ID: 950729766

View in Genome Browser
Species Human (GRCh38)
Location 3:14947541-14947563
Sequence CAGCCTCGCCGCCGCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950729766_950729777 28 Left 950729766 3:14947541-14947563 CCCCCGCCGCGGCGGCGAGGCTG 0: 1
1: 1
2: 2
3: 11
4: 215
Right 950729777 3:14947592-14947614 CCCTCCTCCTACCAGCGCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 160
950729766_950729774 -9 Left 950729766 3:14947541-14947563 CCCCCGCCGCGGCGGCGAGGCTG 0: 1
1: 1
2: 2
3: 11
4: 215
Right 950729774 3:14947555-14947577 GCGAGGCTGGCGCTGGGAAGAGG 0: 1
1: 0
2: 4
3: 28
4: 444
950729766_950729775 27 Left 950729766 3:14947541-14947563 CCCCCGCCGCGGCGGCGAGGCTG 0: 1
1: 1
2: 2
3: 11
4: 215
Right 950729775 3:14947591-14947613 GCCCTCCTCCTACCAGCGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950729766 Original CRISPR CAGCCTCGCCGCCGCGGCGG GGG (reversed) Intergenic
900091143 1:921222-921244 CAGCCTCAGCCCAGCGGCGGAGG + Intergenic
900205016 1:1427940-1427962 CAGCCCCGCCCCCGCCACGGAGG + Intergenic
900483702 1:2911398-2911420 CAGCAGCGCCGCGGCGGCCGCGG - Intergenic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901526015 1:9823867-9823889 CAGCGTCACGGCGGCGGCGGCGG - Exonic
902514054 1:16980507-16980529 CACCCTCGCCCCCGCGCCGGGGG + Intronic
903614753 1:24643553-24643575 CACCGTCGCCGCCGCGTAGGGGG - Intronic
903698950 1:25232161-25232183 CAGCTCCGCCGCCGCAGCGAGGG + Exonic
905807012 1:40884473-40884495 CAGCCCGGCCTCCGCGGTGGTGG - Intergenic
905819696 1:40979910-40979932 TAGCCCCGCCGCCGCGGTGACGG + Intronic
908131837 1:61082368-61082390 CCCCCTCCCCCCCGCGGCGGCGG + Intronic
912798593 1:112707155-112707177 CGCCCTCCCCGCCGCGGCGCTGG - Intronic
916656014 1:166876033-166876055 CAGCCTGGAGTCCGCGGCGGCGG - Intronic
923506158 1:234608660-234608682 CAGCCTGTCCACCGCGGCCGGGG - Exonic
924179150 1:241424069-241424091 CACCCTCCCTGCAGCGGCGGCGG - Intergenic
1062982537 10:1737223-1737245 AAGCTTCGCAGCAGCGGCGGCGG - Exonic
1064384511 10:14878715-14878737 CGCGCTGGCCGCCGCGGCGGGGG + Intergenic
1069023984 10:63521171-63521193 CGGCCTCGCTGCCGCGGCCTTGG - Intergenic
1069993909 10:72331270-72331292 CAGCCTCGCAGCCCCCACGGGGG - Intergenic
1071579685 10:86757245-86757267 CAGCCTCGCCGCTCCGGGGCGGG - Intronic
1071997519 10:91162877-91162899 CAGCGCCGCCGCCGCCGCCGCGG + Intergenic
1074586048 10:114768357-114768379 CAGCCGCTCTGCCGCGGCGCCGG + Intergenic
1075430297 10:122374766-122374788 CACCCGCGCCGCCGCGGCCCCGG - Exonic
1077238617 11:1498442-1498464 CAGCGTCGCAGCCGTGGTGGGGG + Intronic
1077962463 11:7089625-7089647 CCGGCTCGCAGCAGCGGCGGTGG + Exonic
1079128502 11:17734838-17734860 CAGCAGCGTCGCGGCGGCGGCGG + Exonic
1081699945 11:45146699-45146721 CAGCCTCGGCGCGGCGGCGGCGG - Intronic
1084331634 11:68433780-68433802 CTGCCTCGCCGTCGCAGCGCAGG - Exonic
