543062 TAGGCTCTGTTCCATGGGCAAGG + Intronic
978062761 4:104358520-104358542 TTGGCTCTTTACTTTGGTGATGG - Intergenic
978331720 4:107620660-107620682 TAGGATGTTTGCCCTGGGGAGGG - Intronic
982228125 4:153184091-153184113 AAGGGTCTTTACCTTGGGCAGGG + Intronic
986417507 5:7544122-7544144 TGGGCTCTTTGTCATGGGGAAGG - Intronic
995289318 5:110432160-110432182 TTGACTATTTGCCATGGGGATGG - Intronic
997447075 5:133948337-133948359 TGCGTTCATTACCATGGGGAGGG + Intergenic
998885408 5:146688708-146688730 TTTGCTCTTTATCATAGGGATGG + Intronic
1000520878 5:162293298-162293320 TAGGGTCATCACCATGGGAAGGG - Intergenic
1005425928 6:25702300-25702322 CAGTCTCCTTTCCATGGGGATGG - Intergenic
1010974780 6:82299425-82299447 CACACTCATTACCATGGGGAGGG + Intergenic
1011524213 6:88245830-88245852 TAGGCTGTTTAGGATAGGGATGG - Intergenic
1011746566 6:90412817-90412839 GAGGCTCAGTATCATGGGGAGGG + Intergenic
1013740138 6:113273748-113273770 TTCGCTCATTACCATGGGGTGGG + Intergenic
1015168860 6:130228872-130228894 TGGGCTCCTTGCCATTGGGAAGG + Intronic
1017863489 6:158421620-158421642 TAGTCTCTTTAGAATTGGGAGGG + Intronic
1019345342 7:526959-526981 TGGGGTCTTTTCCATGGGGCAGG - Intergenic
1020674129 7:11160007-11160029 TAGGCTCATTACCTGGGTGATGG - Intronic
1022142166 7:27501837-27501859 TGTGCTCATTACCAGGGGGATGG - Intergenic
1024924532 7:54599132-54599154 TACTCTCTTTGCCATAGGGAAGG + Intergenic
1024978976 7:55140977-55140999 TAGAATCATTCCCATGGGGAAGG + Intronic
1026433324 7:70369888-70369910 TAGTCTCTTCAAAATGGGGATGG - Intronic
1028297414 7:89151770-89151792 TAGGCTCTTTAACATGGCAATGG + Intronic
1029236062 7:99120047-99120069 CTGACTCATTACCATGGGGATGG - Intronic
1029911590 7:104157064-104157086 TATACTCTTAACCATGGGAATGG - Intronic
1030168997 7:106582732-106582754 TAGGCTCTTTGCTAGGGGGTAGG - Intergenic
1033812750 7:145035772-145035794 TTCACTCATTACCATGGGGATGG + Intergenic
1035274772 7:157741162-157741184 CAGGCTCTTTTCCATAGGGCTGG - Intronic
1037605018 8:20430936-20430958 TAGGCCCTTAATCATGGTGATGG + Intergenic
1039108692 8:34018588-34018610 CTGACTCATTACCATGGGGATGG + Intergenic
1039731214 8:40280691-40280713 TGGACTCATTACTATGGGGAGGG - Intergenic
1043690672 8:83146937-83146959 TAGGCTCTTTTTCAAGGGGGTGG - Intergenic
1043993126 8:86780639-86780661 CAGGCTCAATACCATGTGGAAGG - Intergenic
1044726975 8:95201994-95202016 TAGTCACTCTCCCATGGGGAGGG + Intergenic
1047103133 8:121702990-121703012 TGAACTCATTACCATGGGGAGGG + Intergenic
1048488015 8:134866697-134866719 TGTGCTCTTTCCCATGGGCAAGG + Intergenic
1049436552 8:142588764-142588786 GAGGCTTCTAACCATGGGGACGG - Intergenic
1049999584 9:1062759-1062781 TAGGCTTGTTTCCATGGGTAGGG + Intergenic
1051036900 9:12758220-12758242 TAGACTCTTGTCCATTGGGAGGG + Intergenic
1055643683 9:78342785-78342807 TAGGCTTTTAAACTTGGGGAAGG - Intergenic
1055888318 9:81093283-81093305 TAGGCCCTTGAAGATGGGGAAGG - Intergenic
1057784760 9:98078376-98078398 TGGGCCATTTACTATGGGGAAGG + Intronic
1059680508 9:116581020-116581042 TGGACTCTTTTCCCTGGGGATGG + Intronic
1060116849 9:120948544-120948566 AACTCTCATTACCATGGGGAGGG + Intergenic
1062197107 9:135280411-135280433 GAGGCTCTGTACCATGTGGCTGG + Intergenic
1062197120 9:135280470-135280492 GAGGCTCTGTACCATGTGGCTGG + Intergenic
1186810376 X:13182132-13182154 TATGCTCTGTCCCAGGGGGATGG - Intergenic
1187274009 X:17802971-17802993 TGGCCTCGTTACCATGGAGAAGG + Intronic
1187816043 X:23232829-23232851 TGTACTCATTACCATGGGGATGG - Intergenic
1188029799 X:25251669-25251691 TATGCTCATTACCTTGGTGACGG - Intergenic
1188112525 X:26208904-26208926 TGGGCTCTTTATCATGGAAATGG + Intergenic
1189586298 X:42465481-42465503 TTGGCCCTTTACCATCAGGAAGG + Intergenic
1194853065 X:98892517-98892539 TAGACTCATTACCATGGGGAGGG - Intergenic
1201354368 Y:13082232-13082254 TTGGCACTTGATCATGGGGAGGG + Intergenic