1085561265 11:77474203-77474225 CCCCCTCCCCGGCGCGGCGGCGG + Intronic
1088315003 11:108498390-108498412 CCTCCTCGCCGCCGCGGAGCTGG - Exonic
1090002941 11:122977745-122977767 CAGCCGAGCCTCGGCGGCGGTGG + Exonic
1090293887 11:125569548-125569570 CAGCTCCGCCGCCGCGGCTCCGG - Exonic
1090636890 11:128694938-128694960 CGGCCTCGCCGCCTCTCCGGCGG + Intronic
1090699312 11:129279630-129279652 GAGGCGCGCCGCCGCGGCCGCGG + Intergenic
1092219143 12:6700859-6700881 CCGCCTCCCCCCCGCGCCGGAGG + Intergenic
1095271475 12:40224691-40224713 CGGCCGCGCCGCCGCTGCGGTGG + Intronic
1096127686 12:49131509-49131531 CGGCCTGGCCGCCGCAGAGGCGG + Intergenic
1096493012 12:52023304-52023326 CAGCCTCGCGGCCCCGGGGTGGG - Intronic
1096647822 12:53047905-53047927 GAGCCCGGCCGCCGCGGAGGAGG - Intronic
1101606007 12:106248042-106248064 CGGGGTCGGCGCCGCGGCGGCGG - Intronic
1102884077 12:116508535-116508557 CCGCCGCGCCGCCGCGGCTCTGG + Intergenic
1103407722 12:120687398-120687420 CGGCGTGGCCGGCGCGGCGGGGG + Exonic
1106512388 13:30422369-30422391 CTCCCTGGCCGCGGCGGCGGTGG + Intergenic
1107604027 13:42040809-42040831 GAGCCCCGGCGCAGCGGCGGCGG + Intronic
1108227536 13:48304185-48304207 CAGACGCTCCGCCGTGGCGGGGG - Intronic
1109079789 13:57884436-57884458 CACTCTCACCGCCGCGGCTGGGG - Intergenic
1114485164 14:23057647-23057669 CAGCCGGGCCCGCGCGGCGGGGG + Intergenic
1115028233 14:28766822-28766844 CAGCCTCGCCGCGGCCGCTCCGG + Intergenic
1115761314 14:36581065-36581087 CAGCCGTGCGGCGGCGGCGGCGG - Exonic
1116905093 14:50396643-50396665 AAGCCTCGCCGCCGCCTCCGCGG - Intronic
1117722104 14:58638148-58638170 CAGCCGGGCCGCCCAGGCGGAGG - Intronic
1122486763 14:102087146-102087168 TAGGCGCGCGGCCGCGGCGGCGG - Intronic
1122689123 14:103523189-103523211 GCCCCTCGCCGCCGCCGCGGGGG - Intergenic
1122885444 14:104708464-104708486 CAGCCCCGACGCCGAGGCTGTGG + Exonic
1122917486 14:104865668-104865690 CAGGGCCGCCTCCGCGGCGGCGG - Intronic
1123040216 14:105487334-105487356 CAGCCTCGTCGCCCCGTCGGCGG - Intronic
1202853658 14_GL000225v1_random:37019-37041 CAGCCTGGCCGCGCCGGCAGAGG + Intergenic
1125626829 15:41115984-41116006 TGGCCCCGCCGCCGCGACGGCGG + Exonic
1128737442 15:70061205-70061227 CAGCCTCACCGTGGAGGCGGGGG - Intronic
1130966986 15:88705183-88705205 CAGCCTCCCCGCCCCTGCTGTGG - Intergenic
1131097958 15:89667688-89667710 CAGCCTCGCAGCCGCCCAGGAGG - Exonic
1131144429 15:90002013-90002035 AAGCGTCGCGGCGGCGGCGGCGG + Intronic
1131231844 15:90665452-90665474 CGTCCTCACCGCCGCGGGGGGGG + Intergenic
1131257554 15:90872032-90872054 CAGCCTCCCCGCCGCCACCGGGG + Intronic
1131827040 15:96330469-96330491 CGGCGTCGCCGGCGCGGCGCGGG - Intronic
1132111465 15:99105090-99105112 CGGCCTCGCCGCTGCCCCGGAGG - Exonic
1132604594 16:788436-788458 CAGCCGCCCTTCCGCGGCGGGGG - Intergenic
1132915278 16:2340574-2340596 GAGCCTGGGCGCCGGGGCGGCGG + Exonic
1134849814 16:17470667-17470689 CAGCCTCGACTCCGGGGCCGGGG - Exonic
1135565853 16:23510417-23510439 CAGCCCCGACGCTGCGGCCGCGG + Exonic
1135821885 16:25692387-25692409 CCGGCTCGCGGCGGCGGCGGCGG - Exonic
1138590433 16:57996552-57996574 CAGTGCCGCCGCCGCGGCAGCGG - Exonic
1139364829 16:66427042-66427064 GAGCCGCGCCGCCGCCGAGGGGG + Intergenic
1140209188 16:72957826-72957848 CAGCCACACTGCCGGGGCGGCGG - Exonic
1140759628 16:78099442-78099464 CAGCCTCCCCGCCGCAGGGAAGG - Exonic
1142136280 16:88453349-88453371 AAGCCGAGCGGCCGCGGCGGCGG + Exonic
1142271795 16:89093790-89093812 CCGCCACGGCGCCGCGCCGGGGG + Exonic
1142339061 16:89508681-89508703 CCGCCTGGCCCCTGCGGCGGGGG + Intronic
1143134563 17:4704274-4704296 CAGCCTGGGCGCCGAGGCAGCGG + Exonic
1143627525 17:8118955-8118977 CTGCGTCGCAGCCTCGGCGGGGG + Exonic
1144339745 17:14301679-14301701 CAGCCCCGGCGCGGCGGCGCAGG - Exonic
1144742591 17:17592178-17592200 GAGCCTGGGCGCCGCGGGGGCGG - Intergenic
1147390863 17:40108340-40108362 CAGCCCGGCTGCTGCGGCGGTGG + Intergenic
1148386586 17:47238620-47238642 CACCCTCCCCGCAGCCGCGGTGG + Intergenic
1148664079 17:49361855-49361877 CGGGGGCGCCGCCGCGGCGGTGG + Intronic
1149270113 17:54968428-54968450 CAGCATTGCAGCCGCCGCGGCGG - Exonic
1150108221 17:62478006-62478028 CAGCATCCCCGCGGGGGCGGGGG + Intronic
1150484869 17:65536832-65536854 GACCCTCGCGGCCGCGGCGGCGG + Intronic
1151783831 17:76265630-76265652 GAGCCTGGCCGCCGCGGGGCCGG + Intronic
1152112497 17:78365079-78365101 CAGGCTCGCCGACCCGGGGGCGG + Intergenic
1152245706 17:79183556-79183578 CAGCCTCCCCGCCCGGGCAGGGG - Intronic
1152345334 17:79747676-79747698 CAGCCCCCGCGCCGCTGCGGTGG - Intergenic
1153514445 18:5891227-5891249 CAGCATCGCCGCCGCTCCGAAGG + Exonic
1157464312 18:47930841-47930863 TACCCGCGCGGCCGCGGCGGCGG - Intronic
1157867049 18:51196763-51196785 CACCCCCGCCGCCGCCGCCGCGG + Exonic
1159798050 18:72867628-72867650 CATCGTCGCCGCCGCGGGGTCGG + Exonic
1160910213 19:1470619-1470641 CAGCCTCGCCCCACCTGCGGCGG - Exonic
1160921798 19:1524145-1524167 CTGCGCCGCCGCCGCGGCCGGGG - Intronic
1160991601 19:1862580-1862602 CCGCGTCGCCGCCGCCGGGGTGG - Intronic
1161038032 19:2096299-2096321 CCGCCTCGCAGCCGCCGCGGAGG + Exonic
1161702367 19:5802514-5802536 CCCCCTCCCCGCCGCGGCTGGGG - Intergenic
1162033199 19:7926041-7926063 CGGCCTCTCCCCGGCGGCGGCGG + Exonic
1162953538 19:14085746-14085768 GAGCCGCGCCGCCGCGCCGGGGG + Exonic
1163158204 19:15450068-15450090 CCCCCTCGCCGCCCCGGGGGGGG + Intergenic
1163513077 19:17747714-17747736 CAGCCGCGCCGCAGCCGCGGAGG + Exonic
1163559377 19:18009913-18009935 CAGCCTCGCGGGCGAGCCGGTGG + Exonic
1164598624 19:29546646-29546668 CAGCCTCGCCGTCCCCGCTGGGG + Intronic
1164834537 19:31349248-31349270 CAGCCCGGCAGCGGCGGCGGCGG - Exonic
1165204521 19:34172457-34172479 AAGCCGCGGCGCGGCGGCGGCGG - Intergenic
1165946373 19:39445383-39445405 CAGCCTGGTCGCCGAGCCGGCGG + Intronic
1167103836 19:47419310-47419332 GCGCATCGCCGCCGGGGCGGGGG + Intronic
1167272069 19:48511442-48511464 CAGCGAGGCCGCCGCGGGGGTGG + Intronic
1167622690 19:50568130-50568152 CAGCCCCACCGCCGCCGCTGCGG - Intergenic
1168337009 19:55602637-55602659 CCGCCTCGCGGAAGCGGCGGGGG - Exonic
1168718987 19:58544642-58544664 CGGCCTCGCGGCGGCGGCGGCGG + Exonic
926083611 2:10007598-10007620 CAGCCTGGCCTCCGAGGAGGCGG - Intergenic
926130963 2:10302903-10302925 CAGGCGGGCCGCGGCGGCGGCGG + Intronic
927881455 2:26692704-26692726 CAGCTCCGCGGCGGCGGCGGCGG + Intronic
934296814 2:91749016-91749038 CACCCTCGCCGCCGCCGCCGCGG + Intergenic
935196640 2:100820234-100820256 GAGACCCGCAGCCGCGGCGGCGG + Exonic
935349691 2:102142703-102142725 TAGCCCCGCCGCTGCGGGGGCGG - Intronic
937221308 2:120344568-120344590 CCGCCTCCCCGCCGCCGCGCAGG - Intergenic
938397730 2:130963498-130963520 CAGGCTCGTCGCAGCCGCGGTGG - Intronic
941095603 2:161237621-161237643 CTGCCTCGCCTCGGCGGGGGTGG - Intergenic
942681279 2:178480367-178480389 CGGCCTCGCCGCCTAGCCGGAGG - Intergenic
943046473 2:182867095-182867117 CAGGGTCGCAGCCGCAGCGGCGG - Exonic
946865655 2:224039286-224039308 CAAGCTGGCTGCCGCGGCGGCGG + Intronic
947739141 2:232476959-232476981 CAAGCTCGCAGCCGAGGCGGGGG + Intergenic
948449576 2:238060877-238060899 CAGCCTCGCCTCCCCGCTGGGGG + Exonic
1169065483 20:2692619-2692641 CCGCCCCGCCGCCGCGGCCCGGG + Intergenic
1169093167 20:2873623-2873645 GAGCCCCGCGGCGGCGGCGGCGG - Intronic
1170150419 20:13221468-13221490 CTGCCTGGCGGCGGCGGCGGCGG - Intergenic
1174017621 20:47501759-47501781 CACCCTGGCTTCCGCGGCGGAGG - Intergenic
1176418924 21:6499024-6499046 CAGGCGGGCCGGCGCGGCGGTGG - Intergenic
1176547080 21:8206711-8206733 CACCCCCACCGCCGCGGAGGGGG - Intergenic
1176554985 21:8250920-8250942 CACCCCCACCGCCGCGGAGGGGG - Intergenic
1176566031 21:8389758-8389780 CACCCCCACCGCCGCGGAGGGGG - Intergenic
1176573907 21:8433944-8433966 CACCCCCACCGCCGCGGAGGGGG - Intergenic
1179694417 21:43107346-43107368 CAGGCGGGCCGGCGCGGCGGTGG - Intronic
1180064458 21:45405516-45405538 CGGCCTCGCCGCCCTGGCTGGGG + Intronic
1180154951 21:45973209-45973231 CAGCCTCGCAGCCGCCTCCGGGG + Intergenic
1181085158 22:20436480-20436502 GAGCCCCGCCTCCGGGGCGGGGG - Intronic
1181539578 22:23566248-23566270 CAGCCTGGCCTCCCCCGCGGGGG - Intergenic
1185055262 22:48575860-48575882 CTGGCCCGCCGCGGCGGCGGTGG + Intronic
1185278485 22:49960108-49960130 CAGCCTCGCAGCCCCGGCGGGGG - Intergenic
1203251955 22_KI270733v1_random:122996-123018 CACCCCCACCGCCGCGGAGGGGG - Intergenic
1203260008 22_KI270733v1_random:168078-168100 CACCCCCACCGCCGCGGAGGGGG - Intergenic
950509953 3:13420143-13420165 GAGCTTGGCCGCAGCGGCGGAGG + Exonic
950729766 3:14947541-14947563 CAGCCTCGCCGCCGCGGCGGGGG - Intergenic
953598349 3:44338533-44338555 CACCCTCCCCGCTCCGGCGGCGG - Exonic
953969569 3:47336611-47336633 CAGCCACGCCAACGCGGCTGCGG - Exonic
954202102 3:49029500-49029522 CCGCCTCGCTGCGGCGGGGGCGG + Intergenic
958900140 3:99876283-99876305 CTGCGCCGCCGCCGCGGCCGAGG - Intronic
960743087 3:120856292-120856314 CAGCCTGGCCTCCTCCGCGGGGG - Intergenic
962263205 3:133927776-133927798 CCGCCTCGCCCACCCGGCGGGGG + Intergenic
963706778 3:148698042-148698064 CAGCCGGGACGCCGAGGCGGCGG + Exonic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
965757415 3:172040309-172040331 CCGCCTCTCCGCGCCGGCGGGGG + Intronic
967493615 3:190120311-190120333 CATCCTCGCTGACGCGGTGGCGG + Exonic
967493776 3:190120986-190121008 CAGGCTCCCCGCTGCAGCGGCGG + Intronic
968372752 4:11005-11027 CCGCCGCGGCGCCGTGGCGGTGG + Intergenic
968548792 4:1212201-1212223 CAGCCTCGGCGCCTGGGCAGAGG - Exonic
968636664 4:1684428-1684450 CAGCCGCGCCGCGCCGACGGAGG + Intergenic
968835792 4:2963577-2963599 GCCCCTCGCCGCCGCGGCCGGGG - Intergenic
969582227 4:8072082-8072104 CAGACTCGCCTCCCCGGCAGAGG + Intronic
976146125 4:82044189-82044211 CTGCCCCGCGGCTGCGGCGGAGG + Intronic
976146130 4:82044194-82044216 CAGCCCCTCCGCCGCAGCCGCGG - Intronic
976390008 4:84497676-84497698 CAGCCCCAGCGCCGCGGCCGTGG - Exonic
977693883 4:99946627-99946649 CCGCCTCGCCTCCTCCGCGGCGG - Exonic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
982712208 4:158768947-158768969 CAGCCCCACGGCGGCGGCGGCGG - Intergenic
982745995 4:159104025-159104047 CAGCCAAACCGCGGCGGCGGCGG - Intergenic
983904435 4:173169209-173169231 CACCCGCGCTGCCGCGGCAGCGG + Intronic
985462642 4:190121561-190121583 CCGCCGCGGCGCCGTGGCGGGGG - Intergenic
985896353 5:2751791-2751813 CAGCCTCCGGGCCGCGGCCGGGG + Intergenic
987108658 5:14664723-14664745 CAGCCTCTCAGCCGCCGGGGCGG - Intronic
987373797 5:17217134-17217156 CAGCCCAGGCGGCGCGGCGGGGG + Intronic
988993045 5:36690142-36690164 CAGCCCCGCAGCCCCTGCGGCGG - Intergenic
989643192 5:43603161-43603183 CAGCCCCAACTCCGCGGCGGCGG - Intronic
992078901 5:73216142-73216164 CAGCATCGAGGGCGCGGCGGCGG + Intergenic
995106247 5:108381036-108381058 CAGCCCCGCTGCGGCGGCGGGGG - Exonic
997984485 5:138492024-138492046 GAGCCTCGCAGCCGCGGGCGGGG - Intergenic
998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG + Exonic
999326937 5:150649595-150649617 CAGCCCCGCGGCGGCGGAGGAGG + Exonic
1002498515 5:179632372-179632394 CTGCCTGGCCGCGGCGGGGGAGG - Intronic
1002591100 5:180292062-180292084 CAGACCGGGCGCCGCGGCGGCGG - Exonic
1003049418 6:2766056-2766078 CGCGCTCCCCGCCGCGGCGGCGG - Exonic
1003482480 6:6546328-6546350 CGGCCTCCCCTCCGCGGCTGCGG - Intergenic
1003869406 6:10390302-10390324 CAGCCTCCCCGCCCCCGCCGGGG + Intergenic
1005705451 6:28447169-28447191 CAGCATTGCAGCCGCCGCGGCGG + Intergenic
1006472507 6:34236740-34236762 CACCCGCGCGGCAGCGGCGGCGG + Intergenic
1015799207 6:137044234-137044256 CCTCCGCGCGGCCGCGGCGGTGG + Intronic
1019290821 7:249229-249251 CAGCCACTTCGCCGAGGCGGGGG - Intronic
1019474250 7:1236436-1236458 CAGCCCCGCGGCGGCGGCGGCGG - Exonic
1020281633 7:6653097-6653119 CAGCGCCACCGACGCGGCGGGGG + Exonic
1020418126 7:7969162-7969184 CCCCCTCGCCGAGGCGGCGGGGG + Exonic
1020418128 7:7969164-7969186 CACCCCCGCCGCCTCGGCGAGGG - Exonic
1021600224 7:22356988-22357010 GGCCCTGGCCGCCGCGGCGGCGG - Intronic
1022100658 7:27167133-27167155 CAGCCTCGCCGCCAGGGAAGTGG - Intronic
1022715065 7:32891599-32891621 CGCCCCCGCCGCCGCGCCGGAGG - Exonic
1023773746 7:43583520-43583542 CAGCCTCGCCGCCGCGGCGCCGG - Intronic
1026114859 7:67487556-67487578 CAGCCTCTCCTCCGCGGGTGTGG + Intergenic
1026765265 7:73155756-73155778 CGGCCCCGTCGCCACGGCGGGGG + Intergenic
1026923666 7:74174301-74174323 CAGCCCCGGCGGCGGGGCGGGGG + Exonic
1027041739 7:74965512-74965534 CGGCCCCGTCGCCACGGCGGGGG + Intronic
1027081903 7:75236857-75236879 CGGCCCCGTCGCCACGGCGGGGG - Intergenic
1029927010 7:104328805-104328827 GAGCATCGCGGCGGCGGCGGCGG - Exonic
1031629730 7:124032556-124032578 CAGCCTGGGCGGCGGGGCGGGGG - Exonic
1034441399 7:151087561-151087583 CCGCTTGGCCGCCGCGGCGTAGG - Intronic
1035212359 7:157337413-157337435 CGGCCCAGCCTCCGCGGCGGCGG + Intronic
1036206119 8:6806690-6806712 CAGCCTCGCCCCCGGGCAGGTGG + Intergenic
1045564364 8:103298795-103298817 CGGGCTCGCGGCGGCGGCGGCGG - Intronic
1047400024 8:124538655-124538677 CAGCCTCTCCGCCAAGGCAGAGG + Intronic
1049628256 8:143636329-143636351 CAGCCTCGCGGGGGCGGCCGTGG - Intronic
1049936315 9:504598-504620 CGGCTTCCCCGCCCCGGCGGCGG + Intronic
1051855428 9:21559637-21559659 CGGCTTCGGCGCCGCGGCCGGGG + Intergenic
1052941499 9:34134752-34134774 CAGCAGCGCGGCAGCGGCGGCGG - Intergenic
1057245535 9:93451687-93451709 CGGCCTCGCAGCGGCGGCAGCGG + Intronic
1060700632 9:125747001-125747023 CCGCCTGGCCGAGGCGGCGGCGG + Intergenic
1061128244 9:128689842-128689864 CAGCGCGGCCGCCGCGGCGCGGG - Intronic
1061365785 9:130172093-130172115 GGCCCTCCCCGCCGCGGCGGGGG + Intergenic
1061366152 9:130173145-130173167 CAATCTCGCAGCAGCGGCGGCGG - Intronic
1203468358 Un_GL000220v1:106146-106168 CACCCCCACCGCCGCGGAGGGGG - Intergenic
1203476179 Un_GL000220v1:150118-150140 CACCCCCACCGCCGCGGAGGGGG - Intergenic
1190285306 X:48957470-48957492 CCGCCGCGCCGCGGCGCCGGGGG + Exonic
1191184158 X:57592286-57592308 CAACCTAGCGGCGGCGGCGGCGG + Exonic
1193130095 X:77910648-77910670 GCGGCTGGCCGCCGCGGCGGGGG + Intronic
1195668348 X:107449912-107449934 CAGCGGCGGCGCAGCGGCGGCGG - Intergenic
1199766660 X:150946448-150946470 CAGCCTAGCAGCCGTGGCAGAGG - Intergenic
1200418387 Y:2935999-2936021 CAGACACGCCGTCGCGCCGGAGG - Intronic